Incidental Mutation 'R2136:Cln3'
ID235819
Institutional Source Beutler Lab
Gene Symbol Cln3
Ensembl Gene ENSMUSG00000030720
Gene Nameceroid lipofuscinosis, neuronal 3, juvenile (Batten, Spielmeyer-Vogt disease)
Synonymsbattenin
MMRRC Submission 040139-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2136 (G1)
Quality Score198
Status Not validated
Chromosome7
Chromosomal Location126571207-126585817 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 126582799 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 30 (S30R)
Ref Sequence ENSEMBL: ENSMUSP00000114555 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032962] [ENSMUST00000039522] [ENSMUST00000084589] [ENSMUST00000098036] [ENSMUST00000116269] [ENSMUST00000125508] [ENSMUST00000128970] [ENSMUST00000131860] [ENSMUST00000137646] [ENSMUST00000138558] [ENSMUST00000144173] [ENSMUST00000147086] [ENSMUST00000150311] [ENSMUST00000150587] [ENSMUST00000150917]
Predicted Effect probably benign
Transcript: ENSMUST00000032962
AA Change: S30R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000032962
Gene: ENSMUSG00000030720
AA Change: S30R

DomainStartEndE-ValueType
Pfam:CLN3 37 438 3.5e-215 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000039522
SMART Domains Protein: ENSMUSP00000042028
Gene: ENSMUSG00000042759

DomainStartEndE-ValueType
low complexity region 45 59 N/A INTRINSIC
low complexity region 171 181 N/A INTRINSIC
low complexity region 351 363 N/A INTRINSIC
low complexity region 381 396 N/A INTRINSIC
low complexity region 465 476 N/A INTRINSIC
low complexity region 588 608 N/A INTRINSIC
low complexity region 837 862 N/A INTRINSIC
low complexity region 869 881 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000084589
AA Change: S30R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000081636
Gene: ENSMUSG00000030720
AA Change: S30R

DomainStartEndE-ValueType
Pfam:CLN3 37 438 3.5e-215 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000098036
AA Change: S30R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000095644
Gene: ENSMUSG00000030720
AA Change: S30R

DomainStartEndE-ValueType
Pfam:CLN3 37 414 4.3e-191 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000116269
AA Change: S30R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000111973
Gene: ENSMUSG00000030720
AA Change: S30R

DomainStartEndE-ValueType
Pfam:CLN3 39 437 1.6e-140 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124177
Predicted Effect probably benign
Transcript: ENSMUST00000125508
AA Change: S30R

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000117561
Gene: ENSMUSG00000030720
AA Change: S30R

DomainStartEndE-ValueType
Pfam:CLN3 37 76 1.2e-17 PFAM
Pfam:CLN3 73 151 2.8e-38 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128049
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128225
Predicted Effect probably benign
Transcript: ENSMUST00000128970
AA Change: S30R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000114901
Gene: ENSMUSG00000030720
AA Change: S30R

DomainStartEndE-ValueType
Pfam:CLN3 37 196 1.2e-87 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000131860
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134246
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134406
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134498
Predicted Effect probably benign
Transcript: ENSMUST00000137646
Predicted Effect probably benign
Transcript: ENSMUST00000138558
Predicted Effect probably benign
Transcript: ENSMUST00000144173
Predicted Effect probably benign
Transcript: ENSMUST00000147086
AA Change: S30R

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect probably benign
Transcript: ENSMUST00000150311
AA Change: S30R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000116160
Gene: ENSMUSG00000030720
AA Change: S30R

DomainStartEndE-ValueType
Pfam:CLN3 37 69 1.5e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000150587
AA Change: S30R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000118054
Gene: ENSMUSG00000030720
AA Change: S30R

DomainStartEndE-ValueType
Pfam:CLN3 37 70 4.1e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000150917
AA Change: S30R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000138688
Gene: ENSMUSG00000030720
AA Change: S30R

