Mutagenetix > Incidental Mutation

Incidental Mutation 'R2138:Otof'

235945

Institutional Source

Beutler Lab

Gene Symbol

Otof

Ensembl Gene

ENSMUSG00000062372

Gene Name

otoferlin

Synonyms

MMRRC Submission

040141-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.123) question?

Stock #

R2138 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

30367062-30461932 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 30461770 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 10 (V10A)

Ref Sequence

ENSEMBL: ENSMUSP00000073803 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000031078] [ENSMUST00000074171] [ENSMUST00000114743] [ENSMUST00000114747] [ENSMUST00000127815] [ENSMUST00000199129]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000031078

SMART Domains

Protein: ENSMUSP00000031078
Gene: ENSMUSG00000029182

Domain	Start	End	E-Value	Type
Pfam:DUF2475	19	84	2.3e-28	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000074171
AA Change: V10A

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)

SMART Domains

Protein: ENSMUSP00000073803
Gene: ENSMUSG00000062372
AA Change: V10A

Domain	Start	End	E-Value	Type
C2	2	97	6.83e-1	SMART
C2	254	352	3.76e-11	SMART
FerI	338	409	7.91e-38	SMART
C2	417	528	1.75e-11	SMART
low complexity region	607	618	N/A	INTRINSIC
FerB	841	917	5.13e-46	SMART
C2	960	1067	1.77e-7	SMART
low complexity region	1191	1202	N/A	INTRINSIC
low complexity region	1265	1276	N/A	INTRINSIC
low complexity region	1293	1323	N/A	INTRINSIC
low complexity region	1370	1385	N/A	INTRINSIC
low complexity region	1436	1447	N/A	INTRINSIC
C2	1493	1592	6.54e-11	SMART
C2	1733	1863	4.02e0	SMART
Pfam:Ferlin_C	1895	1994	7.2e-33	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000114743

SMART Domains

Protein: ENSMUSP00000110391
Gene: ENSMUSG00000029182

Domain	Start	End	E-Value	Type
Pfam:DUF2475	19	84	1e-26	PFAM
low complexity region	125	137	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000114747
AA Change: V10A

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)

SMART Domains

Protein: ENSMUSP00000110395
Gene: ENSMUSG00000062372
AA Change: V10A

Domain	Start	End	E-Value	Type
C2	2	97	6.83e-1	SMART
C2	269	367	3.76e-11	SMART
FerI	353	424	7.91e-38	SMART
C2	432	543	1.75e-11	SMART
low complexity region	622	633	N/A	INTRINSIC
FerB	856	932	5.13e-46	SMART
C2	975	1082	1.77e-7	SMART
Pfam:C2	1153	1236	1.8e-1	PFAM
low complexity region	1260	1271	N/A	INTRINSIC
low complexity region	1288	1318	N/A	INTRINSIC
low complexity region	1365	1380	N/A	INTRINSIC
low complexity region	1431	1442	N/A	INTRINSIC
C2	1488	1587	6.54e-11	SMART
C2	1728	1858	4.02e0	SMART
low complexity region	1903	1915	N/A	INTRINSIC
transmembrane domain	1959	1981	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000127815

SMART Domains

Protein: ENSMUSP00000142635
Gene: ENSMUSG00000029182

Domain	Start	End	E-Value	Type
Pfam:DUF2475	19	84	5.6e-26	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000144125

SMART Domains

Protein: ENSMUSP00000120679
Gene: ENSMUSG00000062372

Domain	Start	End	E-Value	Type
C2	2	97	6.83e-1	SMART
C2	254	352	3.76e-11	SMART
FerI	338	409	7.91e-38	SMART
C2	417	528	1.75e-11	SMART
low complexity region	607	618	N/A	INTRINSIC
FerB	841	917	5.13e-46	SMART
C2	960	1067	1.77e-7	SMART
low complexity region	1191	1202	N/A	INTRINSIC
low complexity region	1265	1276	N/A	INTRINSIC
low complexity region	1293	1323	N/A	INTRINSIC
low complexity region	1370	1385	N/A	INTRINSIC
low complexity region	1436	1447	N/A	INTRINSIC
C2	1493	1592	6.54e-11	SMART
C2	1733	1863	4.02e0	SMART
Pfam:Ferlin_C	1895	1994	7.2e-33	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000150734

