Mutagenetix > Incidental Mutation

Incidental Mutation 'R2137:Lats1'

235896

Institutional Source

Beutler Lab

Gene Symbol

Lats1

Ensembl Gene

ENSMUSG00000040021

Gene Name

large tumor suppressor

Synonyms

MMRRC Submission

040140-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.890) question?

Stock #

R2137 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

7681214-7716460 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 7701847 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 245 (V245A)

Ref Sequence

ENSEMBL: ENSMUSP00000151533 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000040043] [ENSMUST00000165952] [ENSMUST00000217931]

AlphaFold

Q8BYR2

Predicted Effect

possibly damaging
Transcript: ENSMUST00000040043
AA Change: V245A

PolyPhen 2 Score 0.708 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000041915
Gene: ENSMUSG00000040021
AA Change: V245A

Domain	Start	End	E-Value	Type
Pfam:UBA	101	138	7.4e-11	PFAM
low complexity region	228	267	N/A	INTRINSIC
low complexity region	301	314	N/A	INTRINSIC
low complexity region	371	379	N/A	INTRINSIC
low complexity region	433	445	N/A	INTRINSIC
low complexity region	482	493	N/A	INTRINSIC
low complexity region	520	530	N/A	INTRINSIC
low complexity region	554	559	N/A	INTRINSIC
S_TKc	704	1009	7.3e-99	SMART
S_TK_X	1010	1081	1.2e-2	SMART
low complexity region	1102	1120	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000165952
AA Change: V245A

PolyPhen 2 Score 0.708 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000132078
Gene: ENSMUSG00000040021
AA Change: V245A

Domain	Start	End	E-Value	Type
Pfam:UBA	101	138	7.4e-11	PFAM
low complexity region	228	267	N/A	INTRINSIC
low complexity region	301	314	N/A	INTRINSIC
low complexity region	371	379	N/A	INTRINSIC
low complexity region	433	445	N/A	INTRINSIC
low complexity region	482	493	N/A	INTRINSIC
low complexity region	520	530	N/A	INTRINSIC
low complexity region	554	559	N/A	INTRINSIC
S_TKc	704	1009	7.3e-99	SMART
S_TK_X	1010	1081	1.2e-2	SMART
low complexity region	1102	1120	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000217931
AA Change: V245A

PolyPhen 2 Score 0.708 (Sensitivity: 0.86; Specificity: 0.92)

