Incidental Mutation 'R2136:Ralbp1'
ID235850
Institutional Source Beutler Lab
Gene Symbol Ralbp1
Ensembl Gene ENSMUSG00000024096
Gene NameralA binding protein 1
SynonymsRLIP76, Rip1
MMRRC Submission 040139-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.556) question?
Stock #R2136 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location65848433-65885755 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 65864666 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Methionine at position 104 (K104M)
Ref Sequence ENSEMBL: ENSMUSP00000129448 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024905] [ENSMUST00000166543]
Predicted Effect probably damaging
Transcript: ENSMUST00000024905
AA Change: K104M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000024905
Gene: ENSMUSG00000024096
AA Change: K104M

DomainStartEndE-ValueType
low complexity region 63 80 N/A INTRINSIC
low complexity region 112 152 N/A INTRINSIC
low complexity region 159 180 N/A INTRINSIC
RhoGAP 207 373 1.04e-60 SMART
Blast:RhoGAP 391 493 1e-48 BLAST
low complexity region 533 551 N/A INTRINSIC
low complexity region 587 598 N/A INTRINSIC
low complexity region 602 621 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000166543
AA Change: K104M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000129448
Gene: ENSMUSG00000024096
AA Change: K104M

DomainStartEndE-ValueType
low complexity region 63 80 N/A INTRINSIC
low complexity region 112 152 N/A INTRINSIC
low complexity region 159 180 N/A INTRINSIC
RhoGAP 207 373 1.04e-60 SMART
Blast:RhoGAP 391 493 1e-48 BLAST
low complexity region 533 551 N/A INTRINSIC
low complexity region 587 598 N/A INTRINSIC
low complexity region 602 621 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 95.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] RALBP1 plays a role in receptor-mediated endocytosis and is a downstream effector of the small GTP-binding protein RAL (see RALA; MIM 179550). Small G proteins, such as RAL, have GDP-bound inactive and GTP-bound active forms, which shift from the inactive to the active state through the action of RALGDS (MIM 601619), which in turn is activated by RAS (see HRAS; MIM 190020) (summary by Feig, 2003 [PubMed 12888294]).[supplied by OMIM, Nov 2010]
PHENOTYPE: Homozygous and heterozygous null mice display increased sensitivity to X-ray irradiation, increased oxidative stress, and impaired glutathione homeostasis. Mice homozygous for a gene trap insertion exhibit decreases in exploratory and locomotor activity and a decreased sensitivity to pain. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210010C04Rik A G 6: 41,035,462 F6S probably benign Het
2810474O19Rik T A 6: 149,328,822 I1122K probably benign Het
A930003A15Rik T G 16: 19,883,780 noncoding transcript Het
Abca5 T C 11: 110,319,832 T174A probably benign Het
Abcg3 G A 5: 104,966,814 S279L probably benign Het
Acap3 T C 4: 155,896,912 L85P probably damaging Het
Adgrl3 A G 5: 81,512,254 K290R probably damaging Het
Ankhd1 A G 18: 36,647,621 T1909A probably benign Het
Asap1 T C 15: 64,110,959 D832G probably damaging Het
Atp6v0a2 T A 5: 124,718,488 L702Q possibly damaging Het
Bsn A G 9: 108,113,231 V1774A probably damaging Het
Cd209e T C 8: 3,853,248 E48G probably benign Het
Cdadc1 T C 14: 59,568,044 probably null Het
Cfap65 C CA 1: 74,917,273 probably null Het
Cln3 A C 7: 126,582,799 S30R probably benign Het
Cluap1 C T 16: 3,933,772 R332W probably damaging Het
Crb1 A T 1: 139,337,425 V85E probably benign Het
Crocc G A 4: 141,032,954 R789W probably damaging Het
Cwh43 A G 5: 73,415,054 I212V probably benign Het
Cyp2t4 C A 7: 27,158,160 F391L probably benign Het
Dhx35 G T 2: 158,831,861 R404L probably damaging Het
Disp1 A G 1: 183,088,378 L826S probably damaging Het
Dync2h1 T A 9: 7,122,772 E2061D probably damaging Het
Ep300 T A 15: 81,640,447 Y1393N unknown Het
Fap C T 2: 62,524,207 G446D possibly damaging Het
Fat3 A G 9: 16,377,051 I392T probably benign Het
Fpr-rs4 CAGGAA CA 17: 18,022,334 probably null Het
Glipr1l1 T C 10: 112,060,476 V56A probably damaging Het
