Mutagenetix > Incidental Mutation

Incidental Mutation 'R2136:Bsn'

235825

Institutional Source

Beutler Lab

Gene Symbol

Bsn

Ensembl Gene

ENSMUSG00000032589

Gene Name

bassoon

Synonyms

presynaptic cytomatrix protein

MMRRC Submission

040139-MU

Accession Numbers

Genbank: NM_007567; MGI: 1277955

Essential gene?

Possibly non essential (E-score: 0.383) question?

Stock #

R2136 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

108096022-108190384 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 108113231 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 1774 (V1774A)

Ref Sequence

ENSEMBL: ENSMUSP00000035208 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000035208]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000035208
AA Change: V1774A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000035208
Gene: ENSMUSG00000032589
AA Change: V1774A

Domain	Start	End	E-Value	Type
low complexity region	4	40	N/A	INTRINSIC
low complexity region	42	77	N/A	INTRINSIC
Pfam:zf-piccolo	165	223	6.1e-30	PFAM
low complexity region	394	409	N/A	INTRINSIC
low complexity region	445	454	N/A	INTRINSIC
Pfam:zf-piccolo	462	520	5.2e-31	PFAM
low complexity region	527	540	N/A	INTRINSIC
low complexity region	627	643	N/A	INTRINSIC
low complexity region	664	681	N/A	INTRINSIC
low complexity region	694	708	N/A	INTRINSIC
low complexity region	788	803	N/A	INTRINSIC
low complexity region	994	1021	N/A	INTRINSIC
coiled coil region	1047	1101	N/A	INTRINSIC
low complexity region	1131	1145	N/A	INTRINSIC
low complexity region	1173	1190	N/A	INTRINSIC
low complexity region	1209	1220	N/A	INTRINSIC
low complexity region	1333	1343	N/A	INTRINSIC
low complexity region	1443	1455	N/A	INTRINSIC
low complexity region	1481	1498	N/A	INTRINSIC
low complexity region	1790	1800	N/A	INTRINSIC
low complexity region	2117	2126	N/A	INTRINSIC
low complexity region	2287	2303	N/A	INTRINSIC
low complexity region	2326	2356	N/A	INTRINSIC
SCOP:d1eq1a_	2362	2477	2e-7	SMART
low complexity region	2607	2614	N/A	INTRINSIC
low complexity region	2635	2651	N/A	INTRINSIC
low complexity region	2655	2672	N/A	INTRINSIC
coiled coil region	2949	2990	N/A	INTRINSIC
low complexity region	3057	3071	N/A	INTRINSIC
low complexity region	3089	3114	N/A	INTRINSIC
low complexity region	3446	3461	N/A	INTRINSIC
low complexity region	3520	3534	N/A	INTRINSIC
low complexity region	3653	3666	N/A	INTRINSIC
low complexity region	3750	3820	N/A	INTRINSIC
low complexity region	3831	3852	N/A	INTRINSIC
low complexity region	3856	3901	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000124763

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.6%
20x: 95.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Neurotransmitters are released from a specific site in the axon terminal called the active zone, which is composed of synaptic vesicles and a meshwork of cytoskeleton underlying the plasma membrane. The protein encoded by this gene is thought to be a scaffolding protein involved in organizing the presynaptic cytoskeleton. The gene is expressed primarily in neurons in the brain. A similar gene product in rodents is concentrated in the active zone of axon terminals and tightly associated with cytoskeletal structures, and is essential for regulating neurotransmitter release from a subset of synapses. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutants lacking functional protein exhibit impaired hippocampal and photoreceptor synaptic transmission, aberrant photoreceptor ribbon synapse formation, and spontaneous epileptic seizures. [provided by MGI curators]

Allele List at MGI

All alleles(9) : Targeted, other(1) Gene trapped(8)