Meta Mutation Damage Score

0.0585

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.4%
20x: 95.4%

Validation Efficiency

97% (60/62)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a putative serine/threonine kinase that localizes to the mitotic apparatus and complexes with cell cycle controller CDC2 kinase in early mitosis. The protein is phosphorylated in a cell-cycle dependent manner, with late prophase phosphorylation remaining through metaphase. The N-terminal region of the protein binds CDC2 to form a complex showing reduced H1 histone kinase activity, indicating a role as a negative regulator of CDC2/cyclin A. In addition, the C-terminal kinase domain binds to its own N-terminal region, suggesting potential negative regulation through interference with complex formation via intramolecular binding. Biochemical and genetic data suggest a role as a tumor suppressor. This is supported by studies in knockout mice showing development of soft-tissue sarcomas, ovarian stromal cell tumors and a high sensitivity to carcinogenic treatments. Two protein-coding transcripts and one non-protein coding transcript have been found for this gene. [provided by RefSeq, Jul 2012]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit high postnatal mortality, lack of mammary development, infertility, pituitary hyperplasia, reduced hormone levels, growth retardation, and susceptibility to sarcomas and ovarian stromal cell tumors. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 63 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ankrd24	C	T	10: 81,646,309	T88I	probably damaging	Het
Atm	A	T	9: 53,453,375	V49D	probably damaging	Het
Bub1b	G	T	2: 118,636,718	E841*	probably null	Het
Ccdc129	A	G	6: 55,889,189	Q189R	probably damaging	Het
Cdh22	G	A	2: 165,116,394		probably benign	Het
Cdh7	A	T	1: 110,100,106	N527I	probably damaging	Het
Cog1	T	C	11: 113,659,301	L262P	probably damaging	Het
Col22a1	T	C	15: 72,006,948	H120R	possibly damaging	Het
Col4a2	T	C	8: 11,433,749	S890P	probably benign	Het
Cubn	T	C	2: 13,336,167	I2248V	probably benign	Het
Evpl	T	C	11: 116,221,839	E1675G	probably damaging	Het
Faiml	G	A	9: 99,232,492	P115S	probably benign	Het
Fgg	A	T	3: 83,008,438	D62V	possibly damaging	Het
Gak	C	T	5: 108,606,877		probably null	Het
Galntl6	C	T	8: 58,535,905		probably null	Het
Glyr1	T	C	16: 5,018,482	Y501C	probably benign	Het
Gm9847	G	T	12: 14,495,081		noncoding transcript	Het
Gria4	T	G	9: 4,427,026		probably benign	Het
Il1f8	A	G	2: 24,154,660	N24S	probably benign	Het
Il6st	C	A	13: 112,502,858	H606N	possibly damaging	Het
Kctd10	A	G	5: 114,367,328	F202L	probably damaging	Het
Kif17	T	A	4: 138,262,667	D55E	probably damaging	Het
Klf1	C	T	8: 84,903,146	A200V	possibly damaging	Het
Klhl32	A	T	4: 24,629,275	Y497*	probably null	Het
Kng2	G	T	16: 22,997,326		probably benign	Het
Mbd3l2	A	T	9: 18,444,958	D193V	probably damaging	Het
Ms4a18	A	T	19: 10,997,331	V332D	possibly damaging	Het
Mss51	T	C	14: 20,487,523	I47V	probably benign	Het
Myoz2	G	A	3: 123,034,212	T19M	probably benign	Het
Nampt	T	A	12: 32,830,310	N67K	probably benign	Het
Ncor2	A	T	5: 125,030,712	I1607K	probably damaging	Het
Nudt4	T	C	10: 95,563,738	Q7R	probably damaging	Het
Olfr1475	A	G	19: 13,479,809	Y130H	probably damaging	Het
Olfr1480	T	A	19: 13,530,438	I255N	probably damaging	Het
Olfr870	T	A	9: 20,171,167	I135F	probably damaging	Het
Pgm1	A	T	5: 64,116,366	M565L	probably benign	Het
Phactr1	T	G	13: 43,135,175	F639V	possibly damaging	Het
Plod3	C	A	5: 136,988,717	R165S	probably damaging	Het
Polr2b	T	A	5: 77,320,346	N164K	probably benign	Het
Rcbtb2	G	A	14: 73,162,051	G52S	probably damaging	Het
Rfc1	A	G	5: 65,311,039		probably null	Het
Rheb	A	G	5: 24,807,603		probably null	Het
Rin2	C	T	2: 145,860,446	T354I	probably benign	Het
Ripor2	G	A	13: 24,721,834		probably null	Het
Rsf1	ATGGCG	ATGGCGACGGTGGCG	7: 97,579,904		probably benign	Het
Scg3	A	T	9: 75,676,810	D136E	probably damaging	Het
Slc10a4	C	T	5: 73,007,580	L172F	probably damaging	Het
Slc35c2	A	G	2: 165,281,379	Y113H	probably damaging	Het
Slc47a1	T	A	11: 61,344,492	D505V	probably benign	Het
Snap29	C	A	16: 17,428,249	D244E	possibly damaging	Het
Taar1	T	C	10: 23,921,270	F289L	probably benign	Het
Thbs2	T	A	17: 14,673,306	N871Y	probably damaging	Het
Tmem108	T	A	9: 103,499,963	T96S	possibly damaging	Het
Tnk2	G	T	16: 32,670,802		probably null	Het
Trak1	T	A	9: 121,472,962	M928K	possibly damaging	Het
Tuba3b	A	G	6: 145,618,833	I110V	probably benign	Het
Tyk2	A	G	9: 21,110,985		probably benign	Het
Ugt1a9	T	A	1: 88,071,037	C70S	probably benign	Het
Vmn2r10	A	T	5: 109,003,544	I68K	possibly damaging	Het
Wfs1	T	C	5: 36,967,501	E682G	probably damaging	Het
Zfp213	T	C	17: 23,559,507		probably null	Het
Zfp809	T	C	9: 22,235,138	V41A	probably benign	Het
Zfp831	A	G	2: 174,705,746	K1574R	possibly damaging	Het