Predicted Effect

probably benign
Transcript: ENSMUST00000199129

SMART Domains

Protein: ENSMUSP00000142583
Gene: ENSMUSG00000029182

Domain	Start	End	E-Value	Type
Pfam:DUF2475	19	84	3.7e-23	PFAM

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.4%
20x: 95.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Mutations in this gene are a cause of neurosensory nonsyndromic recessive deafness, DFNB9. The short form of the encoded protein has 3 C2 domains, a single carboxy-terminal transmembrane domain found also in the C. elegans spermatogenesis factor FER-1 and human dysferlin, while the long form has 6 C2 domains. The homology suggests that this protein may be involved in vesicle membrane fusion. Several transcript variants encoding multiple isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutants have no detectable auditory brainstem response at any frequency tested. Otoacoustic transmission distortion products are detected. Direct electrical stimulation of cochlear ganglia elicits brainstem responses. On depolarization, inner hair cells release almost no neurotransmitter. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 74 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aamp	A	G	1: 74,283,963	V6A	probably benign	Het
Abcc6	A	G	7: 45,981,051	F1262L	probably damaging	Het
Acot13	A	T	13: 24,818,205		probably null	Het
Adgrv1	T	C	13: 81,445,320	I4183V	probably benign	Het
Aff4	T	G	11: 53,372,512	S120A	possibly damaging	Het
Afp	A	G	5: 90,499,647	E250G	probably damaging	Het
Ankrd34b	A	T	13: 92,439,406	D382V	probably damaging	Het
Arhgef19	A	T	4: 141,250,800	I577F	probably damaging	Het
Arl6	A	G	16: 59,622,467		probably benign	Het
Atp2b2	A	T	6: 113,796,307	M333K	probably benign	Het
Atp8b3	C	A	10: 80,527,105	A635S	possibly damaging	Het
Baiap2	A	G	11: 119,957,102	T19A	possibly damaging	Het
Bcar3	A	G	3: 122,512,996	D206G	probably damaging	Het
Ccdc162	A	T	10: 41,581,297	M85K	probably benign	Het
Clec4a4	A	G	6: 123,023,978	N217D	probably damaging	Het
Csmd1	T	C	8: 15,929,088	Y2832C	probably damaging	Het
Cubn	A	G	2: 13,444,378	I962T	probably damaging	Het
Dennd4a	A	G	9: 64,889,337	Y852C	probably damaging	Het
Dhcr24	G	T	4: 106,572,302	E191*	probably null	Het
Dusp12	G	A	1: 170,880,597	Q114*	probably null	Het
Elfn2	G	T	15: 78,674,038	T103K	probably benign	Het
Eme1	A	T	11: 94,648,192	V314E	probably damaging	Het
Epb41l3	A	G	17: 69,207,880	E4G	probably damaging	Het
Exoc6b	A	T	6: 84,989,482	L170Q	probably damaging	Het
Fam129a	G	A	1: 151,696,251	V316M	probably damaging	Het
