Incidental Mutation 'R2136:Ep300'
ID235843
Institutional Source Beutler Lab
Gene Symbol Ep300
Ensembl Gene ENSMUSG00000055024
Gene NameE1A binding protein p300
SynonymsKAT3B, p300
MMRRC Submission 040139-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2136 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location81585351-81652077 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 81640447 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Asparagine at position 1393 (Y1393N)
Ref Sequence ENSEMBL: ENSMUSP00000066789 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068387]
Predicted Effect unknown
Transcript: ENSMUST00000068387
AA Change: Y1393N
SMART Domains Protein: ENSMUSP00000066789
Gene: ENSMUSG00000055024
AA Change: Y1393N

DomainStartEndE-ValueType
low complexity region 18 28 N/A INTRINSIC
low complexity region 162 178 N/A INTRINSIC
low complexity region 223 242 N/A INTRINSIC
low complexity region 296 309 N/A INTRINSIC
ZnF_TAZ 333 418 2.85e-32 SMART
low complexity region 475 488 N/A INTRINSIC
low complexity region 492 503 N/A INTRINSIC
Pfam:KIX 567 647 7.2e-44 PFAM
low complexity region 722 735 N/A INTRINSIC
low complexity region 831 848 N/A INTRINSIC
low complexity region 852 882 N/A INTRINSIC
low complexity region 884 920 N/A INTRINSIC
low complexity region 924 943 N/A INTRINSIC
low complexity region 1024 1039 N/A INTRINSIC
BROMO 1047 1157 6.36e-42 SMART
Blast:KAT11 1227 1300 9e-22 BLAST
KAT11 1305 1610 1.19e-140 SMART
ZnF_ZZ 1663 1704 2.67e-15 SMART
ZnF_TAZ 1728 1806 5.53e-30 SMART
low complexity region 1810 1836 N/A INTRINSIC
low complexity region 1847 1881 N/A INTRINSIC
low complexity region 1902 1927 N/A INTRINSIC
low complexity region 1962 1979 N/A INTRINSIC
Pfam:Creb_binding 1993 2099 3.5e-37 PFAM
low complexity region 2146 2158 N/A INTRINSIC
low complexity region 2187 2203 N/A INTRINSIC
low complexity region 2205 2244 N/A INTRINSIC
low complexity region 2254 2265 N/A INTRINSIC
low complexity region 2303 2346 N/A INTRINSIC
low complexity region 2390 2405 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187776
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205816
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206431
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 95.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the adenovirus E1A-associated cellular p300 transcriptional co-activator protein. It functions as histone acetyltransferase that regulates transcription via chromatin remodeling and is important in the processes of cell proliferation and differentiation. It mediates cAMP-gene regulation by binding specifically to phosphorylated CREB protein. This gene has also been identified as a co-activator of HIF1A (hypoxia-inducible factor 1 alpha), and thus plays a role in the stimulation of hypoxia-induced genes such as VEGF. Defects in this gene are a cause of Rubinstein-Taybi syndrome and may also play a role in epithelial cancer. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit defects of the heart, lung, and small intestine and die at midgestation; heterozygotes also show some embryonic loss. Heterozygotes for an acetyltransferase-negative mutation die by the neonatal period. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210010C04Rik A G 6: 41,035,462 F6S probably benign Het
2810474O19Rik T A 6: 149,328,822 I1122K probably benign Het
A930003A15Rik T G 16: 19,883,780 noncoding transcript Het
Abca5 T C 11: 110,319,832 T174A probably benign Het
Abcg3 G A 5: 104,966,814 S279L probably benign Het
Acap3 T C 4: 155,896,912 L85P probably damaging Het
Adgrl3 A G 5: 81,512,254 K290R probably damaging Het
Ankhd1 A G 18: 36,647,621 T1909A probably benign Het
