Incidental Mutation 'R2137:Ripor2'
ID235906
Institutional Source Beutler Lab
Gene Symbol Ripor2
Ensembl Gene ENSMUSG00000036006
Gene NameRHO family interacting cell polarization regulator 2
Synonyms6330500D04Rik, E430013J17Rik, Fam65b, 1700108N18Rik
MMRRC Submission 040140-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.221) question?
Stock #R2137 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location24582189-24733816 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) G to A at 24721834 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000106013 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110383] [ENSMUST00000110383] [ENSMUST00000110384] [ENSMUST00000110384]
Predicted Effect probably null
Transcript: ENSMUST00000110383
SMART Domains Protein: ENSMUSP00000106012
Gene: ENSMUSG00000036006

DomainStartEndE-ValueType
coiled coil region 83 112 N/A INTRINSIC
low complexity region 436 451 N/A INTRINSIC
low complexity region 630 639 N/A INTRINSIC
low complexity region 657 672 N/A INTRINSIC
low complexity region 857 864 N/A INTRINSIC
SCOP:d1gw5a_ 901 1023 2e-9 SMART
Predicted Effect probably null
Transcript: ENSMUST00000110383
SMART Domains Protein: ENSMUSP00000106012
Gene: ENSMUSG00000036006

DomainStartEndE-ValueType
coiled coil region 83 112 N/A INTRINSIC
low complexity region 436 451 N/A INTRINSIC
low complexity region 630 639 N/A INTRINSIC
low complexity region 657 672 N/A INTRINSIC
low complexity region 857 864 N/A INTRINSIC
SCOP:d1gw5a_ 901 1023 2e-9 SMART
Predicted Effect probably null
Transcript: ENSMUST00000110384
SMART Domains Protein: ENSMUSP00000106013
Gene: ENSMUSG00000036006

DomainStartEndE-ValueType
Pfam:PL48 41 389 6e-174 PFAM
low complexity region 461 476 N/A INTRINSIC
low complexity region 655 664 N/A INTRINSIC
low complexity region 682 697 N/A INTRINSIC
low complexity region 882 889 N/A INTRINSIC
SCOP:d1gw5a_ 926 1048 2e-9 SMART
Predicted Effect probably null
Transcript: ENSMUST00000110384
SMART Domains Protein: ENSMUSP00000106013
Gene: ENSMUSG00000036006

