Mutagenetix > Incidental Mutations

Incidental Mutation 'R2136:Lifr'

235841

Institutional Source

Beutler Lab

Gene Symbol

Lifr

Ensembl Gene

ENSMUSG00000054263

Gene Name

leukemia inhibitory factor receptor

Synonyms

A230075M04Rik, soluble differentiation-stimulating factor receptor

MMRRC Submission

040139-MU

Accession Numbers

Genbank: NM_013584; MGI: 96788

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R2136 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

7090614-7197489 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 7181857 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glutamic Acid at position 625 (D625E)

Ref Sequence

ENSEMBL: ENSMUSP00000154181 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000067190] [ENSMUST00000164529] [ENSMUST00000171588] [ENSMUST00000226471] [ENSMUST00000226934] [ENSMUST00000227727]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000067190
AA Change: D625E

PolyPhen 2 Score 0.892 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000064551
Gene: ENSMUSG00000054263
AA Change: D625E

Domain	Start	End	E-Value	Type
low complexity region	25	37	N/A	INTRINSIC
Blast:FN3	45	118	5e-22	BLAST
FN3	328	399	1.86e1	SMART
FN3	425	515	9.77e-5	SMART
FN3	530	611	2.68e0	SMART
FN3	620	705	8.23e1	SMART
FN3	719	815	4.81e-4	SMART
transmembrane domain	830	852	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000164529
AA Change: D625E

PolyPhen 2 Score 0.892 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000131434
Gene: ENSMUSG00000054263
AA Change: D625E

Domain	Start	End	E-Value	Type
low complexity region	25	37	N/A	INTRINSIC
Blast:FN3	45	118	4e-22	BLAST
FN3	328	399	1.86e1	SMART
FN3	425	515	9.77e-5	SMART
FN3	530	611	2.68e0	SMART
FN3	620	705	8.23e1	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000171588
AA Change: D625E

PolyPhen 2 Score 0.892 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000126137
Gene: ENSMUSG00000054263
AA Change: D625E

Domain	Start	End	E-Value	Type
low complexity region	25	37	N/A	INTRINSIC
Blast:FN3	45	118	5e-22	BLAST
FN3	328	399	1.86e1	SMART
FN3	425	515	9.77e-5	SMART
FN3	530	611	2.68e0	SMART
FN3	620	705	8.23e1	SMART
FN3	719	815	4.81e-4	SMART
transmembrane domain	830	852	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000226471
AA Change: D625E

PolyPhen 2 Score 0.892 (Sensitivity: 0.82; Specificity: 0.94)

Predicted Effect

possibly damaging
Transcript: ENSMUST00000226934
AA Change: D625E

PolyPhen 2 Score 0.892 (Sensitivity: 0.82; Specificity: 0.94)

Predicted Effect

possibly damaging
Transcript: ENSMUST00000227727
AA Change: D625E

PolyPhen 2 Score 0.892 (Sensitivity: 0.82; Specificity: 0.94)

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.6%
20x: 95.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the type I cytokine receptor family. This protein combines with a high-affinity converter subunit, gp130, to form a receptor complex that mediates the action of the leukemia inhibitory factor, a polyfunctional cytokine that is involved in cellular differentiation, proliferation and survival in the adult and the embryo. Mutations in this gene cause Schwartz-Jampel syndrome type 2, a disease belonging to the group of the bent-bone dysplasias. A translocation that involves the promoter of this gene, t(5;8)(p13;q12) with the pleiomorphic adenoma gene 1, is associated with salivary gland pleiomorphic adenoma, a common type of benign epithelial tumor of the salivary gland. Multiple splice variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations die as neonates with reduced numbers of facial and spinal motor neurons, neurons of the nucleus ambiguus, and astrocytes. Mutants also show impaired placentation, severe osteopenia, and low hepatic glycogen stores. [provided by MGI curators]

Allele List at MGI

All alleles(22) : Targeted, knock-out(1) Targeted, other(2) Gene trapped(19)