Asap1 T C 15: 64,110,959 D832G probably damaging Het
Atp6v0a2 T A 5: 124,718,488 L702Q possibly damaging Het
Bsn A G 9: 108,113,231 V1774A probably damaging Het
Cd209e T C 8: 3,853,248 E48G probably benign Het
Cdadc1 T C 14: 59,568,044 probably null Het
Cfap65 C CA 1: 74,917,273 probably null Het
Cln3 A C 7: 126,582,799 S30R probably benign Het
Cluap1 C T 16: 3,933,772 R332W probably damaging Het
Crb1 A T 1: 139,337,425 V85E probably benign Het
Crocc G A 4: 141,032,954 R789W probably damaging Het
Cwh43 A G 5: 73,415,054 I212V probably benign Het
Cyp2t4 C A 7: 27,158,160 F391L probably benign Het
Dhx35 G T 2: 158,831,861 R404L probably damaging Het
Disp1 A G 1: 183,088,378 L826S probably damaging Het
Dync2h1 T A 9: 7,122,772 E2061D probably damaging Het
Fap C T 2: 62,524,207 G446D possibly damaging Het
Fat3 A G 9: 16,377,051 I392T probably benign Het
Fpr-rs4 CAGGAA CA 17: 18,022,334 probably null Het
Glipr1l1 T C 10: 112,060,476 V56A probably damaging Het
Grsf1 A G 5: 88,672,658 V7A probably benign Het
Hmcn1 G A 1: 150,633,659 A3646V probably damaging Het
Ipo9 A T 1: 135,394,285 I569N probably damaging Het
Irs1 G T 1: 82,290,042 P151Q probably damaging Het
Kalrn T C 16: 34,307,724 D491G possibly damaging Het
Kctd7 T C 5: 130,152,366 L210P probably damaging Het
Lifr C A 15: 7,181,857 D625E possibly damaging Het
Lrguk T C 6: 34,043,519 V201A probably benign Het
Mark1 A G 1: 184,919,573 V135A probably damaging Het
Mical2 T A 7: 112,271,515 D70E possibly damaging Het
Mrc1 T C 2: 14,270,189 Y434H probably damaging Het
Myh10 C A 11: 68,804,714 Q1556K probably damaging Het
Nav1 G A 1: 135,454,436 T1400I probably null Het
Olfr1173 T C 2: 88,274,240 K270E probably damaging Het
Olfr1178 T A 2: 88,391,319 I24N probably benign Het
Olfr1289 T C 2: 111,483,616 V62A probably damaging Het
Olfr13 A G 6: 43,174,501 K172E probably benign Het
Olfr142 A C 2: 90,252,253 V245G probably damaging Het
Olfr339 A G 2: 36,421,938 D180G probably damaging Het
Olfr513 G A 7: 108,755,223 M122I possibly damaging Het
Osmr T A 15: 6,852,462 Q67L probably damaging Het
Pan2 T G 10: 128,313,637 V522G possibly damaging Het
Pard3 T G 8: 127,376,885 probably null Het
Pcdhgc5 G T 18: 37,820,113 A147S possibly damaging Het
Pcsk9 T C 4: 106,446,770 I506V probably benign Het
Polr3d GCCCCC GCCCC 14: 70,443,047 probably null Het
Prdm4 G A 10: 85,893,351 R731* probably null Het
Prdx6b T A 2: 80,293,163 D105E probably damaging Het
Rab42 A G 4: 132,302,479 L144P probably damaging Het
Ralbp1 T A 17: 65,864,666 K104M probably damaging Het
Rrp12 A G 19: 41,892,599 V131A probably damaging Het
Sbno1 C T 5: 124,387,534 probably null Het
Sbno2 A T 10: 80,062,693 I645N probably damaging Het
Scfd2 T C 5: 74,206,367 K624R probably benign Het
Sgk2 C A 2: 162,999,179 probably null Het
Sirt4 A G 5: 115,479,701 S299P probably benign Het
Slit2 C T 5: 48,304,225 A1521V probably benign Het
Socs7 T G 11: 97,373,107 V275G possibly damaging Het
Spink11 G A 18: 44,190,487 P102S probably benign Het
Tacc3 A G 5: 33,671,404 N534D probably damaging Het
Tas2r115 T C 6: 132,737,346 Y214C probably damaging Het
Tcaf1 A T 6: 42,673,520 M875K probably benign Het
Ttc22 T A 4: 106,622,672 L41Q possibly damaging Het
Ttc37 T C 13: 76,173,354 S1322P possibly damaging Het
Vasn T A 16: 4,649,795 C535* probably null Het
Vcan T A 13: 89,689,737 I2563F probably damaging Het
Vmn2r63 T G 7: 42,926,873 Q505H probably damaging Het
Vmn2r65 T G 7: 84,943,573 Q475H probably damaging Het
Zbtb43 T C 2: 33,454,520 Y231C probably damaging Het
Zfp292 A G 4: 34,810,266 V931A probably benign Het
Other mutations in Ep300
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00236:Ep300 APN 15 81641418 missense unknown
IGL01128:Ep300 APN 15 81630006 unclassified probably benign