Other mutations in this stock

Total: 77 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2210010C04Rik	A	G	6: 41,035,462	F6S	probably benign	Het
2810474O19Rik	T	A	6: 149,328,822	I1122K	probably benign	Het
A930003A15Rik	T	G	16: 19,883,780		noncoding transcript	Het
Abca5	T	C	11: 110,319,832	T174A	probably benign	Het
Abcg3	G	A	5: 104,966,814	S279L	probably benign	Het
Acap3	T	C	4: 155,896,912	L85P	probably damaging	Het
Adgrl3	A	G	5: 81,512,254	K290R	probably damaging	Het
Ankhd1	A	G	18: 36,647,621	T1909A	probably benign	Het
Asap1	T	C	15: 64,110,959	D832G	probably damaging	Het
Atp6v0a2	T	A	5: 124,718,488	L702Q	possibly damaging	Het
Cd209e	T	C	8: 3,853,248	E48G	probably benign	Het
Cdadc1	T	C	14: 59,568,044		probably null	Het
Cfap65	C	CA	1: 74,917,273		probably null	Het
Cln3	A	C	7: 126,582,799	S30R	probably benign	Het
Cluap1	C	T	16: 3,933,772	R332W	probably damaging	Het
Crb1	A	T	1: 139,337,425	V85E	probably benign	Het
Crocc	G	A	4: 141,032,954	R789W	probably damaging	Het
Cwh43	A	G	5: 73,415,054	I212V	probably benign	Het
Cyp2t4	C	A	7: 27,158,160	F391L	probably benign	Het
Dhx35	G	T	2: 158,831,861	R404L	probably damaging	Het
Disp1	A	G	1: 183,088,378	L826S	probably damaging	Het
Dync2h1	T	A	9: 7,122,772	E2061D	probably damaging	Het
Ep300	T	A	15: 81,640,447	Y1393N	unknown	Het
Fap	C	T	2: 62,524,207	G446D	possibly damaging	Het
Fat3	A	G	9: 16,377,051	I392T	probably benign	Het
Fpr-rs4	CAGGAA	CA	17: 18,022,334		probably null	Het
Glipr1l1	T	C	10: 112,060,476	V56A	probably damaging	Het
Grsf1	A	G	5: 88,672,658	V7A	probably benign	Het
Hmcn1	G	A	1: 150,633,659	A3646V	probably damaging	Het
Ipo9	A	T	1: 135,394,285	I569N	probably damaging	Het
Irs1	G	T	1: 82,290,042	P151Q	probably damaging	Het
Kalrn	T	C	16: 34,307,724	D491G	possibly damaging	Het
Kctd7	T	C	5: 130,152,366	L210P	probably damaging	Het
Lifr	C	A	15: 7,181,857	D625E	possibly damaging	Het
Lrguk	T	C	6: 34,043,519	V201A	probably benign	Het
Mark1	A	G	1: 184,919,573	V135A	probably damaging	Het
Mical2	T	A	7: 112,271,515	D70E	possibly damaging	Het
Mrc1	T	C	2: 14,270,189	Y434H	probably damaging	Het
