Incidental Mutation 'R0200:Iars'
ID23592
Institutional Source Beutler Lab
Gene Symbol Iars
Ensembl Gene ENSMUSG00000037851
Gene Nameisoleucine-tRNA synthetase
SynonymsE430001P04Rik, 2510016L12Rik
MMRRC Submission 038457-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0200 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location49682100-49734267 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 49726202 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 983 (D983V)
Ref Sequence ENSEMBL: ENSMUSP00000132082 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047363] [ENSMUST00000164260] [ENSMUST00000165316]
Predicted Effect possibly damaging
Transcript: ENSMUST00000047363
AA Change: D983V

PolyPhen 2 Score 0.622 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000048096
Gene: ENSMUSG00000037851
AA Change: D983V

DomainStartEndE-ValueType
Pfam:tRNA-synt_1 17 639 9.2e-242 PFAM
Pfam:tRNA-synt_1g 46 197 3.7e-6 PFAM
Pfam:Anticodon_1 693 852 1.1e-23 PFAM
low complexity region 1159 1167 N/A INTRINSIC
low complexity region 1169 1180 N/A INTRINSIC
low complexity region 1220 1229 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000164260
AA Change: D983V

PolyPhen 2 Score 0.622 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000126806
Gene: ENSMUSG00000037851
AA Change: D983V

DomainStartEndE-ValueType
Pfam:tRNA-synt_1 17 639 5.5e-238 PFAM
Pfam:tRNA-synt_1g 46 205 5.2e-8 PFAM
Pfam:tRNA-synt_1g 521 659 2.1e-5 PFAM
Pfam:Anticodon_1 693 852 7.1e-24 PFAM
low complexity region 1159 1167 N/A INTRINSIC
low complexity region 1169 1180 N/A INTRINSIC
low complexity region 1220 1229 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000165270
Predicted Effect possibly damaging
Transcript: ENSMUST00000165316
AA Change: D983V

PolyPhen 2 Score 0.622 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000132082
Gene: ENSMUSG00000037851
AA Change: D983V

