Incidental Mutation 'R2136:Osmr'
ID235840
Institutional Source Beutler Lab
Gene Symbol Osmr
Ensembl Gene ENSMUSG00000022146
Gene Nameoncostatin M receptor
SynonymsOSMRB
MMRRC Submission 040139-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.057) question?
Stock #R2136 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location6813577-6874969 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 6852462 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 67 (Q67L)
Ref Sequence ENSEMBL: ENSMUSP00000135204 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022746] [ENSMUST00000176826]
Predicted Effect probably damaging
Transcript: ENSMUST00000022746
AA Change: Q67L

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000022746
Gene: ENSMUSG00000022146
AA Change: Q67L

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
low complexity region 26 35 N/A INTRINSIC
Blast:FN3 234 317 9e-38 BLAST
FN3 330 412 6.25e-3 SMART
FN3 427 512 2.75e0 SMART
FN3 523 607 7.02e1 SMART
FN3 619 720 3.17e-4 SMART
transmembrane domain 736 758 N/A INTRINSIC
low complexity region 776 787 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175862
Predicted Effect probably damaging
Transcript: ENSMUST00000176826
AA Change: Q67L

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000135204
Gene: ENSMUSG00000022146
AA Change: Q67L

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
low complexity region 26 35 N/A INTRINSIC
Blast:FN3 234 317 9e-38 BLAST
FN3 330 412 6.25e-3 SMART
FN3 427 512 2.75e0 SMART
FN3 523 606 2.77e1 SMART
FN3 618 719 3.17e-4 SMART
transmembrane domain 735 757 N/A INTRINSIC
low complexity region 775 786 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177263
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177478
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 95.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the type I cytokine receptor family. The encoded protein heterodimerizes with interleukin 6 signal transducer to form the type II oncostatin M receptor and with interleukin 31 receptor A to form the interleukin 31 receptor, and thus transduces oncostatin M and interleukin 31 induced signaling events. Mutations in this gene have been associated with familial primary localized cutaneous amyloidosis. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit anemia, decreased hematocrit, and reduced erythroid progenitor, erythrocyte, platelet, and megakaryocyte cells. Homozygotes also show increased susceptibility to diet-induced obesity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210010C04Rik A G 6: 41,035,462 F6S probably benign Het
2810474O19Rik T A 6: 149,328,822 I1122K probably benign Het
A930003A15Rik T G 16: 19,883,780 noncoding transcript Het
Abca5 T C 11: 110,319,832 T174A probably benign Het
Abcg3 G A 5: 104,966,814 S279L probably benign Het
Acap3 T C 4: 155,896,912 L85P probably damaging Het
Adgrl3 A G 5: 81,512,254 K290R probably damaging Het
Ankhd1 A G 18: 36,647,621 T1909A probably benign Het
Asap1 T C 15: 64,110,959 D832G probably damaging Het
Atp6v0a2 T A 5: 124,718,488 L702Q possibly damaging Het
Bsn A G 9: 108,113,231 V1774A probably damaging Het
Cd209e T C 8: 3,853,248 E48G probably benign Het
Cdadc1 T C 14: 59,568,044 probably null Het
Cfap65 C CA 1: 74,917,273 probably null Het
Cln3 A C 7: 126,582,799 S30R probably benign Het
Cluap1 C T 16: 3,933,772 R332W probably damaging Het
Crb1 A T 1: 139,337,425 V85E probably benign Het
Crocc G A 4: 141,032,954 R789W probably damaging Het
Cwh43 A G 5: 73,415,054 I212V probably benign Het
