Incidental Mutation 'R2136:Lifr'
ID235841
Institutional Source Beutler Lab
Gene Symbol Lifr
Ensembl Gene ENSMUSG00000054263
Gene Nameleukemia inhibitory factor receptor
SynonymsA230075M04Rik, soluble differentiation-stimulating factor receptor
MMRRC Submission 040139-MU
Accession Numbers

Genbank: NM_013584; MGI: 96788  

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2136 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location7090614-7197489 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 7181857 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 625 (D625E)
Ref Sequence ENSEMBL: ENSMUSP00000154181 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067190] [ENSMUST00000164529] [ENSMUST00000171588] [ENSMUST00000226471] [ENSMUST00000226934] [ENSMUST00000227727]
Predicted Effect possibly damaging
Transcript: ENSMUST00000067190
AA Change: D625E

PolyPhen 2 Score 0.892 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000064551
Gene: ENSMUSG00000054263
AA Change: D625E

DomainStartEndE-ValueType
low complexity region 25 37 N/A INTRINSIC
Blast:FN3 45 118 5e-22 BLAST
FN3 328 399 1.86e1 SMART
FN3 425 515 9.77e-5 SMART
FN3 530 611 2.68e0 SMART
FN3 620 705 8.23e1 SMART
FN3 719 815 4.81e-4 SMART
transmembrane domain 830 852 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000164529
AA Change: D625E

PolyPhen 2 Score 0.892 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000131434
Gene: ENSMUSG00000054263
AA Change: D625E

DomainStartEndE-ValueType
low complexity region 25 37 N/A INTRINSIC
Blast:FN3 45 118 4e-22 BLAST
FN3 328 399 1.86e1 SMART
FN3 425 515 9.77e-5 SMART
FN3 530 611 2.68e0 SMART
FN3 620 705 8.23e1 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000171588
AA Change: D625E

PolyPhen 2 Score 0.892 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000126137
Gene: ENSMUSG00000054263
AA Change: D625E

DomainStartEndE-ValueType
low complexity region 25 37 N/A INTRINSIC
Blast:FN3 45 118 5e-22 BLAST
FN3 328 399 1.86e1 SMART
FN3 425 515 9.77e-5 SMART
FN3 530 611 2.68e0 SMART
FN3 620 705 8.23e1 SMART
FN3 719 815 4.81e-4 SMART
transmembrane domain 830 852 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000226471
AA Change: D625E

PolyPhen 2 Score 0.892 (Sensitivity: 0.82; Specificity: 0.94)
Predicted Effect possibly damaging
Transcript: ENSMUST00000226934
AA Change: D625E

PolyPhen 2 Score 0.892 (Sensitivity: 0.82; Specificity: 0.94)
Predicted Effect possibly damaging
Transcript: ENSMUST00000227727
AA Change: D625E

PolyPhen 2 Score 0.892 (Sensitivity: 0.82; Specificity: 0.94)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 95.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the type I cytokine receptor family. This protein combines with a high-affinity converter subunit, gp130, to form a receptor complex that mediates the action of the leukemia inhibitory factor, a polyfunctional cytokine that is involved in cellular differentiation, proliferation and survival in the adult and the embryo. Mutations in this gene cause Schwartz-Jampel syndrome type 2, a disease belonging to the group of the bent-bone dysplasias. A translocation that involves the promoter of this gene, t(5;8)(p13;q12) with the pleiomorphic adenoma gene 1, is associated with salivary gland pleiomorphic adenoma, a common type of benign epithelial tumor of the salivary gland. Multiple splice variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations die as neonates with reduced numbers of facial and spinal motor neurons, neurons of the nucleus ambiguus, and astrocytes. Mutants also show impaired placentation, severe osteopenia, and low hepatic glycogen stores. [provided by MGI curators]
Allele List at MGI

All alleles(22) : Targeted, knock-out(1) Targeted, other(2) Gene trapped(19)

Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210010C04Rik A G 6: 41,035,462 F6S probably benign Het
2810474O19Rik T A 6: 149,328,822 I1122K probably benign Het
A930003A15Rik T G 16: 19,883,780 noncoding transcript Het
Abca5 T C 11: 110,319,832 T174A probably benign Het
Abcg3 G A 5: 104,966,814 S279L probably benign Het
Acap3 T C 4: 155,896,912 L85P probably damaging Het
Adgrl3 A G 5: 81,512,254 K290R probably damaging Het
Ankhd1 A G 18: 36,647,621 T1909A probably benign Het
Asap1 T C 15: 64,110,959 D832G probably damaging Het
Atp6v0a2 T A 5: 124,718,488 L702Q possibly damaging Het
Bsn A G 9: 108,113,231 V1774A probably damaging Het
Cd209e T C 8: 3,853,248 E48G probably benign Het
Cdadc1 T C 14: 59,568,044 probably null Het
Cfap65 C CA 1: 74,917,273 probably null Het
Cln3 A C 7: 126,582,799 S30R probably benign Het
Cluap1 C T 16: 3,933,772 R332W probably damaging Het
Crb1 A T 1: 139,337,425 V85E probably benign Het
Crocc G A 4: 141,032,954 R789W probably damaging Het
Cwh43 A G 5: 73,415,054 I212V probably benign Het
Cyp2t4 C A 7: 27,158,160 F391L probably benign Het
Dhx35 G T 2: 158,831,861 R404L probably damaging Het
Disp1 A G 1: 183,088,378 L826S probably damaging Het
Dync2h1 T A 9: 7,122,772 E2061D probably damaging Het
Ep300 T A 15: 81,640,447 Y1393N unknown Het
Fap C T 2: 62,524,207 G446D possibly damaging Het
Fat3 A G 9: 16,377,051 I392T probably benign Het
Fpr-rs4 CAGGAA CA 17: 18,022,334 probably null Het
Glipr1l1 T C 10: 112,060,476 V56A probably damaging Het
Grsf1 A G 5: 88,672,658 V7A probably benign Het
Hmcn1 G A 1: 150,633,659 A3646V probably damaging Het
Ipo9 A T 1: 135,394,285 I569N probably damaging Het
Irs1 G T 1: 82,290,042 P151Q probably damaging Het
Kalrn T C 16: 34,307,724 D491G possibly damaging Het
Kctd7 T C 5: 130,152,366 L210P probably damaging Het
Lrguk T C 6: 34,043,519 V201A probably benign Het
Mark1 A G 1: 184,919,573 V135A probably damaging Het
Mical2 T A 7: 112,271,515 D70E possibly damaging Het
Mrc1 T C 2: 14,270,189 Y434H probably damaging Het
Myh10 C A 11: 68,804,714 Q1556K probably damaging Het
Nav1 G A 1: 135,454,436 T1400I probably null Het
Olfr1173 T C 2: 88,274,240 K270E probably damaging Het
Olfr1178 T A 2: 88,391,319 I24N probably benign Het
Olfr1289 T C 2: 111,483,616 V62A probably damaging Het
Olfr13 A G 6: 43,174,501 K172E probably benign Het
Olfr142 A C 2: 90,252,253 V245G probably damaging Het
Olfr339 A G 2: 36,421,938 D180G probably damaging Het
Olfr513 G A 7: 108,755,223 M122I possibly damaging Het
Osmr T A 15: 6,852,462 Q67L probably damaging Het
Pan2 T G 10: 128,313,637 V522G possibly damaging Het
Pard3 T G 8: 127,376,885 probably null Het
Pcdhgc5 G T 18: 37,820,113 A147S possibly damaging Het
Pcsk9 T C 4: 106,446,770 I506V probably benign Het
Polr3d GCCCCC GCCCC 14: 70,443,047 probably null Het
Prdm4 G A 10: 85,893,351 R731* probably null Het
Prdx6b T A 2: 80,293,163 D105E probably damaging Het
Rab42 A G 4: 132,302,479 L144P probably damaging Het
Ralbp1 T A 17: 65,864,666 K104M probably damaging Het
Rrp12 A G 19: 41,892,599 V131A probably damaging Het
Sbno1 C T 5: 124,387,534 probably null Het
Sbno2 A T 10: 80,062,693 I645N probably damaging Het
Scfd2 T C 5: 74,206,367 K624R probably benign Het
Sgk2 C A 2: 162,999,179 probably null Het
Sirt4 A G 5: 115,479,701 S299P probably benign Het
Slit2 C T 5: 48,304,225 A1521V probably benign Het
Socs7 T G 11: 97,373,107 V275G possibly damaging Het
Spink11 G A 18: 44,190,487 P102S probably benign Het
Tacc3 A G 5: 33,671,404 N534D probably damaging Het
Tas2r115 T C 6: 132,737,346 Y214C probably damaging Het
Tcaf1 A T 6: 42,673,520 M875K probably benign Het
Ttc22 T A 4: 106,622,672 L41Q possibly damaging Het
Ttc37 T C 13: 76,173,354 S1322P possibly damaging Het
Vasn T A 16: 4,649,795 C535* probably null Het
