Mutagenetix > Incidental Mutations

Incidental Mutation 'R2136:Cd209e'

235821

Institutional Source

Beutler Lab

Gene Symbol

Cd209e

Ensembl Gene

ENSMUSG00000040197

Gene Name

CD209e antigen

Synonyms

mSIGNR4, SIGNR4

MMRRC Submission

040139-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.048) question?

Stock #

R2136 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

3847965-3854309 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 3853248 bp

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 48 (E48G)

Ref Sequence

ENSEMBL: ENSMUSP00000033888 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000033888]

Predicted Effect

probably benign
Transcript: ENSMUST00000033888
AA Change: E48G

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)

SMART Domains

Protein: ENSMUSP00000033888
Gene: ENSMUSG00000040197
AA Change: E48G

Domain	Start	End	E-Value	Type
transmembrane domain	15	37	N/A	INTRINSIC
CLECT	77	198	4.01e-33	SMART

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.6%
20x: 95.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transmembrane receptor and is often referred to as DC-SIGN because of its expression on the surface of dendritic cells and macrophages. The encoded protein is involved in the innate immune system and recognizes numerous evolutionarily divergent pathogens ranging from parasites to viruses with a large impact on public health. The protein is organized into three distinct domains: an N-terminal transmembrane domain, a tandem-repeat neck domain and C-type lectin carbohydrate recognition domain. The extracellular region consisting of the C-type lectin and neck domains has a dual function as a pathogen recognition receptor and a cell adhesion receptor by binding carbohydrate ligands on the surface of microbes and endogenous cells. The neck region is important for homo-oligomerization which allows the receptor to bind multivalent ligands with high avidity. Variations in the number of 23 amino acid repeats in the neck domain of this protein are rare but have a significant impact on ligand binding ability. This gene is closely related in terms of both sequence and function to a neighboring gene (GeneID 10332; often referred to as L-SIGN). DC-SIGN and L-SIGN differ in their ligand-binding properties and distribution. Alternative splicing results in multiple variants.[provided by RefSeq, Feb 2009]