DomainStartEndE-ValueType
Pfam:PL48 41 389 6e-174 PFAM
low complexity region 461 476 N/A INTRINSIC
low complexity region 655 664 N/A INTRINSIC
low complexity region 682 697 N/A INTRINSIC
low complexity region 882 889 N/A INTRINSIC
SCOP:d1gw5a_ 926 1048 2e-9 SMART
Meta Mutation Damage Score 0.9487 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 97% (60/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an atypical inhibitor of the small G protein RhoA. Inhibition of RhoA activity by the encoded protein mediates myoblast fusion and polarization of T cells and neutrophils. The encoded protein is a component of hair cell stereocilia that is essential for hearing. A splice site mutation in this gene results in hearing loss in human patients. [provided by RefSeq, Sep 2016]
PHENOTYPE: Homozygous knockout mice are deaf. The gene product is expressed in the basal region of cochlear hair cell stereocillia, which are disorganized and malformed in null mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd24 C T 10: 81,646,309 T88I probably damaging Het
Atm A T 9: 53,453,375 V49D probably damaging Het
Bub1b G T 2: 118,636,718 E841* probably null Het
Ccdc129 A G 6: 55,889,189 Q189R probably damaging Het
Cdh22 G A 2: 165,116,394 probably benign Het
Cdh7 A T 1: 110,100,106 N527I probably damaging Het
Cog1 T C 11: 113,659,301 L262P probably damaging Het
Col22a1 T C 15: 72,006,948 H120R possibly damaging Het
Col4a2 T C 8: 11,433,749 S890P probably benign Het
Cubn T C 2: 13,336,167 I2248V probably benign Het
Evpl T C 11: 116,221,839 E1675G probably damaging Het
Faiml G A 9: 99,232,492 P115S probably benign Het
Fgg A T 3: 83,008,438 D62V possibly damaging Het
Gak C T 5: 108,606,877 probably null Het
Galntl6 C T 8: 58,535,905 probably null Het
Glyr1 T C 16: 5,018,482 Y501C probably benign Het
Gm9847 G T 12: 14,495,081 noncoding transcript Het
Gria4 T G 9: 4,427,026 probably benign Het
Il1f8 A G 2: 24,154,660 N24S probably benign Het
Il6st C A 13: 112,502,858 H606N possibly damaging Het
Kctd10 A G 5: 114,367,328 F202L probably damaging Het
Kif17 T A 4: 138,262,667 D55E probably damaging Het
Klf1 C T 8: 84,903,146 A200V possibly damaging Het
Klhl32 A T 4: 24,629,275 Y497* probably null Het
Kng2 G T 16: 22,997,326 probably benign Het
Lats1 T C 10: 7,701,847 V245A possibly damaging Het
Mbd3l2 A T 9: 18,444,958 D193V probably damaging Het
Ms4a18 A T 19: 10,997,331 V332D possibly damaging Het
Mss51 T C 14: 20,487,523 I47V probably benign Het
Myoz2 G A 3: 123,034,212 T19M probably benign Het
Nampt T A 12: 32,830,310 N67K probably benign Het
Ncor2 A T 5: 125,030,712 I1607K probably damaging Het
Nudt4 T C 10: 95,563,738 Q7R probably damaging Het
Olfr1475 A G 19: 13,479,809 Y130H probably damaging Het
Olfr1480 T A 19: 13,530,438 I255N probably damaging Het
Olfr870 T A 9: 20,171,167 I135F probably damaging Het
Pgm1 A T 5: 64,116,366 M565L probably benign Het
Phactr1 T G 13: 43,135,175 F639V possibly damaging Het
Plod3 C A 5: 136,988,717 R165S probably damaging Het
Polr2b T A 5: 77,320,346 N164K probably benign Het
Rcbtb2 G A 14: 73,162,051 G52S probably damaging Het
Rfc1 A G 5: 65,311,039 probably null Het
Rheb A G 5: 24,807,603 probably null Het
Rin2 C T 2: 145,860,446 T354I probably benign Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,579,904 probably benign Het
Scg3 A T 9: 75,676,810 D136E probably damaging Het
Slc10a4 C T 5: 73,007,580 L172F probably damaging Het
Slc35c2 A G 2: 165,281,379 Y113H probably damaging Het
Slc47a1 T A 11: 61,344,492 D505V probably benign Het
Snap29 C A 16: 17,428,249 D244E possibly damaging Het
Taar1 T C 10: 23,921,270 F289L probably benign Het
Thbs2 T A 17: 14,673,306 N871Y probably damaging Het
Tmem108 T A 9: 103,499,963 T96S possibly damaging Het
Tnk2 G T 16: 32,670,802 probably null Het
Trak1 T A 9: 121,472,962 M928K possibly damaging Het
Tuba3b A G 6: 145,618,833 I110V probably benign Het
Tyk2 A G 9: 21,110,985 probably benign Het
Ugt1a9 T A 1: 88,071,037 C70S probably benign Het
Vmn2r10 A T 5: 109,003,544 I68K possibly damaging Het
Wfs1 T C 5: 36,967,501 E682G probably damaging Het
