Incidental Mutation 'R2136:Glipr1l1'
ID 235828
Institutional Source Beutler Lab
Gene Symbol Glipr1l1
Ensembl Gene ENSMUSG00000020213
Gene Name GLI pathogenesis-related 1 like 1
Synonyms 1700011E04Rik
MMRRC Submission 040139-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.049) question?
Stock # R2136 (G1)
Quality Score 225
Status Not validated
Chromosome 10
Chromosomal Location 111896094-111914415 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 111896381 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 56 (V56A)
Ref Sequence ENSEMBL: ENSMUSP00000073302 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073617]
AlphaFold Q9DAG6
Predicted Effect probably damaging
Transcript: ENSMUST00000073617
AA Change: V56A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000073302
Gene: ENSMUSG00000020213
AA Change: V56A

DomainStartEndE-ValueType
SCP 40 186 6.52e-50 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 95.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A930003A15Rik T G 16: 19,702,530 (GRCm39) noncoding transcript Het
Abca5 T C 11: 110,210,658 (GRCm39) T174A probably benign Het
Abcg3 G A 5: 105,114,680 (GRCm39) S279L probably benign Het
Acap3 T C 4: 155,981,369 (GRCm39) L85P probably damaging Het
Adgrl3 A G 5: 81,660,101 (GRCm39) K290R probably damaging Het
Ankhd1 A G 18: 36,780,674 (GRCm39) T1909A probably benign Het
Asap1 T C 15: 63,982,808 (GRCm39) D832G probably damaging Het
Atp6v0a2 T A 5: 124,795,552 (GRCm39) L702Q possibly damaging Het
Bsn A G 9: 107,990,430 (GRCm39) V1774A probably damaging Het
Cd209e T C 8: 3,903,248 (GRCm39) E48G probably benign Het
Cdadc1 T C 14: 59,805,493 (GRCm39) probably null Het
Cfap65 C CA 1: 74,956,432 (GRCm39) probably null Het
Cln3 A C 7: 126,181,971 (GRCm39) S30R probably benign Het
Cluap1 C T 16: 3,751,636 (GRCm39) R332W probably damaging Het
Crb1 A T 1: 139,265,163 (GRCm39) V85E probably benign Het
Crocc G A 4: 140,760,265 (GRCm39) R789W probably damaging Het
Cwh43 A G 5: 73,572,397 (GRCm39) I212V probably benign Het
Cyp2t4 C A 7: 26,857,585 (GRCm39) F391L probably benign Het
Dhx35 G T 2: 158,673,781 (GRCm39) R404L probably damaging Het
Disp1 A G 1: 182,869,942 (GRCm39) L826S probably damaging Het
Dync2h1 T A 9: 7,122,772 (GRCm39) E2061D probably damaging Het
Ep300 T A 15: 81,524,648 (GRCm39) Y1393N unknown Het
Fap C T 2: 62,354,551 (GRCm39) G446D possibly damaging Het
Fat3 A G 9: 16,288,347 (GRCm39) I392T probably benign Het
Fpr-rs4 CAGGAA CA 17: 18,242,596 (GRCm39) probably null Het
Grsf1 A G 5: 88,820,517 (GRCm39) V7A probably benign Het
Hmcn1 G A 1: 150,509,410 (GRCm39) A3646V probably damaging Het
Ipo9 A T 1: 135,322,023 (GRCm39) I569N probably damaging Het
Irs1 G T 1: 82,267,763 (GRCm39) P151Q probably damaging Het
Kalrn T C 16: 34,128,094 (GRCm39) D491G possibly damaging Het
Kctd7 T C 5: 130,181,207 (GRCm39) L210P probably damaging Het
Lifr C A 15: 7,211,338 (GRCm39) D625E possibly damaging Het
Lrguk T C 6: 34,020,454 (GRCm39) V201A probably benign Het
Mark1 A G 1: 184,651,770 (GRCm39) V135A probably damaging Het
Mical2 T A 7: 111,870,722 (GRCm39) D70E possibly damaging Het
Mrc1 T C 2: 14,275,000 (GRCm39) Y434H probably damaging Het
Myh10 C A 11: 68,695,540 (GRCm39) Q1556K probably damaging Het
Nav1 G A 1: 135,382,174 (GRCm39) T1400I probably null Het
Or1j11 A G 2: 36,311,950 (GRCm39) D180G probably damaging Het
Or2a7 A G 6: 43,151,435 (GRCm39) K172E probably benign Het
Or4b13 A C 2: 90,082,597 (GRCm39) V245G probably damaging Het
Or4f4b T C 2: 111,313,961 (GRCm39) V62A probably damaging Het
Or4p7 T A 2: 88,221,663 (GRCm39) I24N probably benign Het
Or5d43 T C 2: 88,104,584 (GRCm39) K270E probably damaging Het
Or5e1 G A 7: 108,354,430 (GRCm39) M122I possibly damaging Het
Osmr T A 15: 6,881,943 (GRCm39) Q67L probably damaging Het
Pan2 T G 10: 128,149,506 (GRCm39) V522G possibly damaging Het
Pard3 T G 8: 128,103,366 (GRCm39) probably null Het
