Mutagenetix > Incidental Mutations

Incidental Mutation 'R2136:Osmr'

235840

Institutional Source

Beutler Lab

Gene Symbol

Osmr

Ensembl Gene

ENSMUSG00000022146

Gene Name

oncostatin M receptor

Synonyms

OSMRB

MMRRC Submission

040139-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.057) question?

Stock #

R2136 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

6813577-6874969 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 6852462 bp

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Leucine at position 67 (Q67L)

Ref Sequence

ENSEMBL: ENSMUSP00000135204 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000022746] [ENSMUST00000176826]

Predicted Effect

probably damaging
Transcript: ENSMUST00000022746
AA Change: Q67L

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000022746
Gene: ENSMUSG00000022146
AA Change: Q67L

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
low complexity region	26	35	N/A	INTRINSIC
Blast:FN3	234	317	9e-38	BLAST
FN3	330	412	6.25e-3	SMART
FN3	427	512	2.75e0	SMART
FN3	523	607	7.02e1	SMART
FN3	619	720	3.17e-4	SMART
transmembrane domain	736	758	N/A	INTRINSIC
low complexity region	776	787	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000175862

Predicted Effect

probably damaging
Transcript: ENSMUST00000176826
AA Change: Q67L

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000135204
Gene: ENSMUSG00000022146
AA Change: Q67L

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
low complexity region	26	35	N/A	INTRINSIC
Blast:FN3	234	317	9e-38	BLAST
FN3	330	412	6.25e-3	SMART
FN3	427	512	2.75e0	SMART
FN3	523	606	2.77e1	SMART
FN3	618	719	3.17e-4	SMART
transmembrane domain	735	757	N/A	INTRINSIC
low complexity region	775	786	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000177263