Zfp213 T C 17: 23,559,507 probably null Het
Zfp809 T C 9: 22,235,138 V41A probably benign Het
Zfp831 A G 2: 174,705,746 K1574R possibly damaging Het
Other mutations in Ripor2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01099:Ripor2 APN 13 24701207 missense probably benign 0.11
IGL02145:Ripor2 APN 13 24717571 missense probably damaging 1.00
IGL02351:Ripor2 APN 13 24731589 missense probably damaging 1.00
IGL02358:Ripor2 APN 13 24731589 missense probably damaging 1.00
IGL02377:Ripor2 APN 13 24695566 splice site probably benign
IGL02533:Ripor2 APN 13 24701395 nonsense probably null
IGL02798:Ripor2 APN 13 24674666 missense probably damaging 0.99
IGL02852:Ripor2 APN 13 24695698 missense probably damaging 1.00
IGL02869:Ripor2 APN 13 24696529 missense possibly damaging 0.46
IGL03219:Ripor2 APN 13 24723719 missense probably damaging 1.00
gentleman UTSW 13 24694145 missense probably damaging 1.00
Jack UTSW 13 24677841 nonsense probably null
whitechapel UTSW 13 24673112 critical splice donor site probably null
R0045:Ripor2 UTSW 13 24694226 missense probably damaging 1.00
R0101:Ripor2 UTSW 13 24680632 missense probably damaging 1.00
R0731:Ripor2 UTSW 13 24680644 missense probably damaging 1.00
R0827:Ripor2 UTSW 13 24694186 missense probably damaging 1.00
R1331:Ripor2 UTSW 13 24677841 nonsense probably null
R1374:Ripor2 UTSW 13 24673112 critical splice donor site probably null
R1564:Ripor2 UTSW 13 24675785 missense probably damaging 1.00
R1773:Ripor2 UTSW 13 24701254 missense probably benign 0.10
R1889:Ripor2 UTSW 13 24693887 missense probably damaging 1.00
R2122:Ripor2 UTSW 13 24713718 missense probably damaging 0.98
R2209:Ripor2 UTSW 13 24701612 missense probably damaging 1.00
R2242:Ripor2 UTSW 13 24671772 missense probably benign 0.08
R2392:Ripor2 UTSW 13 24706223 missense probably benign 0.00
R2994:Ripor2 UTSW 13 24701627 missense probably damaging 0.98
R4008:Ripor2 UTSW 13 24696538 missense probably benign
R4287:Ripor2 UTSW 13 24725009 missense probably damaging 1.00
R4364:Ripor2 UTSW 13 24721711 missense probably benign 0.07
R4365:Ripor2 UTSW 13 24721711 missense probably benign 0.07
R4366:Ripor2 UTSW 13 24721711 missense probably benign 0.07
R4868:Ripor2 UTSW 13 24694141 missense possibly damaging 0.88
R5304:Ripor2 UTSW 13 24674666 missense probably damaging 0.99
R6119:Ripor2 UTSW 13 24614644 start gained probably benign
R6157:Ripor2 UTSW 13 24701069 missense probably damaging 1.00
R6178:Ripor2 UTSW 13 24710130 missense possibly damaging 0.94
R6382:Ripor2 UTSW 13 24677845 missense possibly damaging 0.89
R6664:Ripor2 UTSW 13 24675820 missense probably damaging 0.98
R6908:Ripor2 UTSW 13 24706232 missense probably damaging 1.00
R7023:Ripor2 UTSW 13 24671846 missense probably benign 0.00
R7041:Ripor2 UTSW 13 24693766 missense probably benign 0.18
R7196:Ripor2 UTSW 13 24704825 missense possibly damaging 0.66
R7216:Ripor2 UTSW 13 24671903 missense probably damaging 1.00
R7248:Ripor2 UTSW 13 24694145 missense probably damaging 1.00
R7299:Ripor2 UTSW 13 24725001 missense possibly damaging 0.54
R7301:Ripor2 UTSW 13 24725001 missense possibly damaging 0.54
R7343:Ripor2 UTSW 13 24701444 nonsense probably null
R7417:Ripor2 UTSW 13 24696550 missense probably damaging 1.00
R7426:Ripor2 UTSW 13 24694205 missense probably benign 0.01
R7448:Ripor2 UTSW 13 24670071 missense possibly damaging 0.71
R7462:Ripor2 UTSW 13 24696307 missense unknown
R7499:Ripor2 UTSW 13 24693772 missense probably damaging 0.99
R8081:Ripor2 UTSW 13 24713700 missense probably benign 0.01
R8157:Ripor2 UTSW 13 24695617 missense probably benign 0.05
R8364:Ripor2 UTSW 13 24710193 missense possibly damaging 0.95
R8447:Ripor2 UTSW 13 24723788 missense probably damaging 1.00
R8465:Ripor2 UTSW 13 24665468 intron probably benign
R8751:Ripor2 UTSW 13 24701067 missense possibly damaging 0.69
R8818:Ripor2 UTSW 13 24717668 missense not run
Predicted Primers PCR Primer
(F):5'- ATGAGAAACTGCTGCAGACTATG -3'
(R):5'- ATGCAACACTCTGCTCACCTG -3'

Sequencing Primer
(F):5'- TGCAGACTATGAGCGACCTTG -3'
(R):5'- CCATCTATCTGTAAGGGGATCTGAC -3'
Posted On2014-10-01