Vcan T A 13: 89,689,737 I2563F probably damaging Het
Vmn2r63 T G 7: 42,926,873 Q505H probably damaging Het
Vmn2r65 T G 7: 84,943,573 Q475H probably damaging Het
Zbtb43 T C 2: 33,454,520 Y231C probably damaging Het
Zfp292 A G 4: 34,810,266 V931A probably benign Het
Other mutations in Lifr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00702:Lifr APN 15 7185739 splice site probably null
IGL01470:Lifr APN 15 7175666 nonsense probably null
IGL01489:Lifr APN 15 7175556 splice site probably benign
IGL01619:Lifr APN 15 7191162 missense probably damaging 1.00
IGL01636:Lifr APN 15 7179018 splice site probably benign
IGL01943:Lifr APN 15 7188149 missense probably damaging 1.00
IGL02253:Lifr APN 15 7190604 missense probably damaging 1.00
IGL02355:Lifr APN 15 7164693 critical splice donor site probably null
IGL02362:Lifr APN 15 7164693 critical splice donor site probably null
IGL02450:Lifr APN 15 7190765 missense probably damaging 1.00
IGL02477:Lifr APN 15 7186923 missense probably damaging 1.00
IGL02503:Lifr APN 15 7185623 missense probably damaging 1.00
IGL02571:Lifr APN 15 7190111 unclassified probably benign
IGL03340:Lifr APN 15 7177936 missense probably benign 0.02
N/A - 535:Lifr UTSW 15 7186953 missense possibly damaging 0.80
R0012:Lifr UTSW 15 7175608 missense possibly damaging 0.78
R0015:Lifr UTSW 15 7188186 unclassified probably null
R0102:Lifr UTSW 15 7178892 missense probably damaging 0.98
R0102:Lifr UTSW 15 7178892 missense probably damaging 0.98
R0305:Lifr UTSW 15 7177501 missense probably damaging 0.99
R0416:Lifr UTSW 15 7166914 missense probably damaging 1.00
R0440:Lifr UTSW 15 7157191 nonsense probably null
R0519:Lifr UTSW 15 7177580 missense probably damaging 1.00
R0595:Lifr UTSW 15 7177469 missense probably damaging 1.00
R0601:Lifr UTSW 15 7169272 splice site probably null
R0780:Lifr UTSW 15 7177466 missense probably benign 0.00
R0790:Lifr UTSW 15 7185715 missense probably benign 0.13
R1376:Lifr UTSW 15 7184764 missense probably benign 0.04
R1376:Lifr UTSW 15 7184764 missense probably benign 0.04
R1400:Lifr UTSW 15 7190865 missense probably benign 0.04
R1498:Lifr UTSW 15 7190618 missense probably damaging 0.99
R1785:Lifr UTSW 15 7181856 missense possibly damaging 0.89
R1786:Lifr UTSW 15 7181856 missense possibly damaging 0.89
R1906:Lifr UTSW 15 7188131 missense probably damaging 0.98
R2099:Lifr UTSW 15 7157251 missense probably benign
R2102:Lifr UTSW 15 7186923 missense probably damaging 1.00
R2511:Lifr UTSW 15 7166916 missense probably benign
R4375:Lifr UTSW 15 7166898 missense probably benign
R4883:Lifr UTSW 15 7185625 missense possibly damaging 0.94
R5681:Lifr UTSW 15 7191084 missense probably damaging 1.00
R5689:Lifr UTSW 15 7184804 missense probably damaging 1.00
R5693:Lifr UTSW 15 7175560 missense probably damaging 1.00
R5902:Lifr UTSW 15 7190750 missense probably benign
R5918:Lifr UTSW 15 7159416 missense probably benign 0.00
R5924:Lifr UTSW 15 7172972 missense probably benign 0.28
R6037:Lifr UTSW 15 7186943 missense probably damaging 1.00
R6037:Lifr UTSW 15 7186943 missense probably damaging 1.00
R6289:Lifr UTSW 15 7166910 missense probably benign 0.00
R6339:Lifr UTSW 15 7167049 missense probably benign 0.01
R6860:Lifr UTSW 15 7172937 missense probably benign 0.02
R7106:Lifr UTSW 15 7172924 missense probably benign 0.02
R7107:Lifr UTSW 15 7178940 missense possibly damaging 0.88
R7274:Lifr UTSW 15 7167059 critical splice donor site probably null
R7625:Lifr UTSW 15 7169242 missense probably damaging 0.99
R7631:Lifr UTSW 15 7184777 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTCAGCTTCTGAATAAAGGTAGATGC -3'
(R):5'- GAGCCACGGATTCTTACCAG -3'

Sequencing Primer
(F):5'- CAGCGAAATAACTTCAGTAAC -3'
(R):5'- CGGATTCTTACCAGACTCTATGACAG -3'
Posted On2014-10-01