DomainStartEndE-ValueType
Pfam:CLN3 37 77 1.6e-18 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153790
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184825
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 95.9%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a transmembrane protein called battenin that is involved in lysosomal function. Mutations in this, as well as other neuronal ceroid-lipofuscinosis genes, cause a number of neurodegenerative diseases collectively known as neuronal ceroid lipofuscinoses, the most common of which is juvenile neuronal ceroid-lipofuscinosis (Batten disease). Alternate splicing results in multiple transcript variants. [provided by RefSeq, Aug 2016]
PHENOTYPE: Nullizygous mutations can result in neuronal ceroid lipofuscinosis, degeneration of the retina, cerebral cortex and cerebellum, hypertrophy of hippocampal interneuron populations, gliosis, neurological deficits, and premature death. Homozygotes for a null allele show impaired water and K+ balance. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210010C04Rik A G 6: 41,035,462 F6S probably benign Het
2810474O19Rik T A 6: 149,328,822 I1122K probably benign Het
A930003A15Rik T G 16: 19,883,780 noncoding transcript Het
Abca5 T C 11: 110,319,832 T174A probably benign Het
Abcg3 G A 5: 104,966,814 S279L probably benign Het
Acap3 T C 4: 155,896,912 L85P probably damaging Het
Adgrl3 A G 5: 81,512,254 K290R probably damaging Het
Ankhd1 A G 18: 36,647,621 T1909A probably benign Het
Asap1 T C 15: 64,110,959 D832G probably damaging Het
Atp6v0a2 T A 5: 124,718,488 L702Q possibly damaging Het
Bsn A G 9: 108,113,231 V1774A probably damaging Het
Cd209e T C 8: 3,853,248 E48G probably benign Het
Cdadc1 T C 14: 59,568,044 probably null Het
Cfap65 C CA 1: 74,917,273 probably null Het
Cluap1 C T 16: 3,933,772 R332W probably damaging Het
Crb1 A T 1: 139,337,425 V85E probably benign Het
Crocc G A 4: 141,032,954 R789W probably damaging Het
Cwh43 A G 5: 73,415,054 I212V probably benign Het
Cyp2t4 C A 7: 27,158,160 F391L probably benign Het
Dhx35 G T 2: 158,831,861 R404L probably damaging Het
Disp1 A G 1: 183,088,378 L826S probably damaging Het
Dync2h1 T A 9: 7,122,772 E2061D probably damaging Het
Ep300 T A 15: 81,640,447 Y1393N unknown Het
Fap C T 2: 62,524,207 G446D possibly damaging Het
Fat3 A G 9: 16,377,051 I392T probably benign Het
Fpr-rs4 CAGGAA CA 17: 18,022,334 probably null Het
Glipr1l1 T C 10: 112,060,476 V56A probably damaging Het
Grsf1 A G 5: 88,672,658 V7A probably benign Het
Hmcn1 G A 1: 150,633,659 A3646V probably damaging Het
Ipo9 A T 1: 135,394,285 I569N probably damaging Het
Irs1 G T 1: 82,290,042 P151Q probably damaging Het
Kalrn T C 16: 34,307,724 D491G possibly damaging Het
Kctd7 T C 5: 130,152,366 L210P probably damaging Het
Lifr C A 15: 7,181,857 D625E possibly damaging Het
Lrguk T C 6: 34,043,519 V201A probably benign Het
Mark1 A G 1: 184,919,573 V135A probably damaging Het
Mical2 T A 7: 112,271,515 D70E possibly damaging Het
Mrc1 T C 2: 14,270,189 Y434H probably damaging Het
Myh10 C A 11: 68,804,714 Q1556K probably damaging Het
Nav1 G A 1: 135,454,436 T1400I probably null Het
Olfr1173 T C 2: 88,274,240 K270E probably damaging Het
Olfr1178 T A 2: 88,391,319 I24N probably benign Het
Olfr1289 T C 2: 111,483,616 V62A probably damaging Het
Olfr13 A G 6: 43,174,501 K172E probably benign Het
Olfr142 A C 2: 90,252,253 V245G probably damaging Het