Cyp2t4 C A 7: 27,158,160 F391L probably benign Het
Dhx35 G T 2: 158,831,861 R404L probably damaging Het
Disp1 A G 1: 183,088,378 L826S probably damaging Het
Dync2h1 T A 9: 7,122,772 E2061D probably damaging Het
Ep300 T A 15: 81,640,447 Y1393N unknown Het
Fap C T 2: 62,524,207 G446D possibly damaging Het
Fat3 A G 9: 16,377,051 I392T probably benign Het
Fpr-rs4 CAGGAA CA 17: 18,022,334 probably null Het
Glipr1l1 T C 10: 112,060,476 V56A probably damaging Het
Grsf1 A G 5: 88,672,658 V7A probably benign Het
Hmcn1 G A 1: 150,633,659 A3646V probably damaging Het
Ipo9 A T 1: 135,394,285 I569N probably damaging Het
Irs1 G T 1: 82,290,042 P151Q probably damaging Het
Kalrn T C 16: 34,307,724 D491G possibly damaging Het
Kctd7 T C 5: 130,152,366 L210P probably damaging Het
Lifr C A 15: 7,181,857 D625E possibly damaging Het
Lrguk T C 6: 34,043,519 V201A probably benign Het
Mark1 A G 1: 184,919,573 V135A probably damaging Het
Mical2 T A 7: 112,271,515 D70E possibly damaging Het
Mrc1 T C 2: 14,270,189 Y434H probably damaging Het
Myh10 C A 11: 68,804,714 Q1556K probably damaging Het
Nav1 G A 1: 135,454,436 T1400I probably null Het
Olfr1173 T C 2: 88,274,240 K270E probably damaging Het
Olfr1178 T A 2: 88,391,319 I24N probably benign Het
Olfr1289 T C 2: 111,483,616 V62A probably damaging Het
Olfr13 A G 6: 43,174,501 K172E probably benign Het
Olfr142 A C 2: 90,252,253 V245G probably damaging Het
Olfr339 A G 2: 36,421,938 D180G probably damaging Het
Olfr513 G A 7: 108,755,223 M122I possibly damaging Het
Pan2 T G 10: 128,313,637 V522G possibly damaging Het
Pard3 T G 8: 127,376,885 probably null Het
Pcdhgc5 G T 18: 37,820,113 A147S possibly damaging Het
Pcsk9 T C 4: 106,446,770 I506V probably benign Het
Polr3d GCCCCC GCCCC 14: 70,443,047 probably null Het
Prdm4 G A 10: 85,893,351 R731* probably null Het
Prdx6b T A 2: 80,293,163 D105E probably damaging Het
Rab42 A G 4: 132,302,479 L144P probably damaging Het
Ralbp1 T A 17: 65,864,666 K104M probably damaging Het
Rrp12 A G 19: 41,892,599 V131A probably damaging Het
Sbno1 C T 5: 124,387,534 probably null Het
Sbno2 A T 10: 80,062,693 I645N probably damaging Het
Scfd2 T C 5: 74,206,367 K624R probably benign Het
Sgk2 C A 2: 162,999,179 probably null Het
Sirt4 A G 5: 115,479,701 S299P probably benign Het
Slit2 C T 5: 48,304,225 A1521V probably benign Het
Socs7 T G 11: 97,373,107 V275G possibly damaging Het
Spink11 G A 18: 44,190,487 P102S probably benign Het
Tacc3 A G 5: 33,671,404 N534D probably damaging Het
Tas2r115 T C 6: 132,737,346 Y214C probably damaging Het
Tcaf1 A T 6: 42,673,520 M875K probably benign Het
Ttc22 T A 4: 106,622,672 L41Q possibly damaging Het
Ttc37 T C 13: 76,173,354 S1322P possibly damaging Het
Vasn T A 16: 4,649,795 C535* probably null Het
Vcan T A 13: 89,689,737 I2563F probably damaging Het
Vmn2r63 T G 7: 42,926,873 Q505H probably damaging Het
Vmn2r65 T G 7: 84,943,573 Q475H probably damaging Het
Zbtb43 T C 2: 33,454,520 Y231C probably damaging Het
Zfp292 A G 4: 34,810,266 V931A probably benign Het
Other mutations in Osmr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00163:Osmr APN 15 6844445 nonsense probably null
IGL00335:Osmr APN 15 6837023 missense probably benign 0.00
IGL00497:Osmr APN 15 6847066 missense probably benign 0.26
IGL00510:Osmr APN 15 6823631 nonsense probably null
IGL00811:Osmr APN 15 6815666 missense probably benign 0.28
IGL00959:Osmr APN 15 6824605 missense probably benign 0.12
IGL01115:Osmr APN 15 6847201 splice site probably benign
IGL01307:Osmr APN 15 6844427 missense probably damaging 1.00