Fbln5	C	T	12: 101,761,920	M261I	probably benign	Het
Fgf22	T	C	10: 79,756,601	V64A	probably damaging	Het
Gak	C	T	5: 108,606,877		probably null	Het
Gatad2b	T	A	3: 90,352,113	S401R	probably damaging	Het
Gen1	A	T	12: 11,241,621	S722R	probably damaging	Het
Gm10754	A	T	10: 97,682,270		probably benign	Het
Gm8897	A	T	5: 11,419,085	R68*	probably null	Het
Grid2	G	A	6: 64,345,798	R594Q	probably damaging	Het
Grm7	C	A	6: 110,646,137	N90K	probably damaging	Het
Herc1	G	A	9: 66,470,307	V3452M	possibly damaging	Het
Il22ra2	T	A	10: 19,632,870	F215L	probably benign	Het
Kank1	G	A	19: 25,411,753	G930D	probably benign	Het
Klra3	A	T	6: 130,333,158	V133D	probably benign	Het
Lims2	A	G	18: 31,955,407	E220G	possibly damaging	Het
Mbd3l2	A	T	9: 18,444,958	D193V	probably damaging	Het
Mbl1	T	A	14: 41,153,691	I34K	possibly damaging	Het
Mgam	C	T	6: 40,756,450	P839S	probably damaging	Het
Mmp9	G	T	2: 164,952,467	E460*	probably null	Het
Mov10	T	C	3: 104,804,242	H316R	probably benign	Het
Ms4a18	A	T	19: 10,997,331	V332D	possibly damaging	Het
Myo15b	T	C	11: 115,883,807	S2082P	probably benign	Het
Myrfl	G	A	10: 116,795,538	T706I	probably benign	Het
Nampt	C	A	12: 32,838,422	H191N	possibly damaging	Het
Nphp3	A	G	9: 104,025,903	E693G	possibly damaging	Het
Obscn	A	T	11: 59,003,665	Y1191*	probably null	Het
Olfr19	A	G	16: 16,673,205	Y259H	probably damaging	Het
Olfr398	A	T	11: 73,984,303	Y102N	probably damaging	Het
Olfr419	A	T	1: 174,250,736		probably null	Het
Osbpl10	A	G	9: 115,232,134	N760S	probably benign	Het
Pkhd1l1	A	C	15: 44,501,457	E664A	probably damaging	Het
Pnp2	T	C	14: 50,963,704	S178P	probably damaging	Het
Pvr	G	A	7: 19,917,002	T199I	probably damaging	Het
Rbp3	C	T	14: 33,956,018	T641M	probably damaging	Het
Rnaseh2b	T	C	14: 62,361,345	V173A	probably benign	Het
Sept12	C	T	16: 4,992,206	R155H	probably damaging	Het
Slco6d1	G	T	1: 98,443,660	R290L	probably benign	Het
Snx32	A	G	19: 5,496,129	V335A	probably damaging	Het
Son	T	C	16: 91,659,372	V1669A	possibly damaging	Het
Tbata	C	T	10: 61,179,284	T116I	probably benign	Het
Tdrd1	T	A	19: 56,842,589	S279T	probably benign	Het
Thsd7a	A	T	6: 12,471,073	Y515*	probably null	Het
Tmem102	T	G	11: 69,805,114	L40F	probably damaging	Het
Tmem169	A	G	1: 72,300,996	N195S	probably damaging	Het
Tmem201	A	T	4: 149,718,080	S613T	probably damaging	Het
Tnfaip6	A	T	2: 52,052,332	I218F	possibly damaging	Het
Tube1	C	A	10: 39,147,351	H331Q	probably benign	Het
Wwc1	G	A	11: 35,841,887	T998I	possibly damaging	Het
Xpc	A	T	6: 91,498,122	Y638*	probably null	Het
Zdhhc4	A	T	5: 143,324,262	Y80*	probably null	Het