Myh10	C	A	11: 68,804,714	Q1556K	probably damaging	Het
Nav1	G	A	1: 135,454,436	T1400I	probably null	Het
Olfr1173	T	C	2: 88,274,240	K270E	probably damaging	Het
Olfr1178	T	A	2: 88,391,319	I24N	probably benign	Het
Olfr1289	T	C	2: 111,483,616	V62A	probably damaging	Het
Olfr13	A	G	6: 43,174,501	K172E	probably benign	Het
Olfr142	A	C	2: 90,252,253	V245G	probably damaging	Het
Olfr339	A	G	2: 36,421,938	D180G	probably damaging	Het
Olfr513	G	A	7: 108,755,223	M122I	possibly damaging	Het
Osmr	T	A	15: 6,852,462	Q67L	probably damaging	Het
Pan2	T	G	10: 128,313,637	V522G	possibly damaging	Het
Pard3	T	G	8: 127,376,885		probably null	Het
Pcdhgc5	G	T	18: 37,820,113	A147S	possibly damaging	Het
Pcsk9	T	C	4: 106,446,770	I506V	probably benign	Het
Polr3d	GCCCCC	GCCCC	14: 70,443,047		probably null	Het
Prdm4	G	A	10: 85,893,351	R731*	probably null	Het
Prdx6b	T	A	2: 80,293,163	D105E	probably damaging	Het
Rab42	A	G	4: 132,302,479	L144P	probably damaging	Het
Ralbp1	T	A	17: 65,864,666	K104M	probably damaging	Het
Rrp12	A	G	19: 41,892,599	V131A	probably damaging	Het
Sbno1	C	T	5: 124,387,534		probably null	Het
Sbno2	A	T	10: 80,062,693	I645N	probably damaging	Het
Scfd2	T	C	5: 74,206,367	K624R	probably benign	Het
Sgk2	C	A	2: 162,999,179		probably null	Het
Sirt4	A	G	5: 115,479,701	S299P	probably benign	Het
Slit2	C	T	5: 48,304,225	A1521V	probably benign	Het
Socs7	T	G	11: 97,373,107	V275G	possibly damaging	Het
Spink11	G	A	18: 44,190,487	P102S	probably benign	Het
Tacc3	A	G	5: 33,671,404	N534D	probably damaging	Het
Tas2r115	T	C	6: 132,737,346	Y214C	probably damaging	Het
Tcaf1	A	T	6: 42,673,520	M875K	probably benign	Het
Ttc22	T	A	4: 106,622,672	L41Q	possibly damaging	Het
Ttc37	T	C	13: 76,173,354	S1322P	possibly damaging	Het
Vasn	T	A	16: 4,649,795	C535*	probably null	Het
Vcan	T	A	13: 89,689,737	I2563F	probably damaging	Het
Vmn2r63	T	G	7: 42,926,873	Q505H	probably damaging	Het
Vmn2r65	T	G	7: 84,943,573	Q475H	probably damaging	Het
Zbtb43	T	C	2: 33,454,520	Y231C	probably damaging	Het
Zfp292	A	G	4: 34,810,266	V931A	probably benign	Het

