Incidental Mutation 'R2136:Myh10'
ID235832
Institutional Source Beutler Lab
Gene Symbol Myh10
Ensembl Gene ENSMUSG00000020900
Gene Namemyosin, heavy polypeptide 10, non-muscle
SynonymsMyosin IIB, Fltn, Fltn, Myhn-2, myosin IIB, nonmuscle myosin heavy chain II-B, NMHC-B, Myhn2, SMemb, NMHC II-B, 5730504C04Rik, nonmuscle myosin heavy chain IIB, 9330167F11Rik
MMRRC Submission 040139-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2136 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location68691559-68816632 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 68804714 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Lysine at position 1556 (Q1556K)
Ref Sequence ENSEMBL: ENSMUSP00000099671 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018887] [ENSMUST00000092984] [ENSMUST00000102611]
Predicted Effect possibly damaging
Transcript: ENSMUST00000018887
AA Change: Q1587K

PolyPhen 2 Score 0.893 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000018887
Gene: ENSMUSG00000020900
AA Change: Q1587K

DomainStartEndE-ValueType
Pfam:Myosin_N 33 75 1.5e-15 PFAM
MYSc 79 815 N/A SMART
IQ 816 838 4.81e-4 SMART
low complexity region 932 946 N/A INTRINSIC
low complexity region 984 994 N/A INTRINSIC
low complexity region 1046 1058 N/A INTRINSIC
low complexity region 1070 1086 N/A INTRINSIC
Pfam:Myosin_tail_1 1104 1961 6.5e-211 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000092984
AA Change: Q1593K

PolyPhen 2 Score 0.893 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000090661
Gene: ENSMUSG00000020900
AA Change: Q1593K

DomainStartEndE-ValueType
Pfam:Myosin_N 70 110 2.5e-13 PFAM
MYSc 116 821 N/A SMART
IQ 822 844 4.81e-4 SMART
Pfam:Myosin_tail_1 885 1965 N/A PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000102611
AA Change: Q1556K

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000099671
Gene: ENSMUSG00000020900
AA Change: Q1556K