Other mutations in this stock

Total: 77 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2210010C04Rik	A	G	6: 41,035,462	F6S	probably benign	Het
2810474O19Rik	T	A	6: 149,328,822	I1122K	probably benign	Het
A930003A15Rik	T	G	16: 19,883,780		noncoding transcript	Het
Abca5	T	C	11: 110,319,832	T174A	probably benign	Het
Abcg3	G	A	5: 104,966,814	S279L	probably benign	Het
Acap3	T	C	4: 155,896,912	L85P	probably damaging	Het
Adgrl3	A	G	5: 81,512,254	K290R	probably damaging	Het
Ankhd1	A	G	18: 36,647,621	T1909A	probably benign	Het
Asap1	T	C	15: 64,110,959	D832G	probably damaging	Het
Atp6v0a2	T	A	5: 124,718,488	L702Q	possibly damaging	Het
Bsn	A	G	9: 108,113,231	V1774A	probably damaging	Het
Cd209e	T	C	8: 3,853,248	E48G	probably benign	Het
Cdadc1	T	C	14: 59,568,044		probably null	Het
Cfap65	C	CA	1: 74,917,273		probably null	Het
Cln3	A	C	7: 126,582,799	S30R	probably benign	Het
Cluap1	C	T	16: 3,933,772	R332W	probably damaging	Het
Crb1	A	T	1: 139,337,425	V85E	probably benign	Het
Crocc	G	A	4: 141,032,954	R789W	probably damaging	Het
Cwh43	A	G	5: 73,415,054	I212V	probably benign	Het
Cyp2t4	C	A	7: 27,158,160	F391L	probably benign	Het
Dhx35	G	T	2: 158,831,861	R404L	probably damaging	Het
Disp1	A	G	1: 183,088,378	L826S	probably damaging	Het
Dync2h1	T	A	9: 7,122,772	E2061D	probably damaging	Het
Ep300	T	A	15: 81,640,447	Y1393N	unknown	Het
Fap	C	T	2: 62,524,207	G446D	possibly damaging	Het
Fat3	A	G	9: 16,377,051	I392T	probably benign	Het
Fpr-rs4	CAGGAA	CA	17: 18,022,334		probably null	Het
Glipr1l1	T	C	10: 112,060,476	V56A	probably damaging	Het
Grsf1	A	G	5: 88,672,658	V7A	probably benign	Het
Hmcn1	G	A	1: 150,633,659	A3646V	probably damaging	Het
Ipo9	A	T	1: 135,394,285	I569N	probably damaging	Het
Irs1	G	T	1: 82,290,042	P151Q	probably damaging	Het
Kalrn	T	C	16: 34,307,724	D491G	possibly damaging	Het
Kctd7	T	C	5: 130,152,366	L210P	probably damaging	Het
Lrguk	T	C	6: 34,043,519	V201A	probably benign	Het
Mark1	A	G	1: 184,919,573	V135A	probably damaging	Het
Mical2	T	A	7: 112,271,515	D70E	possibly damaging	Het
Mrc1	T	C	2: 14,270,189	Y434H	probably damaging	Het
Myh10	C	A	11: 68,804,714	Q1556K	probably damaging	Het
Nav1	G	A	1: 135,454,436	T1400I	probably null	Het
Olfr1173	T	C	2: 88,274,240	K270E	probably damaging	Het
Olfr1178	T	A	2: 88,391,319	I24N	probably benign	Het
Olfr1289	T	C	2: 111,483,616	V62A	probably damaging	Het
Olfr13	A	G	6: 43,174,501	K172E	probably benign	Het
Olfr142	A	C	2: 90,252,253	V245G	probably damaging	Het
Olfr339	A	G	2: 36,421,938	D180G	probably damaging	Het
Olfr513	G	A	7: 108,755,223	M122I	possibly damaging	Het
Osmr	T	A	15: 6,852,462	Q67L	probably damaging	Het
Pan2	T	G	10: 128,313,637	V522G	possibly damaging	Het
Pard3	T	G	8: 127,376,885		probably null	Het
Pcdhgc5	G	T	18: 37,820,113	A147S	possibly damaging	Het
Pcsk9	T	C	4: 106,446,770	I506V	probably benign	Het
Polr3d	GCCCCC	GCCCC	14: 70,443,047		probably null	Het
Prdm4	G	A	10: 85,893,351	R731*	probably null	Het
Prdx6b	T	A	2: 80,293,163	D105E	probably damaging	Het
Rab42	A	G	4: 132,302,479	L144P	probably damaging	Het
Ralbp1	T	A	17: 65,864,666	K104M	probably damaging	Het
Rrp12	A	G	19: 41,892,599	V131A	probably damaging	Het
Sbno1	C	T	5: 124,387,534		probably null	Het
Sbno2	A	T	10: 80,062,693	I645N	probably damaging	Het
Scfd2	T	C	5: 74,206,367	K624R	probably benign	Het
Sgk2	C	A	2: 162,999,179		probably null	Het
Sirt4	A	G	5: 115,479,701	S299P	probably benign	Het
Slit2	C	T	5: 48,304,225	A1521V	probably benign	Het
Socs7	T	G	11: 97,373,107	V275G	possibly damaging	Het
Spink11	G	A	18: 44,190,487	P102S	probably benign	Het
Tacc3	A	G	5: 33,671,404	N534D	probably damaging	Het
Tas2r115	T	C	6: 132,737,346	Y214C	probably damaging	Het
Tcaf1	A	T	6: 42,673,520	M875K	probably benign	Het
Ttc22	T	A	4: 106,622,672	L41Q	possibly damaging	Het
Ttc37	T	C	13: 76,173,354	S1322P	possibly damaging	Het
Vasn	T	A	16: 4,649,795	C535*	probably null	Het
Vcan	T	A	13: 89,689,737	I2563F	probably damaging	Het
Vmn2r63	T	G	7: 42,926,873	Q505H	probably damaging	Het
Vmn2r65	T	G	7: 84,943,573	Q475H	probably damaging	Het
Zbtb43	T	C	2: 33,454,520	Y231C	probably damaging	Het
Zfp292	A	G	4: 34,810,266	V931A	probably benign	Het