Other mutations in Bsn

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00161:Bsn	APN	9	108115110	missense	probably benign	0.01
IGL00330:Bsn	APN	9	108115340	missense	probably damaging	1.00
IGL00863:Bsn	APN	9	108115322	missense	probably damaging	1.00
IGL01123:Bsn	APN	9	108115986	missense	probably damaging	1.00
IGL01330:Bsn	APN	9	108110913	unclassified	probably benign
IGL01336:Bsn	APN	9	108111785	missense	probably damaging	0.99
IGL01399:Bsn	APN	9	108107187	missense	unknown
IGL01683:Bsn	APN	9	108114896	missense	possibly damaging	0.71
IGL02022:Bsn	APN	9	108110418	unclassified	probably benign
IGL02396:Bsn	APN	9	108116046	missense	possibly damaging	0.90
IGL02538:Bsn	APN	9	108105236	missense	unknown
IGL02565:Bsn	APN	9	108113288	missense	probably damaging	0.99
IGL02661:Bsn	APN	9	108106936	nonsense	probably null
IGL02739:Bsn	APN	9	108112546	missense	probably benign	0.14
IGL02951:Bsn	APN	9	108115613	missense	probably damaging	1.00
IGL02987:Bsn	APN	9	108126304	missense	probably benign	0.03
IGL03033:Bsn	APN	9	108115993	missense	probably damaging	1.00
IGL03069:Bsn	APN	9	108114263	missense	probably damaging	1.00
IGL03076:Bsn	APN	9	108105382	missense	unknown
R0068:Bsn	UTSW	9	108112137	missense	probably damaging	1.00
R0068:Bsn	UTSW	9	108112137	missense	probably damaging	1.00
R0167:Bsn	UTSW	9	108125986	missense	probably benign	0.01
R0234:Bsn	UTSW	9	108116396	missense	possibly damaging	0.50
R0234:Bsn	UTSW	9	108116396	missense	possibly damaging	0.50
R0359:Bsn	UTSW	9	108111846	missense	possibly damaging	0.81
R0514:Bsn	UTSW	9	108125782	missense	probably benign	0.07
R0593:Bsn	UTSW	9	108110306	missense	unknown
R0617:Bsn	UTSW	9	108107240	missense	unknown
R0636:Bsn	UTSW	9	108107834	missense	unknown
R0652:Bsn	UTSW	9	108105742	missense	unknown
R0718:Bsn	UTSW	9	108111360	unclassified	probably benign
R0730:Bsn	UTSW	9	108106812	missense	unknown
R0905:Bsn	UTSW	9	108105635	missense	unknown
R0963:Bsn	UTSW	9	108111807	missense	possibly damaging	0.81
R0992:Bsn	UTSW	9	108114354	nonsense	probably null
R1101:Bsn	UTSW	9	108116411	missense	probably damaging	1.00
R1393:Bsn	UTSW	9	108110517	unclassified	probably benign
R1490:Bsn	UTSW	9	108113994	missense	probably benign	0.03
R1566:Bsn	UTSW	9	108125985	missense	probably benign	0.35
R1582:Bsn	UTSW	9	108105092	missense	unknown
R1738:Bsn	UTSW	9	108106934	missense	unknown
R1867:Bsn	UTSW	9	108106719	missense	unknown
R1918:Bsn	UTSW	9	108107573	missense	unknown
R1933:Bsn	UTSW	9	108116444	missense	possibly damaging	0.91
R1946:Bsn	UTSW	9	108114651	missense	probably damaging	0.99
R1978:Bsn	UTSW	9	108114549	missense	probably benign	0.35
R2068:Bsn	UTSW	9	108110684	unclassified	probably benign
R2068:Bsn	UTSW	9	108126550	missense	possibly damaging	0.95
R2113:Bsn	UTSW	9	108114886	missense	probably benign	0.14
R2172:Bsn	UTSW	9	108109992	intron	probably benign
R2266:Bsn	UTSW	9	108115124	missense	probably damaging	1.00
R2293:Bsn	UTSW	9	108113067	missense	possibly damaging	0.47
R2294:Bsn	UTSW	9	108113067	missense	possibly damaging	0.47
R2368:Bsn	UTSW	9	108111030	nonsense	probably null
R2442:Bsn	UTSW	9	108106920	missense	unknown
R2507:Bsn	UTSW	9	108116114	missense	probably damaging	1.00
R2880:Bsn	UTSW	9	108113067	missense	possibly damaging	0.47
R2881:Bsn	UTSW	9	108113067	missense	possibly damaging	0.47