DomainStartEndE-ValueType
Pfam:Myosin_N 33 75 1.4e-15 PFAM
MYSc 79 784 N/A SMART
IQ 785 807 4.81e-4 SMART
low complexity region 901 915 N/A INTRINSIC
low complexity region 953 963 N/A INTRINSIC
low complexity region 1015 1027 N/A INTRINSIC
low complexity region 1039 1055 N/A INTRINSIC
Pfam:Myosin_tail_1 1073 1930 6.2e-211 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 95.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the myosin superfamily. The protein represents a conventional non-muscle myosin; it should not be confused with the unconventional myosin-10 (MYO10). Myosins are actin-dependent motor proteins with diverse functions including regulation of cytokinesis, cell motility, and cell polarity. Mutations in this gene have been associated with May-Hegglin anomaly and developmental defects in brain and heart. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2011]
PHENOTYPE: Nullizygous mice show pre- and neonatal death, heart defects and hydrocephaly. Deletion of exon B1 disrupts migration of facial neurons, whereas deletion of exon B2 leads to Purkinje cell anomalies. Hypomorphs show hydrocephaly and defects in motor control, cerebellar foliation and neuron migration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210010C04Rik A G 6: 41,035,462 F6S probably benign Het
2810474O19Rik T A 6: 149,328,822 I1122K probably benign Het
A930003A15Rik T G 16: 19,883,780 noncoding transcript Het
Abca5 T C 11: 110,319,832 T174A probably benign Het
Abcg3 G A 5: 104,966,814 S279L probably benign Het
Acap3 T C 4: 155,896,912 L85P probably damaging Het
Adgrl3 A G 5: 81,512,254 K290R probably damaging Het
Ankhd1 A G 18: 36,647,621 T1909A probably benign Het
Asap1 T C 15: 64,110,959 D832G probably damaging Het
Atp6v0a2 T A 5: 124,718,488 L702Q possibly damaging Het
Bsn A G 9: 108,113,231 V1774A probably damaging Het
Cd209e T C 8: 3,853,248 E48G probably benign Het
Cdadc1 T C 14: 59,568,044 probably null Het
Cfap65 C CA 1: 74,917,273 probably null Het
Cln3 A C 7: 126,582,799 S30R probably benign Het
Cluap1 C T 16: 3,933,772 R332W probably damaging Het
Crb1 A T 1: 139,337,425 V85E probably benign Het
Crocc G A 4: 141,032,954 R789W probably damaging Het
Cwh43 A G 5: 73,415,054 I212V probably benign Het
Cyp2t4 C A 7: 27,158,160 F391L probably benign Het
Dhx35 G T 2: 158,831,861 R404L probably damaging Het
Disp1 A G 1: 183,088,378 L826S probably damaging Het
Dync2h1 T A 9: 7,122,772 E2061D probably damaging Het
Ep300 T A 15: 81,640,447 Y1393N unknown Het
Fap C T 2: 62,524,207 G446D possibly damaging Het
Fat3 A G 9: 16,377,051 I392T probably benign Het
Fpr-rs4 CAGGAA CA 17: 18,022,334 probably null Het
Glipr1l1 T C 10: 112,060,476 V56A probably damaging Het
Grsf1 A G 5: 88,672,658 V7A probably benign Het
Hmcn1 G A 1: 150,633,659 A3646V probably damaging Het
Ipo9 A T 1: 135,394,285 I569N probably damaging Het
Irs1 G T 1: 82,290,042 P151Q probably damaging Het
Kalrn T C 16: 34,307,724 D491G possibly damaging Het
Kctd7 T C 5: 130,152,366 L210P probably damaging Het
Lifr C A 15: 7,181,857 D625E possibly damaging Het
Lrguk T C 6: 34,043,519 V201A probably benign Het
Mark1 A G 1: 184,919,573 V135A probably damaging Het
Mical2 T A 7: 112,271,515 D70E possibly damaging Het
Mrc1 T C 2: 14,270,189 Y434H probably damaging Het
Nav1 G A 1: 135,454,436 T1400I probably null Het
Olfr1173 T C 2: 88,274,240 K270E probably damaging Het
Olfr1178 T A 2: 88,391,319 I24N probably benign Het
Olfr1289 T C 2: 111,483,616 V62A probably damaging Het
Olfr13 A G 6: 43,174,501 K172E probably benign Het
Olfr142 A C 2: 90,252,253 V245G probably damaging Het
Olfr339 A G 2: 36,421,938 D180G probably damaging Het
Olfr513 G A 7: 108,755,223 M122I possibly damaging Het
Osmr T A 15: 6,852,462 Q67L probably damaging Het
Pan2 T G 10: 128,313,637 V522G possibly damaging Het
Pard3 T G 8: 127,376,885 probably null Het
Pcdhgc5 G T 18: 37,820,113 A147S possibly damaging Het
Pcsk9 T C 4: 106,446,770 I506V probably benign Het
Polr3d GCCCCC GCCCC 14: 70,443,047 probably null Het
Prdm4 G A 10: 85,893,351 R731* probably null Het
Prdx6b T A 2: 80,293,163 D105E probably damaging Het
Rab42 A G 4: 132,302,479 L144P probably damaging Het
Ralbp1 T A 17: 65,864,666 K104M probably damaging Het
Rrp12 A G 19: 41,892,599 V131A probably damaging Het
Sbno1 C T 5: 124,387,534 probably null Het
Sbno2 A T 10: 80,062,693 I645N probably damaging Het
Scfd2 T C 5: 74,206,367 K624R probably benign Het
Sgk2 C A 2: 162,999,179 probably null Het
Sirt4 A G 5: 115,479,701 S299P probably benign Het
Slit2 C T 5: 48,304,225 A1521V probably benign Het
Socs7 T G 11: 97,373,107 V275G possibly damaging Het
Spink11 G A 18: 44,190,487 P102S probably benign Het
Tacc3 A G 5: 33,671,404 N534D probably damaging Het
Tas2r115 T C 6: 132,737,346 Y214C probably damaging Het
Tcaf1 A T 6: 42,673,520 M875K probably benign Het
Ttc22 T A 4: 106,622,672 L41Q possibly damaging Het