DomainStartEndE-ValueType
Pfam:tRNA-synt_1 17 639 5.5e-238 PFAM
Pfam:tRNA-synt_1g 46 205 5.2e-8 PFAM
Pfam:tRNA-synt_1g 521 659 2.1e-5 PFAM
Pfam:Anticodon_1 693 852 7.1e-24 PFAM
low complexity region 1159 1167 N/A INTRINSIC
low complexity region 1169 1180 N/A INTRINSIC
low complexity region 1220 1229 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000165656
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.8%
  • 10x: 94.7%
  • 20x: 86.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Aminoacyl-tRNA synthetases catalyze the aminoacylation of tRNA by their cognate amino acid. Because of their central role in linking amino acids with nucleotide triplets contained in tRNAS, aminoacyl-tRNA synthetases are thought to be among the first proteins that appeared in evolution. Isoleucine-tRNA synthetase belongs to the class-I aminoacyl-tRNA synthetase family and has been identified as a target of autoantibodies in the autoimmune disease polymyositis/dermatomyositis. Alternatively spliced transcript variants have been found. [provided by RefSeq, Nov 2012]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A730017C20Rik A G 18: 59,062,459 probably null Het
Aatf T C 11: 84,445,676 K466E probably damaging Het
Abcc3 T C 11: 94,355,074 D1245G probably damaging Het
Adam12 T C 7: 133,974,416 probably null Het
Akap11 A G 14: 78,510,753 V1398A probably benign Het
Ank1 T G 8: 23,096,812 L461R probably damaging Het
Ankfn1 T C 11: 89,441,966 S402G possibly damaging Het
Arhgef40 A C 14: 51,996,974 E911D probably damaging Het
Atp2b1 C T 10: 98,979,814 Q107* probably null Het
BC117090 T C 16: 36,323,024 probably null Het
Cacng3 T A 7: 122,671,785 C4* probably null Het
Ccdc129 T C 6: 55,897,956 L297P probably benign Het
Cds1 G A 5: 101,814,433 V305M probably damaging Het
Cecr2 T G 6: 120,761,797 F1162V probably damaging Het
Cfap70 A T 14: 20,448,563 Y19N probably damaging Het
Chrm5 A G 2: 112,480,720 V17A probably benign Het
Col20a1 T C 2: 181,000,438 I714T probably damaging Het
Cpeb2 T A 5: 43,261,776 M156K possibly damaging Het
Defb25 C A 2: 152,622,412 V71L probably benign Het
Dhx35 A T 2: 158,829,623 M325L probably benign Het
Dhx57 A T 17: 80,251,473 L1019H probably damaging Het
Dnah6 T A 6: 73,069,420 D3195V probably damaging Het
Dph5 A G 3: 115,928,703 S277G probably benign Het
Dpm1 C A 2: 168,223,155 probably null Het
Dsg1a A T 18: 20,340,938 M1023L probably benign Het
Egf A G 3: 129,706,233 Y252H probably benign Het
Egf A G 3: 129,737,549 S126P probably damaging Het
Enam T C 5: 88,493,027 W183R possibly damaging Het
Foxn1 T C 11: 78,361,040 Y455C probably damaging Het
Gm14085 T A 2: 122,527,447 *661R probably null Het
Ikzf4 C A 10: 128,634,676 G325V probably damaging Het
Il1rl1 T A 1: 40,441,303 W31R possibly damaging Het
Ip6k3 C T 17: 27,145,025 D350N probably damaging Het
Irgc1 T C 7: 24,432,006 D462G probably benign Het
Jph3 A G 8: 121,784,833 E520G probably benign Het
Kcna2 T A 3: 107,105,160 D352E probably benign Het
Klk4 T A 7: 43,885,361 I248N probably damaging Het
Krtap16-1 T C 11: 99,985,297 Y427C probably damaging Het
Lgr4 A G 2: 109,970,690 probably null Het
Lhpp C T 7: 132,610,677 probably benign Het
Lypd3 T A 7: 24,640,231 V241D probably damaging Het
Lyz2 T A 10: 117,280,773 N57Y possibly damaging Het
Man1a A G 10: 54,074,498 V176A probably damaging Het
Mcm4 G A 16: 15,629,639 T487I probably benign Het
Mettl21c T A 1: 44,013,654 I68F probably damaging Het
Miip T A 4: 147,862,263 T313S probably damaging Het
Mog A T 17: 37,012,419 I209K probably damaging Het
Myo1c C A 11: 75,672,182 D997E probably benign Het
Npc1 T C 18: 12,219,204 Y146C probably damaging Het
Nploc4 A G 11: 120,413,681 L238P probably damaging Het
Olfr231 T C 1: 174,117,512 H168R probably benign Het
Olfr531 T C 7: 140,400,875 Y57C probably damaging Het
Olfr56 T A 11: 49,135,047 M285K probably damaging Het
Opa1 A G 16: 29,614,129 N544S probably benign Het
Pam C T 1: 97,894,401 probably null Het
Pdgfra T C 5: 75,163,777 Y98H probably damaging Het
Plcz1 C T 6: 139,990,733 R590H probably damaging Het
Plxdc1 T C 11: 97,934,012 Y339C probably damaging Het
Plxna1 T C 6: 89,323,593 N1583S probably damaging Het
Plxna4 C T 6: 32,197,088 V1191M probably damaging Het
Polk T A 13: 96,496,822 N238Y probably benign Het
Ptprq T C 10: 107,685,157 N718S probably benign Het
Rsrc1 A T 3: 67,180,861 H176L probably damaging Het
Sbno1 T C 5: 124,384,541 D1072G probably damaging Het
Scmh1 A G 4: 120,483,831 K238R probably damaging Het
Senp7 A G 16: 56,123,873 T187A possibly damaging Het
Slc12a4 T C 8: 105,951,617 R315G probably benign Het
Slc16a10 A G 10: 40,040,616 V430A probably benign Het
Slc26a7 T C 4: 14,621,317 D23G probably benign Het
Slc7a7 A G 14: 54,377,802 L246P probably damaging Het
Spata7 T A 12: 98,663,169 S332T probably benign Het
Spsb1 A G 4: 149,898,216 *274R probably null Het
Sspo T G 6: 48,486,415 V3767G probably null Het