R2922:Bsn	UTSW	9	108108186	missense	unknown
R2922:Bsn	UTSW	9	108115469	missense	probably damaging	1.00
R3618:Bsn	UTSW	9	108117561	critical splice acceptor site	probably null
R3742:Bsn	UTSW	9	108105739	missense	unknown
R3825:Bsn	UTSW	9	108106856	missense	unknown
R3982:Bsn	UTSW	9	108107166	missense	unknown
R4094:Bsn	UTSW	9	108113870	missense	probably damaging	1.00
R4158:Bsn	UTSW	9	108112946	missense	possibly damaging	0.95
R4225:Bsn	UTSW	9	108106733	missense	unknown
R4261:Bsn	UTSW	9	108110684	unclassified	probably benign
R4482:Bsn	UTSW	9	108114664	missense	probably damaging	1.00
R4515:Bsn	UTSW	9	108104078	splice site	probably null
R4585:Bsn	UTSW	9	108110463	unclassified	probably benign
R4628:Bsn	UTSW	9	108113235	missense	probably damaging	1.00
R4636:Bsn	UTSW	9	108115424	missense	probably damaging	1.00
R4679:Bsn	UTSW	9	108110130	missense	unknown
R4723:Bsn	UTSW	9	108112655	missense	probably benign	0.03
R4843:Bsn	UTSW	9	108107189	missense	unknown
R4885:Bsn	UTSW	9	108107527	nonsense	probably null
R4936:Bsn	UTSW	9	108111761	missense	probably damaging	1.00
R4942:Bsn	UTSW	9	108106479	missense	unknown
R4972:Bsn	UTSW	9	108115178	missense	probably damaging	1.00
R4992:Bsn	UTSW	9	108115548	missense	probably damaging	1.00
R5067:Bsn	UTSW	9	108111953	missense	probably damaging	1.00
R5206:Bsn	UTSW	9	108105373	missense	unknown
R5286:Bsn	UTSW	9	108110924	unclassified	probably benign
R5492:Bsn	UTSW	9	108112515	missense	probably damaging	0.98
R5553:Bsn	UTSW	9	108110421	unclassified	probably benign
R5561:Bsn	UTSW	9	108105511	missense	unknown
R5597:Bsn	UTSW	9	108114932	missense	probably benign	0.06
R5646:Bsn	UTSW	9	108110432	unclassified	probably benign
R5796:Bsn	UTSW	9	108126024	missense	probably damaging	1.00
R5801:Bsn	UTSW	9	108113009	missense	possibly damaging	0.81
R5802:Bsn	UTSW	9	108113009	missense	possibly damaging	0.81
R5850:Bsn	UTSW	9	108114950	missense	probably damaging	0.99
R5938:Bsn	UTSW	9	108113009	missense	possibly damaging	0.81
R6221:Bsn	UTSW	9	108105566	missense	unknown
R6243:Bsn	UTSW	9	108107561	missense	unknown
R6254:Bsn	UTSW	9	108111866	missense	probably damaging	0.96
R6263:Bsn	UTSW	9	108113254	missense	probably damaging	1.00
R6345:Bsn	UTSW	9	108107355	missense	unknown
R6368:Bsn	UTSW	9	108111314	unclassified	probably benign
R6574:Bsn	UTSW	9	108113954	missense	possibly damaging	0.95
R6793:Bsn	UTSW	9	108114615	nonsense	probably null
R6802:Bsn	UTSW	9	108110624	unclassified	probably benign
R6943:Bsn	UTSW	9	108107817	missense	unknown
R6999:Bsn	UTSW	9	108113433	missense	probably benign	0.00
R7149:Bsn	UTSW	9	108116321	nonsense	probably null
R7199:Bsn	UTSW	9	108115334	missense	probably damaging	1.00
R7322:Bsn	UTSW	9	108126421	nonsense	probably null
R7349:Bsn	UTSW	9	108110783	missense	unknown
R7372:Bsn	UTSW	9	108110519	missense	unknown
R7373:Bsn	UTSW	9	108113484	missense	probably damaging	1.00
R7413:Bsn	UTSW	9	108139491	missense	possibly damaging	0.61
R7473:Bsn	UTSW	9	108112250	missense	probably damaging	1.00
R7482:Bsn	UTSW	9	108113529	missense	probably damaging	0.98
R7530:Bsn	UTSW	9	108111956	missense	probably damaging	1.00
R7549:Bsn	UTSW	9	108114815	missense	probably benign	0.05
R7570:Bsn	UTSW	9	108113543	missense	probably damaging	1.00
R7635:Bsn	UTSW	9	108110990	missense	unknown