Other mutations in Lats1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00234:Lats1	APN	10	7691566	missense	probably damaging	0.99
IGL00595:Lats1	APN	10	7702305	missense	probably benign	0.00
IGL00932:Lats1	APN	10	7712742	missense	possibly damaging	0.69
IGL01019:Lats1	APN	10	7705671	missense	probably damaging	1.00
IGL01380:Lats1	APN	10	7691780	missense	possibly damaging	0.69
IGL01965:Lats1	APN	10	7701706	missense	probably benign	0.10
IGL02027:Lats1	APN	10	7712948	missense	probably benign
IGL02611:Lats1	APN	10	7705787	missense	possibly damaging	0.91
IGL02997:Lats1	APN	10	7702254	missense	possibly damaging	0.53
IGL03107:Lats1	APN	10	7712746	missense	probably benign	0.15
I1329:Lats1	UTSW	10	7712802	missense	probably benign	0.10
PIT4378001:Lats1	UTSW	10	7705605	missense	probably damaging	1.00
R0153:Lats1	UTSW	10	7691575	missense	probably damaging	1.00
R0568:Lats1	UTSW	10	7712528	missense	possibly damaging	0.69
R0581:Lats1	UTSW	10	7702941	missense	possibly damaging	0.67
R0604:Lats1	UTSW	10	7712661	missense	probably damaging	0.96
R1681:Lats1	UTSW	10	7705914	missense	probably damaging	0.99
R1694:Lats1	UTSW	10	7701945	missense	probably benign	0.07
R1840:Lats1	UTSW	10	7710939	nonsense	probably null
R1914:Lats1	UTSW	10	7710457	splice site	probably benign
R2317:Lats1	UTSW	10	7691776	nonsense	probably null
R3863:Lats1	UTSW	10	7705746	missense	probably damaging	1.00
R3864:Lats1	UTSW	10	7705746	missense	probably damaging	1.00
R4597:Lats1	UTSW	10	7691746	missense	probably benign	0.00
R4657:Lats1	UTSW	10	7705684	missense	possibly damaging	0.82
R4658:Lats1	UTSW	10	7702729	missense	probably benign
R4663:Lats1	UTSW	10	7712583	missense	probably damaging	1.00
R4870:Lats1	UTSW	10	7705785	missense	probably damaging	1.00
R5101:Lats1	UTSW	10	7712584	nonsense	probably null
R5134:Lats1	UTSW	10	7691811	missense	probably benign	0.34
R5150:Lats1	UTSW	10	7712651	missense	probably benign
R5546:Lats1	UTSW	10	7705754	missense	probably damaging	0.99
R5820:Lats1	UTSW	10	7705908	missense	probably damaging	1.00
R6006:Lats1	UTSW	10	7705595	missense	probably damaging	1.00
R6301:Lats1	UTSW	10	7703107	missense	probably benign	0.01
R6544:Lats1	UTSW	10	7701670	missense	possibly damaging	0.94
R6647:Lats1	UTSW	10	7697507	missense	possibly damaging	0.81
R6874:Lats1	UTSW	10	7710851	missense	probably damaging	1.00
R7328:Lats1	UTSW	10	7705547	missense	possibly damaging	0.62
R7390:Lats1	UTSW	10	7702095	nonsense	probably null
R7438:Lats1	UTSW	10	7712942	nonsense	probably null
R7457:Lats1	UTSW	10	7710891	missense	probably damaging	1.00
R7524:Lats1	UTSW	10	7701978	missense	possibly damaging	0.89
R7593:Lats1	UTSW	10	7701712	missense	probably damaging	1.00
R7736:Lats1	UTSW	10	7702364	missense	probably damaging	1.00
R7884:Lats1	UTSW	10	7697526	nonsense	probably null
R8166:Lats1	UTSW	10	7702116	missense	probably benign
R8248:Lats1	UTSW	10	7705903	missense	probably damaging	1.00
R8458:Lats1	UTSW	10	7710924	nonsense	probably null
R8477:Lats1	UTSW	10	7705515	missense	probably damaging	1.00
R8547:Lats1	UTSW	10	7712849	missense	probably damaging	1.00
R9163:Lats1	UTSW	10	7702288	missense	probably benign
R9441:Lats1	UTSW	10	7702917	missense	probably damaging	0.96
R9673:Lats1	UTSW	10	7712623	missense	probably benign	0.29
RF021:Lats1	UTSW	10	7710608	missense	probably damaging	1.00
X0026:Lats1	UTSW	10	7710623	missense	probably damaging	1.00
X0053:Lats1	UTSW	10	7691609	missense	probably benign	0.00
Z1176:Lats1	UTSW	10	7705809	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TAGTTCCTCAGAGACACGGC -3'
(R):5'- CAGAACTAATGGCCCTCTGAGC -3'

Sequencing Primer
(F):5'- CGGCCCATCTCTAGGAGAAAATG -3'
(R):5'- AGCCTGGCTAGGGGGATTC -3'

Posted On

2014-10-01