IGL01151:Ep300 APN 15 81623472 intron probably benign
IGL01414:Ep300 APN 15 81627266 unclassified probably benign
IGL01564:Ep300 APN 15 81632464 unclassified probably benign
IGL01875:Ep300 APN 15 81640023 missense unknown
IGL01945:Ep300 APN 15 81616109 unclassified probably benign
IGL02022:Ep300 APN 15 81611437 unclassified probably benign
IGL02115:Ep300 APN 15 81648818 missense unknown
IGL02129:Ep300 APN 15 81586636 missense unknown
IGL02145:Ep300 APN 15 81601166 missense unknown
IGL02149:Ep300 APN 15 81628420 unclassified probably benign
IGL02165:Ep300 APN 15 81641391 missense probably benign 0.39
IGL02226:Ep300 APN 15 81613412 missense unknown
IGL02610:Ep300 APN 15 81601522 missense unknown
IGL02731:Ep300 APN 15 81648414 missense unknown
IGL03239:Ep300 APN 15 81641388 missense unknown
R0077:Ep300 UTSW 15 81641313 missense unknown
R0145:Ep300 UTSW 15 81616127 critical splice donor site probably null
R0244:Ep300 UTSW 15 81640128 missense unknown
R0390:Ep300 UTSW 15 81640116 missense unknown
R0534:Ep300 UTSW 15 81600896 splice site probably benign
R0671:Ep300 UTSW 15 81616134 unclassified probably benign
R0840:Ep300 UTSW 15 81644933 missense unknown
R1166:Ep300 UTSW 15 81630064 unclassified probably benign
R1737:Ep300 UTSW 15 81626347 missense probably damaging 0.99
R1893:Ep300 UTSW 15 81631646 unclassified probably benign
R3427:Ep300 UTSW 15 81601279 missense unknown
R3757:Ep300 UTSW 15 81648589 missense unknown
R3892:Ep300 UTSW 15 81619997 unclassified probably benign
R4554:Ep300 UTSW 15 81601430 missense unknown
R4575:Ep300 UTSW 15 81649009 missense unknown
R4575:Ep300 UTSW 15 81611410 unclassified probably benign
R4577:Ep300 UTSW 15 81611410 unclassified probably benign
R4577:Ep300 UTSW 15 81649009 missense unknown
R4578:Ep300 UTSW 15 81649009 missense unknown
R4578:Ep300 UTSW 15 81611410 unclassified probably benign
R5021:Ep300 UTSW 15 81640023 missense unknown
R5366:Ep300 UTSW 15 81616100 missense probably benign 0.24
R5372:Ep300 UTSW 15 81636830 missense unknown
R5393:Ep300 UTSW 15 81631618 unclassified probably benign
R5410:Ep300 UTSW 15 81648854 missense unknown
R5571:Ep300 UTSW 15 81643217 intron probably benign
R5701:Ep300 UTSW 15 81601495 missense unknown
R5772:Ep300 UTSW 15 81639914 intron probably benign
R5825:Ep300 UTSW 15 81611472 missense probably benign 0.39
R5917:Ep300 UTSW 15 81628607 unclassified probably benign
R5991:Ep300 UTSW 15 81648466 missense unknown
R6019:Ep300 UTSW 15 81641382 missense unknown
R6144:Ep300 UTSW 15 81601234 missense unknown
R6291:Ep300 UTSW 15 81648507 missense unknown
R6292:Ep300 UTSW 15 81616734 unclassified probably benign
R6599:Ep300 UTSW 15 81586713 missense unknown
R6804:Ep300 UTSW 15 81641311 nonsense probably null
R6925:Ep300 UTSW 15 81649981 missense probably benign 0.32
R7327:Ep300 UTSW 15 81627314 missense unknown
R7378:Ep300 UTSW 15 81650545 missense probably damaging 0.97
R7388:Ep300 UTSW 15 81648366 missense unknown
R7419:Ep300 UTSW 15 81648514 missense unknown
R7498:Ep300 UTSW 15 81639843 missense unknown
R7584:Ep300 UTSW 15 81628426 missense unknown
R7605:Ep300 UTSW 15 81621152 missense unknown
R7619:Ep300 UTSW 15 81608198 missense unknown
R7763:Ep300 UTSW 15 81586583 start gained probably benign
R7775:Ep300 UTSW 15 81586686 missense unknown
R7778:Ep300 UTSW 15 81586686 missense unknown
R7862:Ep300 UTSW 15 81650753 missense probably damaging 1.00
R7945:Ep300 UTSW 15 81650753 missense probably damaging 1.00
RF020:Ep300 UTSW 15 81586571 start gained probably benign
Predicted Primers PCR Primer
(F):5'- TAGCATGTACCAGGTCAGTCC -3'
(R):5'- ACAAACTGAGTTCATGGCTCC -3'

Sequencing Primer
(F):5'- TGTACCAGGTCAGTCCTACATAG -3'
(R):5'- AGTTCATGGCTCCACTGTATCATAAC -3'
Posted On2014-10-01