Syt10 C A 15: 89,826,941 A130S probably benign Het
Tgm6 T A 2: 130,152,945 probably null Het
Them7 A C 2: 105,297,917 N81T probably damaging Het
Tinag C A 9: 76,951,935 A464S probably damaging Het
Tmem217 T G 17: 29,526,310 I149L probably benign Het
Trp53rkb T G 2: 166,795,683 D186E probably damaging Het
Vmn1r20 T C 6: 57,432,099 Y137H probably damaging Het
Vmn1r60 T A 7: 5,544,380 L240F probably benign Het
Vmn1r64 A G 7: 5,883,818 M242T probably benign Het
Xkr4 T C 1: 3,670,663 N229S probably benign Het
Zcchc2 T A 1: 106,004,123 L352M probably damaging Het
Zfp217 C T 2: 170,115,462 A539T probably benign Het
Zfp638 T C 6: 83,967,354 L1018P probably damaging Het
Other mutations in Iars
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00697:Iars APN 13 49709728 missense probably damaging 1.00
IGL00764:Iars APN 13 49711827 missense probably benign 0.34
IGL01153:Iars APN 13 49711805 missense probably damaging 1.00
IGL01481:Iars APN 13 49728698 missense probably benign 0.00
IGL01596:Iars APN 13 49703176 missense probably benign
IGL01682:Iars APN 13 49709658 missense probably damaging 1.00
IGL01885:Iars APN 13 49691499 missense probably benign 0.25
IGL01907:Iars APN 13 49709655 missense probably damaging 1.00
IGL02023:Iars APN 13 49688249 missense probably damaging 1.00
IGL02121:Iars APN 13 49724696 missense probably benign 0.00
IGL02365:Iars APN 13 49691499 missense probably benign 0.25
IGL02704:Iars APN 13 49721100 missense probably damaging 1.00
IGL02838:Iars APN 13 49690489 missense possibly damaging 0.87
IGL02975:Iars APN 13 49704849 missense probably damaging 1.00
IGL02982:Iars APN 13 49709709 missense probably benign 0.00
IGL03034:Iars APN 13 49690489 missense possibly damaging 0.87
IGL03060:Iars APN 13 49690447 critical splice acceptor site probably null
IGL03156:Iars APN 13 49703179 missense possibly damaging 0.87
IGL03206:Iars APN 13 49693070 missense possibly damaging 0.81
IGL03343:Iars APN 13 49724747 missense probably benign 0.12
gannett_peak UTSW 13 49708421 missense probably damaging 1.00
wind_river UTSW 13 49701895 missense probably damaging 1.00
R0054:Iars UTSW 13 49693135 missense probably damaging 1.00
R0054:Iars UTSW 13 49693135 missense probably damaging 1.00
R0184:Iars UTSW 13 49722212 missense probably benign 0.00
R0356:Iars UTSW 13 49703233 missense probably benign 0.03
R0383:Iars UTSW 13 49732342 missense probably damaging 0.99
R0657:Iars UTSW 13 49702519 missense probably damaging 1.00
R1005:Iars UTSW 13 49687445 missense possibly damaging 0.94
R1427:Iars UTSW 13 49704269 critical splice acceptor site probably null
R1449:Iars UTSW 13 49733710 missense probably damaging 0.99
R1647:Iars UTSW 13 49723002 missense possibly damaging 0.85
R1648:Iars UTSW 13 49723002 missense possibly damaging 0.85
R1664:Iars UTSW 13 49711775 missense probably damaging 0.98
R1763:Iars UTSW 13 49723077 critical splice donor site probably null
R2192:Iars UTSW 13 49688129 intron probably null
R2203:Iars UTSW 13 49722675 missense probably benign 0.00
R2357:Iars UTSW 13 49688203 missense probably damaging 1.00
R3724:Iars UTSW 13 49687384 critical splice acceptor site probably null
R4785:Iars UTSW 13 49724663 missense probably damaging 0.99
R4934:Iars UTSW 13 49717984 missense probably benign 0.17
R4999:Iars UTSW 13 49709661 missense probably damaging 1.00
R5048:Iars UTSW 13 49688237 missense probably damaging 0.99
R5268:Iars UTSW 13 49690491 missense probably damaging 1.00
R5394:Iars UTSW 13 49722165 missense probably damaging 1.00
R5486:Iars UTSW 13 49709573 splice site probably null
R5960:Iars UTSW 13 49724637 missense possibly damaging 0.68
R5972:Iars UTSW 13 49709632 missense possibly damaging 0.91
R5978:Iars UTSW 13 49722993 missense probably damaging 0.99
R6031:Iars UTSW 13 49705831 missense probably damaging 0.98
R6031:Iars UTSW 13 49705831 missense probably damaging 0.98
R6092:Iars UTSW 13 49708421 missense probably damaging 1.00
R6167:Iars UTSW 13 49722714 missense probably damaging 1.00
R6313:Iars UTSW 13 49708445 missense probably damaging 0.99
R6358:Iars UTSW 13 49727143 missense possibly damaging 0.67
R6385:Iars UTSW 13 49701895 missense probably damaging 1.00
R6403:Iars UTSW 13 49687495 missense probably damaging 1.00
R6575:Iars UTSW 13 49725269 missense probably damaging 1.00
R6675:Iars UTSW 13 49719578 missense probably damaging 0.99
R6957:Iars UTSW 13 49722161 missense probably damaging 1.00
R7207:Iars UTSW 13 49688315 critical splice donor site probably null
R7254:Iars UTSW 13 49723078 critical splice donor site probably null
R7354:Iars UTSW 13 49704320 missense probably benign
R7397:Iars UTSW 13 49728677 missense probably benign 0.00
Z1088:Iars UTSW 13 49721088 missense probably benign
Predicted Primers PCR Primer
(F):5'- ATCAATCTGTAGGCCGCCTGTCTC -3'
(R):5'- TTCTGTAGCAGCCTTGTGGAAGC -3'

Sequencing Primer
(F):5'- TCTGTCCCACCTGCCAG -3'
(R):5'- CTTCCCTGCGGAGTATAATCAGAG -3'
Posted On2013-04-16