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000177478

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.6%
20x: 95.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the type I cytokine receptor family. The encoded protein heterodimerizes with interleukin 6 signal transducer to form the type II oncostatin M receptor and with interleukin 31 receptor A to form the interleukin 31 receptor, and thus transduces oncostatin M and interleukin 31 induced signaling events. Mutations in this gene have been associated with familial primary localized cutaneous amyloidosis. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit anemia, decreased hematocrit, and reduced erythroid progenitor, erythrocyte, platelet, and megakaryocyte cells. Homozygotes also show increased susceptibility to diet-induced obesity. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 77 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2210010C04Rik	A	G	6: 41,035,462	F6S	probably benign	Het
2810474O19Rik	T	A	6: 149,328,822	I1122K	probably benign	Het
A930003A15Rik	T	G	16: 19,883,780		noncoding transcript	Het
Abca5	T	C	11: 110,319,832	T174A	probably benign	Het
Abcg3	G	A	5: 104,966,814	S279L	probably benign	Het
Acap3	T	C	4: 155,896,912	L85P	probably damaging	Het
Adgrl3	A	G	5: 81,512,254	K290R	probably damaging	Het
Ankhd1	A	G	18: 36,647,621	T1909A	probably benign	Het
Asap1	T	C	15: 64,110,959	D832G	probably damaging	Het
Atp6v0a2	T	A	5: 124,718,488	L702Q	possibly damaging	Het
Bsn	A	G	9: 108,113,231	V1774A	probably damaging	Het
Cd209e	T	C	8: 3,853,248	E48G	probably benign	Het
Cdadc1	T	C	14: 59,568,044		probably null	Het
Cfap65	C	CA	1: 74,917,273		probably null	Het
Cln3	A	C	7: 126,582,799	S30R	probably benign	Het
Cluap1	C	T	16: 3,933,772	R332W	probably damaging	Het
Crb1	A	T	1: 139,337,425	V85E	probably benign	Het
Crocc	G	A	4: 141,032,954	R789W	probably damaging	Het
Cwh43	A	G	5: 73,415,054	I212V	probably benign	Het
Cyp2t4	C	A	7: 27,158,160	F391L	probably benign	Het
Dhx35	G	T	2: 158,831,861	R404L	probably damaging	Het
Disp1	A	G	1: 183,088,378	L826S	probably damaging	Het
Dync2h1	T	A	9: 7,122,772	E2061D	probably damaging	Het
Ep300	T	A	15: 81,640,447	Y1393N	unknown	Het
Fap	C	T	2: 62,524,207	G446D	possibly damaging	Het
Fat3	A	G	9: 16,377,051	I392T	probably benign	Het
Fpr-rs4	CAGGAA	CA	17: 18,022,334		probably null	Het
Glipr1l1	T	C	10: 112,060,476	V56A	probably damaging	Het
Grsf1	A	G	5: 88,672,658	V7A	probably benign	Het
Hmcn1	G	A	1: 150,633,659	A3646V	probably damaging	Het
Ipo9	A	T	1: 135,394,285	I569N	probably damaging	Het
Irs1	G	T	1: 82,290,042	P151Q	probably damaging	Het
Kalrn	T	C	16: 34,307,724	D491G	possibly damaging	Het
Kctd7	T	C	5: 130,152,366	L210P	probably damaging	Het
Lifr	C	A	15: 7,181,857	D625E	possibly damaging	Het
Lrguk	T	C	6: 34,043,519	V201A	probably benign	Het
Mark1	A	G	1: 184,919,573	V135A	probably damaging	Het
Mical2	T	A	7: 112,271,515	D70E	possibly damaging	Het
Mrc1	T	C	2: 14,270,189	Y434H	probably damaging	Het
Myh10	C	A	11: 68,804,714	Q1556K	probably damaging	Het
Nav1	G	A	1: 135,454,436	T1400I	probably null	Het
Olfr1173	T	C	2: 88,274,240	K270E	probably damaging	Het
Olfr1178	T	A	2: 88,391,319	I24N	probably benign	Het
Olfr1289	T	C	2: 111,483,616	V62A	probably damaging	Het
Olfr13	A	G	6: 43,174,501	K172E	probably benign	Het
Olfr142	A	C	2: 90,252,253	V245G	probably damaging	Het
Olfr339	A	G	2: 36,421,938	D180G	probably damaging	Het
Olfr513	G	A	7: 108,755,223	M122I	possibly damaging	Het
Pan2	T	G	10: 128,313,637	V522G	possibly damaging	Het
Pard3	T	G	8: 127,376,885		probably null	Het
Pcdhgc5	G	T	18: 37,820,113	A147S	possibly damaging	Het
Pcsk9	T	C	4: 106,446,770	I506V	probably benign	Het
Polr3d	GCCCCC	GCCCC	14: 70,443,047		probably null	Het
Prdm4	G	A	10: 85,893,351	R731*	probably null	Het
Prdx6b	T	A	2: 80,293,163	D105E	probably damaging	Het
Rab42	A	G	4: 132,302,479	L144P	probably damaging	Het
Ralbp1	T	A	17: 65,864,666	K104M	probably damaging	Het
Rrp12	A	G	19: 41,892,599	V131A	probably damaging	Het
Sbno1	C	T	5: 124,387,534		probably null	Het
Sbno2	A	T	10: 80,062,693	I645N	probably damaging	Het
Scfd2	T	C	5: 74,206,367	K624R	probably benign	Het
Sgk2	C	A	2: 162,999,179		probably null	Het
Sirt4	A	G	5: 115,479,701	S299P	probably benign	Het
Slit2	C	T	5: 48,304,225	A1521V	probably benign	Het
Socs7	T	G	11: 97,373,107	V275G	possibly damaging	Het
Spink11	G	A	18: 44,190,487	P102S	probably benign	Het
Tacc3	A	G	5: 33,671,404	N534D	probably damaging	Het
Tas2r115	T	C	6: 132,737,346	Y214C	probably damaging	Het
Tcaf1	A	T	6: 42,673,520	M875K	probably benign	Het
Ttc22	T	A	4: 106,622,672	L41Q	possibly damaging	Het
Ttc37	T	C	13: 76,173,354	S1322P	possibly damaging	Het
Vasn	T	A	16: 4,649,795	C535*	probably null	Het
Vcan	T	A	13: 89,689,737	I2563F	probably damaging	Het
Vmn2r63	T	G	7: 42,926,873	Q505H	probably damaging	Het
Vmn2r65	T	G	7: 84,943,573	Q475H	probably damaging	Het
Zbtb43	T	C	2: 33,454,520	Y231C	probably damaging	Het
Zfp292	A	G	4: 34,810,266	V931A	probably benign	Het