R7696:Bsn	UTSW	9	108114501	missense	probably damaging	1.00
R7757:Bsn	UTSW	9	108114740	missense	possibly damaging	0.90
R7868:Bsn	UTSW	9	108114899	missense	possibly damaging	0.95
R7897:Bsn	UTSW	9	108111866	missense	probably damaging	0.98
R7960:Bsn	UTSW	9	108115548	missense	probably damaging	1.00
R8022:Bsn	UTSW	9	108114404	missense	probably benign	0.01
R8056:Bsn	UTSW	9	108105307	missense
R8158:Bsn	UTSW	9	108110033	missense	unknown
R8161:Bsn	UTSW	9	108139530	missense	probably benign	0.20
R8225:Bsn	UTSW	9	108107106	missense
R8282:Bsn	UTSW	9	108107691	missense	possibly damaging	0.73
R8296:Bsn	UTSW	9	108117379	missense	probably benign	0.00
R8415:Bsn	UTSW	9	108111452	missense	probably benign	0.00
R8417:Bsn	UTSW	9	108111452	missense	probably benign	0.00
R8426:Bsn	UTSW	9	108126573	missense	probably damaging	1.00
R8437:Bsn	UTSW	9	108111452	missense	probably benign	0.00
R8438:Bsn	UTSW	9	108111452	missense	probably benign	0.00
R8439:Bsn	UTSW	9	108111452	missense	probably benign	0.00
R8440:Bsn	UTSW	9	108111452	missense	probably benign	0.00
R8441:Bsn	UTSW	9	108111452	missense	probably benign	0.00
R8442:Bsn	UTSW	9	108111452	missense	probably benign	0.00
R8513:Bsn	UTSW	9	108114510	missense	possibly damaging	0.65
R8529:Bsn	UTSW	9	108111452	missense	probably benign	0.00
R8535:Bsn	UTSW	9	108111452	missense	probably benign	0.00
R8546:Bsn	UTSW	9	108111452	missense	probably benign	0.00
R8548:Bsn	UTSW	9	108111452	missense	probably benign	0.00
R8549:Bsn	UTSW	9	108111452	missense	probably benign	0.00
R8682:Bsn	UTSW	9	108106169	missense
R8773:Bsn	UTSW	9	108110505	missense	unknown
R8883:Bsn	UTSW	9	108113028	missense	probably damaging	0.98
R8906:Bsn	UTSW	9	108107553	missense	unknown
R9018:Bsn	UTSW	9	108117289	missense	probably benign	0.06
R9070:Bsn	UTSW	9	108110096	missense
R9094:Bsn	UTSW	9	108110853	missense	unknown
R9098:Bsn	UTSW	9	108112974	missense	possibly damaging	0.65
R9128:Bsn	UTSW	9	108116150	missense	probably benign	0.21
R9162:Bsn	UTSW	9	108110684	missense	unknown
R9224:Bsn	UTSW	9	108105487	missense
R9230:Bsn	UTSW	9	108112260	missense	probably damaging	1.00
R9233:Bsn	UTSW	9	108117090	missense	probably benign	0.28
R9245:Bsn	UTSW	9	108116093	missense	probably damaging	1.00
R9275:Bsn	UTSW	9	108111620	missense	probably damaging	1.00
R9307:Bsn	UTSW	9	108115794	missense	probably benign	0.01
R9343:Bsn	UTSW	9	108115502	missense	probably damaging	1.00
R9377:Bsn	UTSW	9	108113601	missense	probably damaging	1.00
R9377:Bsn	UTSW	9	108116162	missense	probably damaging	1.00
R9378:Bsn	UTSW	9	108107655	missense	possibly damaging	0.85
R9408:Bsn	UTSW	9	108139453	nonsense	probably null
R9455:Bsn	UTSW	9	108111332	missense	unknown
R9563:Bsn	UTSW	9	108107417	missense
R9615:Bsn	UTSW	9	108107231	missense
R9656:Bsn	UTSW	9	108117208	missense	probably benign	0.09
R9698:Bsn	UTSW	9	108115971	missense	probably damaging	1.00
X0028:Bsn	UTSW	9	108113504	missense	probably damaging	1.00
X0066:Bsn	UTSW	9	108139210	missense	probably damaging	1.00
Z1177:Bsn	UTSW	9	108105499	missense
Z1177:Bsn	UTSW	9	108139195	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ATCTGTACCACCACTGTGTG -3'
(R):5'- GTTATCAACCTCAATGCCCAAG -3'

Sequencing Primer
(F):5'- TACCTGGAGGAGCATGTGACC -3'
(R):5'- GAGCAGACCCATACCTTCCTGG -3'

Posted On

2014-10-01