Pcdhgc5 G T 18: 37,953,166 (GRCm39) A147S possibly damaging Het
Pcsk9 T C 4: 106,303,967 (GRCm39) I506V probably benign Het
Polr3d GCCCCC GCCCC 14: 70,680,487 (GRCm39) probably null Het
Prdm4 G A 10: 85,729,215 (GRCm39) R731* probably null Het
Prdx6b T A 2: 80,123,507 (GRCm39) D105E probably damaging Het
Prss3b A G 6: 41,012,396 (GRCm39) F6S probably benign Het
Rab42 A G 4: 132,029,790 (GRCm39) L144P probably damaging Het
Ralbp1 T A 17: 66,171,661 (GRCm39) K104M probably damaging Het
Resf1 T A 6: 149,230,320 (GRCm39) I1122K probably benign Het
Rrp12 A G 19: 41,881,038 (GRCm39) V131A probably damaging Het
Sbno1 C T 5: 124,525,597 (GRCm39) probably null Het
Sbno2 A T 10: 79,898,527 (GRCm39) I645N probably damaging Het
Scfd2 T C 5: 74,367,028 (GRCm39) K624R probably benign Het
Sgk2 C A 2: 162,841,099 (GRCm39) probably null Het
Sirt4 A G 5: 115,617,760 (GRCm39) S299P probably benign Het
Skic3 T C 13: 76,321,473 (GRCm39) S1322P possibly damaging Het
Slit2 C T 5: 48,461,567 (GRCm39) A1521V probably benign Het
Socs7 T G 11: 97,263,933 (GRCm39) V275G possibly damaging Het
Spink11 G A 18: 44,323,554 (GRCm39) P102S probably benign Het
Tacc3 A G 5: 33,828,748 (GRCm39) N534D probably damaging Het
Tas2r115 T C 6: 132,714,309 (GRCm39) Y214C probably damaging Het
Tcaf1 A T 6: 42,650,454 (GRCm39) M875K probably benign Het
Ttc22 T A 4: 106,479,869 (GRCm39) L41Q possibly damaging Het
Vasn T A 16: 4,467,659 (GRCm39) C535* probably null Het
Vcan T A 13: 89,837,856 (GRCm39) I2563F probably damaging Het
Vmn2r63 T G 7: 42,576,297 (GRCm39) Q505H probably damaging Het
Vmn2r65 T G 7: 84,592,781 (GRCm39) Q475H probably damaging Het
Zbtb43 T C 2: 33,344,532 (GRCm39) Y231C probably damaging Het
Zfp292 A G 4: 34,810,266 (GRCm39) V931A probably benign Het
Other mutations in Glipr1l1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00467:Glipr1l1 APN 10 111,914,286 (GRCm39) missense probably benign 0.02
IGL01660:Glipr1l1 APN 10 111,908,184 (GRCm39) missense probably damaging 0.97
IGL01893:Glipr1l1 APN 10 111,912,074 (GRCm39) missense probably benign 0.06
IGL02576:Glipr1l1 APN 10 111,896,224 (GRCm39) missense possibly damaging 0.77
IGL03309:Glipr1l1 APN 10 111,908,141 (GRCm39) splice site probably benign
P0031:Glipr1l1 UTSW 10 111,896,292 (GRCm39) missense probably benign
R0987:Glipr1l1 UTSW 10 111,914,340 (GRCm39) missense probably benign
R0992:Glipr1l1 UTSW 10 111,898,230 (GRCm39) missense probably benign
R2248:Glipr1l1 UTSW 10 111,898,192 (GRCm39) missense probably benign 0.09
R4297:Glipr1l1 UTSW 10 111,898,252 (GRCm39) missense probably benign 0.05
R4298:Glipr1l1 UTSW 10 111,898,252 (GRCm39) missense probably benign 0.05
R4569:Glipr1l1 UTSW 10 111,898,317 (GRCm39) missense probably benign 0.00
R5015:Glipr1l1 UTSW 10 111,914,279 (GRCm39) missense probably benign 0.00
R5552:Glipr1l1 UTSW 10 111,898,243 (GRCm39) missense probably benign 0.00
R5629:Glipr1l1 UTSW 10 111,914,308 (GRCm39) missense possibly damaging 0.90
R6061:Glipr1l1 UTSW 10 111,912,075 (GRCm39) missense probably benign 0.32
R6237:Glipr1l1 UTSW 10 111,896,332 (GRCm39) nonsense probably null
R6519:Glipr1l1 UTSW 10 111,898,153 (GRCm39) missense probably benign 0.02
R6913:Glipr1l1 UTSW 10 111,898,339 (GRCm39) critical splice donor site probably null
R7621:Glipr1l1 UTSW 10 111,896,300 (GRCm39) missense probably benign 0.00
R8171:Glipr1l1 UTSW 10 111,914,289 (GRCm39) missense probably benign 0.01
R9182:Glipr1l1 UTSW 10 111,912,056 (GRCm39) missense probably damaging 1.00
R9319:Glipr1l1 UTSW 10 111,898,122 (GRCm39) missense probably damaging 1.00
R9508:Glipr1l1 UTSW 10 111,912,015 (GRCm39) missense probably damaging 0.98
X0023:Glipr1l1 UTSW 10 111,914,344 (GRCm39) missense probably damaging 0.98
Z1177:Glipr1l1 UTSW 10 111,914,295 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TTCCATGGCCCTGAAGAAG -3'
(R):5'- ATGCACAATGACCCGTGAG -3'

Sequencing Primer
(F):5'- GTGCCAACTATCACGGAT -3'
(R):5'- AAAGGAGTCAAGGGTGATTCTTTC -3'
Posted On 2014-10-01