IGL01330:Osmr APN 15 6842028 missense probably damaging 1.00
IGL01633:Osmr APN 15 6824604 missense probably damaging 1.00
IGL01780:Osmr APN 15 6828663 missense probably benign 0.00
IGL02164:Osmr APN 15 6842048 missense probably damaging 0.99
IGL02207:Osmr APN 15 6847147 missense probably benign 0.07
IGL02338:Osmr APN 15 6837729 nonsense probably null
IGL02350:Osmr APN 15 6828663 missense probably benign 0.00
IGL02357:Osmr APN 15 6828663 missense probably benign 0.00
IGL02545:Osmr APN 15 6823579 missense probably damaging 0.98
IGL02619:Osmr APN 15 6841994 missense probably damaging 1.00
IGL02685:Osmr APN 15 6815573 missense probably benign 0.00
IGL02959:Osmr APN 15 6815897 missense possibly damaging 0.93
IGL03303:Osmr APN 15 6842808 missense probably benign 0.03
FR4548:Osmr UTSW 15 6837703 small insertion probably benign
FR4737:Osmr UTSW 15 6837706 nonsense probably null
R0149:Osmr UTSW 15 6841951 critical splice donor site probably null
R0361:Osmr UTSW 15 6841951 critical splice donor site probably null
R0492:Osmr UTSW 15 6824518 missense probably damaging 1.00
R0538:Osmr UTSW 15 6841938 splice site probably benign
R0585:Osmr UTSW 15 6837793 missense probably benign
R0980:Osmr UTSW 15 6852440 missense probably benign 0.00
R1221:Osmr UTSW 15 6823561 nonsense probably null
R1922:Osmr UTSW 15 6844367 missense possibly damaging 0.67
R2067:Osmr UTSW 15 6815415 missense probably benign 0.00
R2156:Osmr UTSW 15 6844410 missense probably benign 0.04
R3683:Osmr UTSW 15 6837053 missense possibly damaging 0.95
R3735:Osmr UTSW 15 6822080 missense probably damaging 1.00
R3736:Osmr UTSW 15 6822080 missense probably damaging 1.00
R4011:Osmr UTSW 15 6824533 missense probably benign 0.01
R4175:Osmr UTSW 15 6852546 missense probably damaging 1.00
R4555:Osmr UTSW 15 6815720 missense possibly damaging 0.73
R4581:Osmr UTSW 15 6842894 missense probably benign 0.00
R4751:Osmr UTSW 15 6842852 missense probably damaging 1.00
R4758:Osmr UTSW 15 6852555 missense probably benign 0.23
R4986:Osmr UTSW 15 6816580 critical splice donor site probably null
R4997:Osmr UTSW 15 6815639 missense probably benign 0.25
R5077:Osmr UTSW 15 6844393 nonsense probably null
R5093:Osmr UTSW 15 6821079 missense probably damaging 0.96
R5120:Osmr UTSW 15 6827275 missense probably benign 0.16
R5331:Osmr UTSW 15 6842881 missense probably damaging 1.00
R5812:Osmr UTSW 15 6837059 missense probably damaging 0.99
R5819:Osmr UTSW 15 6815787 missense probably benign 0.00
R5876:Osmr UTSW 15 6821047 missense probably benign 0.07
R5986:Osmr UTSW 15 6844453 missense probably benign 0.36
R6018:Osmr UTSW 15 6815795 missense probably damaging 1.00
R6164:Osmr UTSW 15 6860352 missense probably benign 0.00
R6217:Osmr UTSW 15 6823566 missense probably damaging 1.00
R6312:Osmr UTSW 15 6823638 missense probably damaging 1.00
R6349:Osmr UTSW 15 6821063 missense probably benign 0.00
R6898:Osmr UTSW 15 6815883 missense probably damaging 0.97
R7139:Osmr UTSW 15 6821088 missense possibly damaging 0.79
R7412:Osmr UTSW 15 6823567 missense probably damaging 1.00
R7527:Osmr UTSW 15 6827122 missense probably damaging 1.00
R7630:Osmr UTSW 15 6816971 missense possibly damaging 0.53
R7730:Osmr UTSW 15 6824482 missense probably damaging 1.00
RF040:Osmr UTSW 15 6837701 small insertion probably benign
RF055:Osmr UTSW 15 6837700 small insertion probably benign
Predicted Primers PCR Primer
(F):5'- CACAGGGATGCAATTGTTTAGG -3'
(R):5'- CTCAGATTCTGATGCTAGGATGC -3'

Sequencing Primer
(F):5'- CAGGGATGCAATTGTTTAGGAAATC -3'
(R):5'- CTATTTAAGCATGCCCCCACTGAG -3'
Posted On2014-10-01