Olfr339 A G 2: 36,421,938 D180G probably damaging Het
Olfr513 G A 7: 108,755,223 M122I possibly damaging Het
Osmr T A 15: 6,852,462 Q67L probably damaging Het
Pan2 T G 10: 128,313,637 V522G possibly damaging Het
Pard3 T G 8: 127,376,885 probably null Het
Pcdhgc5 G T 18: 37,820,113 A147S possibly damaging Het
Pcsk9 T C 4: 106,446,770 I506V probably benign Het
Polr3d GCCCCC GCCCC 14: 70,443,047 probably null Het
Prdm4 G A 10: 85,893,351 R731* probably null Het
Prdx6b T A 2: 80,293,163 D105E probably damaging Het
Rab42 A G 4: 132,302,479 L144P probably damaging Het
Ralbp1 T A 17: 65,864,666 K104M probably damaging Het
Rrp12 A G 19: 41,892,599 V131A probably damaging Het
Sbno1 C T 5: 124,387,534 probably null Het
Sbno2 A T 10: 80,062,693 I645N probably damaging Het
Scfd2 T C 5: 74,206,367 K624R probably benign Het
Sgk2 C A 2: 162,999,179 probably null Het
Sirt4 A G 5: 115,479,701 S299P probably benign Het
Slit2 C T 5: 48,304,225 A1521V probably benign Het
Socs7 T G 11: 97,373,107 V275G possibly damaging Het
Spink11 G A 18: 44,190,487 P102S probably benign Het
Tacc3 A G 5: 33,671,404 N534D probably damaging Het
Tas2r115 T C 6: 132,737,346 Y214C probably damaging Het
Tcaf1 A T 6: 42,673,520 M875K probably benign Het
Ttc22 T A 4: 106,622,672 L41Q possibly damaging Het
Ttc37 T C 13: 76,173,354 S1322P possibly damaging Het
Vasn T A 16: 4,649,795 C535* probably null Het
Vcan T A 13: 89,689,737 I2563F probably damaging Het
Vmn2r63 T G 7: 42,926,873 Q505H probably damaging Het
Vmn2r65 T G 7: 84,943,573 Q475H probably damaging Het
Zbtb43 T C 2: 33,454,520 Y231C probably damaging Het
Zfp292 A G 4: 34,810,266 V931A probably benign Het
Other mutations in Cln3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01084:Cln3 APN 7 126575254 missense probably damaging 1.00
IGL01603:Cln3 APN 7 126575354 missense probably benign 0.30
IGL02216:Cln3 APN 7 126575342 critical splice donor site probably null
IGL02440:Cln3 APN 7 126582782 missense probably benign 0.01
IGL03118:Cln3 APN 7 126575397 missense probably null 0.00
R0326:Cln3 UTSW 7 126583045 start codon destroyed probably damaging 0.96
R0610:Cln3 UTSW 7 126580189 missense probably damaging 1.00
R1256:Cln3 UTSW 7 126583036 missense probably damaging 0.98
R2202:Cln3 UTSW 7 126579218 missense probably benign 0.11
R3977:Cln3 UTSW 7 126580136 splice site probably benign
R4563:Cln3 UTSW 7 126572558 missense probably damaging 0.98
R4690:Cln3 UTSW 7 126575393 missense possibly damaging 0.61
R4936:Cln3 UTSW 7 126575221 missense probably damaging 1.00
R5668:Cln3 UTSW 7 126572386 missense probably benign 0.01
R5726:Cln3 UTSW 7 126575501 missense probably null 0.00
R6385:Cln3 UTSW 7 126575035 missense probably null 1.00
R6591:Cln3 UTSW 7 126579434 missense possibly damaging 0.82
R6691:Cln3 UTSW 7 126579434 missense possibly damaging 0.82
R6891:Cln3 UTSW 7 126582803 missense possibly damaging 0.88
R7173:Cln3 UTSW 7 126579417 missense probably damaging 1.00
R7214:Cln3 UTSW 7 126582770 missense probably damaging 1.00
R7426:Cln3 UTSW 7 126581740 missense probably benign 0.31
R7520:Cln3 UTSW 7 126581680 missense probably damaging 1.00
R7556:Cln3 UTSW 7 126575070 missense probably damaging 0.97
R7761:Cln3 UTSW 7 126581714 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACTGCTTTTCACAACTTGGC -3'
(R):5'- TTGGGAATGACCACCTCTGC -3'

Sequencing Primer
(F):5'- TGGCTGTCCTGGAACTCAC -3'
(R):5'- GACCACCTCTGCCCGCG -3'
Posted On2014-10-01