Grsf1 A G 5: 88,672,658 V7A probably benign Het
Hmcn1 G A 1: 150,633,659 A3646V probably damaging Het
Ipo9 A T 1: 135,394,285 I569N probably damaging Het
Irs1 G T 1: 82,290,042 P151Q probably damaging Het
Kalrn T C 16: 34,307,724 D491G possibly damaging Het
Kctd7 T C 5: 130,152,366 L210P probably damaging Het
Lifr C A 15: 7,181,857 D625E possibly damaging Het
Lrguk T C 6: 34,043,519 V201A probably benign Het
Mark1 A G 1: 184,919,573 V135A probably damaging Het
Mical2 T A 7: 112,271,515 D70E possibly damaging Het
Mrc1 T C 2: 14,270,189 Y434H probably damaging Het
Myh10 C A 11: 68,804,714 Q1556K probably damaging Het
Nav1 G A 1: 135,454,436 T1400I probably null Het
Olfr1173 T C 2: 88,274,240 K270E probably damaging Het
Olfr1178 T A 2: 88,391,319 I24N probably benign Het
Olfr1289 T C 2: 111,483,616 V62A probably damaging Het
Olfr13 A G 6: 43,174,501 K172E probably benign Het
Olfr142 A C 2: 90,252,253 V245G probably damaging Het
Olfr339 A G 2: 36,421,938 D180G probably damaging Het
Olfr513 G A 7: 108,755,223 M122I possibly damaging Het
Osmr T A 15: 6,852,462 Q67L probably damaging Het
Pan2 T G 10: 128,313,637 V522G possibly damaging Het
Pard3 T G 8: 127,376,885 probably null Het
Pcdhgc5 G T 18: 37,820,113 A147S possibly damaging Het
Pcsk9 T C 4: 106,446,770 I506V probably benign Het
Polr3d GCCCCC GCCCC 14: 70,443,047 probably null Het
Prdm4 G A 10: 85,893,351 R731* probably null Het
Prdx6b T A 2: 80,293,163 D105E probably damaging Het
Rab42 A G 4: 132,302,479 L144P probably damaging Het
Rrp12 A G 19: 41,892,599 V131A probably damaging Het
Sbno1 C T 5: 124,387,534 probably null Het
Sbno2 A T 10: 80,062,693 I645N probably damaging Het
Scfd2 T C 5: 74,206,367 K624R probably benign Het
Sgk2 C A 2: 162,999,179 probably null Het
Sirt4 A G 5: 115,479,701 S299P probably benign Het
Slit2 C T 5: 48,304,225 A1521V probably benign Het
Socs7 T G 11: 97,373,107 V275G possibly damaging Het
Spink11 G A 18: 44,190,487 P102S probably benign Het
Tacc3 A G 5: 33,671,404 N534D probably damaging Het
Tas2r115 T C 6: 132,737,346 Y214C probably damaging Het
Tcaf1 A T 6: 42,673,520 M875K probably benign Het
Ttc22 T A 4: 106,622,672 L41Q possibly damaging Het
Ttc37 T C 13: 76,173,354 S1322P possibly damaging Het
Vasn T A 16: 4,649,795 C535* probably null Het
Vcan T A 13: 89,689,737 I2563F probably damaging Het
Vmn2r63 T G 7: 42,926,873 Q505H probably damaging Het
Vmn2r65 T G 7: 84,943,573 Q475H probably damaging Het
Zbtb43 T C 2: 33,454,520 Y231C probably damaging Het
Zfp292 A G 4: 34,810,266 V931A probably benign Het
Other mutations in Ralbp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00671:Ralbp1 APN 17 65864612 missense possibly damaging 0.87
IGL00736:Ralbp1 APN 17 65864723 missense probably damaging 1.00
IGL01318:Ralbp1 APN 17 65864282 missense probably damaging 1.00
IGL01661:Ralbp1 APN 17 65861389 missense probably damaging 0.99
IGL02523:Ralbp1 APN 17 65859091 missense probably damaging 0.99
R0507:Ralbp1 UTSW 17 65849960 missense probably benign 0.08
R0666:Ralbp1 UTSW 17 65854129 missense probably benign 0.28
R0674:Ralbp1 UTSW 17 65852753 missense probably benign 0.28
R1418:Ralbp1 UTSW 17 65859148 splice site probably benign
R2320:Ralbp1 UTSW 17 65852747 missense possibly damaging 0.71
R4657:Ralbp1 UTSW 17 65852691 missense probably null 0.99
R5482:Ralbp1 UTSW 17 65861568 nonsense probably null
R5545:Ralbp1 UTSW 17 65850104 missense possibly damaging 0.77
R5967:Ralbp1 UTSW 17 65864279 missense probably benign 0.19
R6512:Ralbp1 UTSW 17 65861275 missense probably damaging 1.00
R6853:Ralbp1 UTSW 17 65852756 missense possibly damaging 0.86
R7399:Ralbp1 UTSW 17 65854148 missense probably benign 0.01
R7423:Ralbp1 UTSW 17 65858981 missense probably damaging 0.99
R7545:Ralbp1 UTSW 17 65867598 missense probably benign
R8394:Ralbp1 UTSW 17 65852753 missense probably benign 0.28
Predicted Primers PCR Primer
(F):5'- CTGTTTAACAACATCAGCTGCTG -3'
(R):5'- GTGGTCACTGAGTGTCACTAC -3'

Sequencing Primer
(F):5'- ACATCAGCTGCTGTCAAGTC -3'
(R):5'- GGTCACTGAGTGTCACTACTCTATTG -3'
Posted On2014-10-01