Other mutations in Lifr

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00702:Lifr	APN	15	7185739	splice site	probably null
IGL01470:Lifr	APN	15	7175666	nonsense	probably null
IGL01489:Lifr	APN	15	7175556	splice site	probably benign
IGL01619:Lifr	APN	15	7191162	missense	probably damaging	1.00
IGL01636:Lifr	APN	15	7179018	splice site	probably benign
IGL01943:Lifr	APN	15	7188149	missense	probably damaging	1.00
IGL02253:Lifr	APN	15	7190604	missense	probably damaging	1.00
IGL02355:Lifr	APN	15	7164693	critical splice donor site	probably null
IGL02362:Lifr	APN	15	7164693	critical splice donor site	probably null
IGL02450:Lifr	APN	15	7190765	missense	probably damaging	1.00
IGL02477:Lifr	APN	15	7186923	missense	probably damaging	1.00
IGL02503:Lifr	APN	15	7185623	missense	probably damaging	1.00
IGL02571:Lifr	APN	15	7190111	unclassified	probably benign
IGL03340:Lifr	APN	15	7177936	missense	probably benign	0.02
N/A - 535:Lifr	UTSW	15	7186953	missense	possibly damaging	0.80
R0012:Lifr	UTSW	15	7175608	missense	possibly damaging	0.78
R0015:Lifr	UTSW	15	7188186	unclassified	probably null
R0102:Lifr	UTSW	15	7178892	missense	probably damaging	0.98
R0102:Lifr	UTSW	15	7178892	missense	probably damaging	0.98
R0305:Lifr	UTSW	15	7177501	missense	probably damaging	0.99
R0416:Lifr	UTSW	15	7166914	missense	probably damaging	1.00
R0440:Lifr	UTSW	15	7157191	nonsense	probably null
R0519:Lifr	UTSW	15	7177580	missense	probably damaging	1.00
R0595:Lifr	UTSW	15	7177469	missense	probably damaging	1.00
R0601:Lifr	UTSW	15	7169272	splice site	probably null
R0780:Lifr	UTSW	15	7177466	missense	probably benign	0.00
R0790:Lifr	UTSW	15	7185715	missense	probably benign	0.13
R1376:Lifr	UTSW	15	7184764	missense	probably benign	0.04
R1376:Lifr	UTSW	15	7184764	missense	probably benign	0.04
R1400:Lifr	UTSW	15	7190865	missense	probably benign	0.04
R1498:Lifr	UTSW	15	7190618	missense	probably damaging	0.99
R1785:Lifr	UTSW	15	7181856	missense	possibly damaging	0.89
R1786:Lifr	UTSW	15	7181856	missense	possibly damaging	0.89
R1906:Lifr	UTSW	15	7188131	missense	probably damaging	0.98
R2099:Lifr	UTSW	15	7157251	missense	probably benign
R2102:Lifr	UTSW	15	7186923	missense	probably damaging	1.00
R2511:Lifr	UTSW	15	7166916	missense	probably benign
R4375:Lifr	UTSW	15	7166898	missense	probably benign
R4883:Lifr	UTSW	15	7185625	missense	possibly damaging	0.94
R5681:Lifr	UTSW	15	7191084	missense	probably damaging	1.00
R5689:Lifr	UTSW	15	7184804	missense	probably damaging	1.00
R5693:Lifr	UTSW	15	7175560	missense	probably damaging	1.00
R5902:Lifr	UTSW	15	7190750	missense	probably benign
R5918:Lifr	UTSW	15	7159416	missense	probably benign	0.00
R5924:Lifr	UTSW	15	7172972	missense	probably benign	0.28
R6037:Lifr	UTSW	15	7186943	missense	probably damaging	1.00
R6037:Lifr	UTSW	15	7186943	missense	probably damaging	1.00
R6289:Lifr	UTSW	15	7166910	missense	probably benign	0.00
R6339:Lifr	UTSW	15	7167049	missense	probably benign	0.01
R6860:Lifr	UTSW	15	7172937	missense	probably benign	0.02
R7106:Lifr	UTSW	15	7172924	missense	probably benign	0.02
R7107:Lifr	UTSW	15	7178940	missense	possibly damaging	0.88
R7274:Lifr	UTSW	15	7167059	critical splice donor site	probably null
R7625:Lifr	UTSW	15	7169242	missense	probably damaging	0.99
R7631:Lifr	UTSW	15	7184777	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CTCAGCTTCTGAATAAAGGTAGATGC -3'
(R):5'- GAGCCACGGATTCTTACCAG -3'

Sequencing Primer
(F):5'- CAGCGAAATAACTTCAGTAAC -3'
(R):5'- CGGATTCTTACCAGACTCTATGACAG -3'

Posted On

2014-10-01