Ttc37 T C 13: 76,173,354 S1322P possibly damaging Het
Vasn T A 16: 4,649,795 C535* probably null Het
Vcan T A 13: 89,689,737 I2563F probably damaging Het
Vmn2r63 T G 7: 42,926,873 Q505H probably damaging Het
Vmn2r65 T G 7: 84,943,573 Q475H probably damaging Het
Zbtb43 T C 2: 33,454,520 Y231C probably damaging Het
Zfp292 A G 4: 34,810,266 V931A probably benign Het
Other mutations in Myh10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00540:Myh10 APN 11 68790708 missense probably benign 0.10
IGL01132:Myh10 APN 11 68768268 missense possibly damaging 0.93
IGL01348:Myh10 APN 11 68811803 missense probably benign 0.04
IGL01404:Myh10 APN 11 68752040 splice site probably null
IGL01409:Myh10 APN 11 68807219 missense probably damaging 0.98
IGL01660:Myh10 APN 11 68785889 missense probably benign 0.00
IGL02111:Myh10 APN 11 68790112 missense probably damaging 1.00
IGL02481:Myh10 APN 11 68802168 missense probably benign 0.00
IGL02483:Myh10 APN 11 68802168 missense probably benign 0.00
IGL02502:Myh10 APN 11 68814372 splice site probably null
IGL03178:Myh10 APN 11 68699413 missense probably benign 0.19
algia UTSW 11 68802931 missense probably damaging 1.00
itis UTSW 11 68764245 missense probably damaging 0.96
PIT4802001:Myh10 UTSW 11 68765092 missense probably damaging 1.00
R0066:Myh10 UTSW 11 68699491 missense probably damaging 1.00
R0066:Myh10 UTSW 11 68699491 missense probably damaging 1.00
R0517:Myh10 UTSW 11 68811599 critical splice acceptor site probably null
R0855:Myh10 UTSW 11 68811801 missense possibly damaging 0.88
R1110:Myh10 UTSW 11 68791850 splice site probably benign
R1135:Myh10 UTSW 11 68807197 missense probably benign
R1169:Myh10 UTSW 11 68762841 missense probably damaging 0.99
R1643:Myh10 UTSW 11 68792010 missense probably damaging 0.96
R1733:Myh10 UTSW 11 68802296 missense probably benign 0.06
R1754:Myh10 UTSW 11 68813058 missense probably damaging 0.98
R1859:Myh10 UTSW 11 68745413 missense probably benign 0.03
R1898:Myh10 UTSW 11 68771906 missense probably damaging 1.00
R1905:Myh10 UTSW 11 68771868 splice site probably benign
R1914:Myh10 UTSW 11 68790208 missense probably damaging 0.99
R1915:Myh10 UTSW 11 68790208 missense probably damaging 0.99
R1987:Myh10 UTSW 11 68814496 missense possibly damaging 0.56
R2130:Myh10 UTSW 11 68807289 splice site probably benign
R2132:Myh10 UTSW 11 68807289 splice site probably benign
R2214:Myh10 UTSW 11 68783127 missense probably damaging 1.00
R2351:Myh10 UTSW 11 68793139 missense probably damaging 1.00
R3407:Myh10 UTSW 11 68790211 missense possibly damaging 0.68
R3721:Myh10 UTSW 11 68813052 missense probably damaging 0.99
R3908:Myh10 UTSW 11 68771059 critical splice donor site probably null
R4275:Myh10 UTSW 11 68751940 critical splice acceptor site probably null
R4526:Myh10 UTSW 11 68815049 missense probably benign 0.04
R4666:Myh10 UTSW 11 68801730 critical splice donor site probably null
R4668:Myh10 UTSW 11 68804642 missense probably damaging 1.00
R4750:Myh10 UTSW 11 68785314 missense probably damaging 1.00
R4968:Myh10 UTSW 11 68793223 missense probably damaging 1.00
R4977:Myh10 UTSW 11 68798371 missense possibly damaging 0.55
R5201:Myh10 UTSW 11 68783195 missense probably damaging 1.00
R5288:Myh10 UTSW 11 68801608 missense probably damaging 1.00
R5304:Myh10 UTSW 11 68764245 missense probably damaging 0.96
R5366:Myh10 UTSW 11 68760692 missense probably damaging 0.97
R5384:Myh10 UTSW 11 68801608 missense probably damaging 1.00
R5427:Myh10 UTSW 11 68802931 missense probably damaging 1.00
R5546:Myh10 UTSW 11 68798380 missense possibly damaging 0.90
R5551:Myh10 UTSW 11 68768287 missense possibly damaging 0.65
R5777:Myh10 UTSW 11 68785859 missense probably damaging 1.00
R5995:Myh10 UTSW 11 68814983 missense probably benign 0.01
R6021:Myh10 UTSW 11 68808862 missense possibly damaging 0.72
R6171:Myh10 UTSW 11 68791890 missense probably damaging 1.00
R6179:Myh10 UTSW 11 68802153 missense probably damaging 0.98
R6263:Myh10 UTSW 11 68810232 missense probably damaging 0.98
R6264:Myh10 UTSW 11 68745415 missense probably benign 0.01
R6484:Myh10 UTSW 11 68699467 missense probably damaging 1.00
R6575:Myh10 UTSW 11 68808850 missense probably benign 0.00
R6736:Myh10 UTSW 11 68745339 missense probably damaging 1.00
R7141:Myh10 UTSW 11 68802139 missense probably benign
R7256:Myh10 UTSW 11 68790689 missense probably damaging 1.00
R7329:Myh10 UTSW 11 68810191 missense probably benign 0.44
R7363:Myh10 UTSW 11 68815048 missense probably benign
R7576:Myh10 UTSW 11 68802166 missense probably damaging 1.00
R7577:Myh10 UTSW 11 68745980 missense unknown
R7681:Myh10 UTSW 11 68771936 missense probably damaging 0.98
X0028:Myh10 UTSW 11 68793135 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGTGATTAAAACACGTGTGACC -3'
(R):5'- CTAGGCAGCAGTGATGTTGG -3'

Sequencing Primer
(F):5'- TGTGACCACAGAACTGCG -3'
(R):5'- TGTTGGAGAGAGACTATCTAAACCCC -3'
Posted On2014-10-01