Allele List at MGI

Other mutations in this stock

Total: 77 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2210010C04Rik	A	G	6: 41,035,462	F6S	probably benign	Het
2810474O19Rik	T	A	6: 149,328,822	I1122K	probably benign	Het
A930003A15Rik	T	G	16: 19,883,780		noncoding transcript	Het
Abca5	T	C	11: 110,319,832	T174A	probably benign	Het
Abcg3	G	A	5: 104,966,814	S279L	probably benign	Het
Acap3	T	C	4: 155,896,912	L85P	probably damaging	Het
Adgrl3	A	G	5: 81,512,254	K290R	probably damaging	Het
Ankhd1	A	G	18: 36,647,621	T1909A	probably benign	Het
Asap1	T	C	15: 64,110,959	D832G	probably damaging	Het
Atp6v0a2	T	A	5: 124,718,488	L702Q	possibly damaging	Het
Bsn	A	G	9: 108,113,231	V1774A	probably damaging	Het
Cdadc1	T	C	14: 59,568,044		probably null	Het
Cfap65	C	CA	1: 74,917,273		probably null	Het
Cln3	A	C	7: 126,582,799	S30R	probably benign	Het
Cluap1	C	T	16: 3,933,772	R332W	probably damaging	Het
Crb1	A	T	1: 139,337,425	V85E	probably benign	Het
Crocc	G	A	4: 141,032,954	R789W	probably damaging	Het
Cwh43	A	G	5: 73,415,054	I212V	probably benign	Het
Cyp2t4	C	A	7: 27,158,160	F391L	probably benign	Het
Dhx35	G	T	2: 158,831,861	R404L	probably damaging	Het
Disp1	A	G	1: 183,088,378	L826S	probably damaging	Het
Dync2h1	T	A	9: 7,122,772	E2061D	probably damaging	Het
Ep300	T	A	15: 81,640,447	Y1393N	unknown	Het
Fap	C	T	2: 62,524,207	G446D	possibly damaging	Het
Fat3	A	G	9: 16,377,051	I392T	probably benign	Het
Fpr-rs4	CAGGAA	CA	17: 18,022,334		probably null	Het
Glipr1l1	T	C	10: 112,060,476	V56A	probably damaging	Het
Grsf1	A	G	5: 88,672,658	V7A	probably benign	Het
Hmcn1	G	A	1: 150,633,659	A3646V	probably damaging	Het
Ipo9	A	T	1: 135,394,285	I569N	probably damaging	Het
Irs1	G	T	1: 82,290,042	P151Q	probably damaging	Het
Kalrn	T	C	16: 34,307,724	D491G	possibly damaging	Het
Kctd7	T	C	5: 130,152,366	L210P	probably damaging	Het
Lifr	C	A	15: 7,181,857	D625E	possibly damaging	Het
Lrguk	T	C	6: 34,043,519	V201A	probably benign	Het
Mark1	A	G	1: 184,919,573	V135A	probably damaging	Het
Mical2	T	A	7: 112,271,515	D70E	possibly damaging	Het
Mrc1	T	C	2: 14,270,189	Y434H	probably damaging	Het
Myh10	C	A	11: 68,804,714	Q1556K	probably damaging	Het
Nav1	G	A	1: 135,454,436	T1400I	probably null	Het
Olfr1173	T	C	2: 88,274,240	K270E	probably damaging	Het
Olfr1178	T	A	2: 88,391,319	I24N	probably benign	Het
Olfr1289	T	C	2: 111,483,616	V62A	probably damaging	Het
Olfr13	A	G	6: 43,174,501	K172E	probably benign	Het
Olfr142	A	C	2: 90,252,253	V245G	probably damaging	Het
Olfr339	A	G	2: 36,421,938	D180G	probably damaging	Het
Olfr513	G	A	7: 108,755,223	M122I	possibly damaging	Het
Osmr	T	A	15: 6,852,462	Q67L	probably damaging	Het
Pan2	T	G	10: 128,313,637	V522G	possibly damaging	Het
Pard3	T	G	8: 127,376,885		probably null	Het
Pcdhgc5	G	T	18: 37,820,113	A147S	possibly damaging	Het
Pcsk9	T	C	4: 106,446,770	I506V	probably benign	Het
Polr3d	GCCCCC	GCCCC	14: 70,443,047		probably null	Het
Prdm4	G	A	10: 85,893,351	R731*	probably null	Het
Prdx6b	T	A	2: 80,293,163	D105E	probably damaging	Het
Rab42	A	G	4: 132,302,479	L144P	probably damaging	Het
Ralbp1	T	A	17: 65,864,666	K104M	probably damaging	Het
Rrp12	A	G	19: 41,892,599	V131A	probably damaging	Het
Sbno1	C	T	5: 124,387,534		probably null	Het
Sbno2	A	T	10: 80,062,693	I645N	probably damaging	Het
Scfd2	T	C	5: 74,206,367	K624R	probably benign	Het
Sgk2	C	A	2: 162,999,179		probably null	Het
Sirt4	A	G	5: 115,479,701	S299P	probably benign	Het
Slit2	C	T	5: 48,304,225	A1521V	probably benign	Het
Socs7	T	G	11: 97,373,107	V275G	possibly damaging	Het
Spink11	G	A	18: 44,190,487	P102S	probably benign	Het
Tacc3	A	G	5: 33,671,404	N534D	probably damaging	Het
Tas2r115	T	C	6: 132,737,346	Y214C	probably damaging	Het
Tcaf1	A	T	6: 42,673,520	M875K	probably benign	Het
Ttc22	T	A	4: 106,622,672	L41Q	possibly damaging	Het
Ttc37	T	C	13: 76,173,354	S1322P	possibly damaging	Het
Vasn	T	A	16: 4,649,795	C535*	probably null	Het
Vcan	T	A	13: 89,689,737	I2563F	probably damaging	Het
Vmn2r63	T	G	7: 42,926,873	Q505H	probably damaging	Het
Vmn2r65	T	G	7: 84,943,573	Q475H	probably damaging	Het
Zbtb43	T	C	2: 33,454,520	Y231C	probably damaging	Het
Zfp292	A	G	4: 34,810,266	V931A	probably benign	Het

Other mutations in Cd209e

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00833:Cd209e	APN	8	3852800	missense	probably benign	0.05
IGL00920:Cd209e	APN	8	3849187	missense	probably damaging	1.00
IGL01132:Cd209e	APN	8	3851274	missense	probably benign	0.18
IGL02499:Cd209e	APN	8	3854238	missense	probably benign
R0124:Cd209e	UTSW	8	3851274	missense	probably benign	0.08
R0268:Cd209e	UTSW	8	3849125	missense	probably benign	0.34
R0540:Cd209e	UTSW	8	3851265	missense	probably benign	0.04
R0744:Cd209e	UTSW	8	3853205	missense	probably benign	0.00
R0836:Cd209e	UTSW	8	3853205	missense	probably benign	0.00
R1241:Cd209e	UTSW	8	3849124	missense	probably damaging	0.99
R1367:Cd209e	UTSW	8	3849084	makesense	probably null
R2040:Cd209e	UTSW	8	3849158	missense	probably damaging	1.00
R4787:Cd209e	UTSW	8	3851181	missense	probably null	0.69
R6283:Cd209e	UTSW	8	3849212	nonsense	probably null
R6338:Cd209e	UTSW	8	3849154	missense	probably damaging	1.00
R6894:Cd209e	UTSW	8	3853569	missense	possibly damaging	0.48
Z1176:Cd209e	UTSW	8	3849196	missense	probably benign	0.30
Z1177:Cd209e	UTSW	8	3851181	missense	probably null	0.99

Predicted Primers

PCR Primer
(F):5'- CTTTCTCCACAGTTGGCAGAAG -3'
(R):5'- GAACAACGGGTCTTTCAGCAG -3'

Sequencing Primer
(F):5'- TCTCCACAGTTGGCAGAAGATTAG -3'
(R):5'- TAGCAGCTTCGTGGAACCC -3'

Posted On

2014-10-01