Other mutations in Osmr

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00163:Osmr	APN	15	6844445	nonsense	probably null
IGL00335:Osmr	APN	15	6837023	missense	probably benign	0.00
IGL00497:Osmr	APN	15	6847066	missense	probably benign	0.26
IGL00510:Osmr	APN	15	6823631	nonsense	probably null
IGL00811:Osmr	APN	15	6815666	missense	probably benign	0.28
IGL00959:Osmr	APN	15	6824605	missense	probably benign	0.12
IGL01115:Osmr	APN	15	6847201	splice site	probably benign
IGL01307:Osmr	APN	15	6844427	missense	probably damaging	1.00
IGL01330:Osmr	APN	15	6842028	missense	probably damaging	1.00
IGL01633:Osmr	APN	15	6824604	missense	probably damaging	1.00
IGL01780:Osmr	APN	15	6828663	missense	probably benign	0.00
IGL02164:Osmr	APN	15	6842048	missense	probably damaging	0.99
IGL02207:Osmr	APN	15	6847147	missense	probably benign	0.07
IGL02338:Osmr	APN	15	6837729	nonsense	probably null
IGL02350:Osmr	APN	15	6828663	missense	probably benign	0.00
IGL02357:Osmr	APN	15	6828663	missense	probably benign	0.00
IGL02545:Osmr	APN	15	6823579	missense	probably damaging	0.98
IGL02619:Osmr	APN	15	6841994	missense	probably damaging	1.00
IGL02685:Osmr	APN	15	6815573	missense	probably benign	0.00
IGL02959:Osmr	APN	15	6815897	missense	possibly damaging	0.93
IGL03303:Osmr	APN	15	6842808	missense	probably benign	0.03
FR4548:Osmr	UTSW	15	6837703	small insertion	probably benign
FR4737:Osmr	UTSW	15	6837706	nonsense	probably null
R0149:Osmr	UTSW	15	6841951	critical splice donor site	probably null
R0361:Osmr	UTSW	15	6841951	critical splice donor site	probably null
R0492:Osmr	UTSW	15	6824518	missense	probably damaging	1.00
R0538:Osmr	UTSW	15	6841938	splice site	probably benign
R0585:Osmr	UTSW	15	6837793	missense	probably benign
R0980:Osmr	UTSW	15	6852440	missense	probably benign	0.00
R1221:Osmr	UTSW	15	6823561	nonsense	probably null
R1922:Osmr	UTSW	15	6844367	missense	possibly damaging	0.67
R2067:Osmr	UTSW	15	6815415	missense	probably benign	0.00
R2156:Osmr	UTSW	15	6844410	missense	probably benign	0.04
R3683:Osmr	UTSW	15	6837053	missense	possibly damaging	0.95
R3735:Osmr	UTSW	15	6822080	missense	probably damaging	1.00
R3736:Osmr	UTSW	15	6822080	missense	probably damaging	1.00
R4011:Osmr	UTSW	15	6824533	missense	probably benign	0.01
R4175:Osmr	UTSW	15	6852546	missense	probably damaging	1.00
R4555:Osmr	UTSW	15	6815720	missense	possibly damaging	0.73
R4581:Osmr	UTSW	15	6842894	missense	probably benign	0.00
R4751:Osmr	UTSW	15	6842852	missense	probably damaging	1.00
R4758:Osmr	UTSW	15	6852555	missense	probably benign	0.23
R4986:Osmr	UTSW	15	6816580	critical splice donor site	probably null
R4997:Osmr	UTSW	15	6815639	missense	probably benign	0.25
R5077:Osmr	UTSW	15	6844393	nonsense	probably null
R5093:Osmr	UTSW	15	6821079	missense	probably damaging	0.96
R5120:Osmr	UTSW	15	6827275	missense	probably benign	0.16
R5331:Osmr	UTSW	15	6842881	missense	probably damaging	1.00
R5812:Osmr	UTSW	15	6837059	missense	probably damaging	0.99
R5819:Osmr	UTSW	15	6815787	missense	probably benign	0.00
R5876:Osmr	UTSW	15	6821047	missense	probably benign	0.07
R5986:Osmr	UTSW	15	6844453	missense	probably benign	0.36
R6018:Osmr	UTSW	15	6815795	missense	probably damaging	1.00
R6164:Osmr	UTSW	15	6860352	missense	probably benign	0.00
R6217:Osmr	UTSW	15	6823566	missense	probably damaging	1.00
R6312:Osmr	UTSW	15	6823638	missense	probably damaging	1.00
R6349:Osmr	UTSW	15	6821063	missense	probably benign	0.00
R6898:Osmr	UTSW	15	6815883	missense	probably damaging	0.97
R7139:Osmr	UTSW	15	6821088	missense	possibly damaging	0.79
R7412:Osmr	UTSW	15	6823567	missense	probably damaging	1.00
R7527:Osmr	UTSW	15	6827122	missense	probably damaging	1.00
R7630:Osmr	UTSW	15	6816971	missense	possibly damaging	0.53
R7730:Osmr	UTSW	15	6824482	missense	probably damaging	1.00
RF040:Osmr	UTSW	15	6837701	small insertion	probably benign
RF055:Osmr	UTSW	15	6837700	small insertion	probably benign

Predicted Primers

PCR Primer
(F):5'- CACAGGGATGCAATTGTTTAGG -3'
(R):5'- CTCAGATTCTGATGCTAGGATGC -3'

Sequencing Primer
(F):5'- CAGGGATGCAATTGTTTAGGAAATC -3'
(R):5'- CTATTTAAGCATGCCCCCACTGAG -3'

Posted On

2014-10-01