Other mutations in Otof

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00159:Otof	APN	5	30375904	missense	probably damaging	1.00
IGL00391:Otof	APN	5	30375623	missense	probably damaging	1.00
IGL00579:Otof	APN	5	30399322	missense	possibly damaging	0.88
IGL00671:Otof	APN	5	30385753	critical splice donor site	probably null
IGL01019:Otof	APN	5	30405216	missense	probably benign	0.01
IGL01025:Otof	APN	5	30384253	missense	possibly damaging	0.82
IGL01086:Otof	APN	5	30376273	critical splice donor site	probably null
IGL01110:Otof	APN	5	30461725	missense	probably damaging	1.00
IGL01160:Otof	APN	5	30381535	missense	probably benign	0.00
IGL01285:Otof	APN	5	30405183	missense	probably damaging	1.00
IGL01329:Otof	APN	5	30441379	missense	probably benign	0.00
IGL01337:Otof	APN	5	30405777	missense	possibly damaging	0.93
IGL01337:Otof	APN	5	30419512	missense	probably benign	0.17
IGL01834:Otof	APN	5	30399220	missense	probably damaging	1.00
IGL01872:Otof	APN	5	30379254	splice site	probably benign
IGL01969:Otof	APN	5	30382483	splice site	probably benign
IGL02075:Otof	APN	5	30370726	missense	probably benign	0.23
IGL02077:Otof	APN	5	30399235	missense	probably damaging	1.00
IGL02136:Otof	APN	5	30373992	missense	possibly damaging	0.90
IGL02227:Otof	APN	5	30370784	missense	probably damaging	1.00
IGL02475:Otof	APN	5	30376682	missense	probably damaging	1.00
IGL02812:Otof	APN	5	30374082	missense	probably benign	0.08
IGL02864:Otof	APN	5	30386341	missense	probably damaging	0.99
IGL03176:Otof	APN	5	30405176	splice site	probably null
R0285:Otof	UTSW	5	30379533	critical splice donor site	probably null
R0421:Otof	UTSW	5	30371568	missense	possibly damaging	0.94
R0570:Otof	UTSW	5	30371881	splice site	probably benign
R0599:Otof	UTSW	5	30370705	missense	probably damaging	1.00
R0675:Otof	UTSW	5	30382361	missense	probably benign	0.01
R0715:Otof	UTSW	5	30394697	missense	probably damaging	0.99
R1019:Otof	UTSW	5	30370743	missense	probably damaging	0.96
R1183:Otof	UTSW	5	30371912	missense	probably damaging	1.00
R1435:Otof	UTSW	5	30378695	missense	probably benign	0.00
R1469:Otof	UTSW	5	30380227	missense	probably benign	0.00
R1469:Otof	UTSW	5	30380227	missense	probably benign	0.00
R1474:Otof	UTSW	5	30379532	critical splice donor site	probably null
R1524:Otof	UTSW	5	30379556	missense	probably benign	0.03
R1563:Otof	UTSW	5	30371005	missense	probably benign	0.00
R1732:Otof	UTSW	5	30386471	missense	probably damaging	1.00
R1822:Otof	UTSW	5	30378710	missense	probably benign	0.00
R1845:Otof	UTSW	5	30371723	nonsense	probably null
R1925:Otof	UTSW	5	30394188	missense	probably benign	0.37
R1938:Otof	UTSW	5	30376369	missense	probably benign	0.00
R1968:Otof	UTSW	5	30388654	missense	probably damaging	1.00
R1996:Otof	UTSW	5	30421037	missense	probably benign	0.01
R1999:Otof	UTSW	5	30388772	missense	probably benign	0.19
R2027:Otof	UTSW	5	30421014	missense	probably benign	0.08
R2173:Otof	UTSW	5	30386374	missense	probably damaging	1.00
R2245:Otof	UTSW	5	30370207	missense	probably damaging	1.00
R3011:Otof	UTSW	5	30382840	missense	probably damaging	1.00
R3105:Otof	UTSW	5	30381801	missense	probably benign	0.03
R3442:Otof	UTSW	5	30371689	missense	probably damaging	1.00
R3710:Otof	UTSW	5	30385266	missense	probably benign
R3715:Otof	UTSW	5	30376871	nonsense	probably null
R3806:Otof	UTSW	5	30386499	critical splice acceptor site	probably null
R3975:Otof	UTSW	5	30370712	missense	probably damaging	1.00
R4067:Otof	UTSW	5	30399291	missense	probably damaging	1.00
R4077:Otof	UTSW	5	30419506	missense	possibly damaging	0.89
R4166:Otof	UTSW	5	30382418	missense	probably damaging	1.00
R4451:Otof	UTSW	5	30385164	missense	possibly damaging	0.77
R4485:Otof	UTSW	5	30375000	missense	possibly damaging	0.77
R4600:Otof	UTSW	5	30371900	missense	probably damaging	1.00
R4646:Otof	UTSW	5	30383570	missense	possibly damaging	0.82
R4648:Otof	UTSW	5	30383570	missense	possibly damaging	0.82
R4669:Otof	UTSW	5	30420974	critical splice donor site	probably null
R4773:Otof	UTSW	5	30394682	missense	probably benign	0.05
R4839:Otof	UTSW	5	30419404	missense	probably damaging	0.99
R4907:Otof	UTSW	5	30378661	critical splice donor site	probably null
R4961:Otof	UTSW	5	30383493	intron	probably benign
R4991:Otof	UTSW	5	30394181	missense	probably damaging	1.00
R5015:Otof	UTSW	5	30382894	missense	probably damaging	1.00
R5036:Otof	UTSW	5	30384439	missense	possibly damaging	0.54
R5038:Otof	UTSW	5	30384439	missense	possibly damaging	0.54
R5253:Otof	UTSW	5	30370139	missense	probably damaging	1.00
R5336:Otof	UTSW	5	30376720	missense	probably benign	0.01
R5365:Otof	UTSW	5	30381800	missense	probably damaging	0.99
R5901:Otof	UTSW	5	30374979	missense	probably damaging	1.00
R6211:Otof	UTSW	5	30371900	missense	probably damaging	0.99
R6318:Otof	UTSW	5	30414544	missense	probably damaging	1.00
R6331:Otof	UTSW	5	30371935	missense	possibly damaging	0.94
R6671:Otof	UTSW	5	30419533	missense	probably benign
R6701:Otof	UTSW	5	30370797	nonsense	probably null
R6792:Otof	UTSW	5	30375634	missense	probably damaging	1.00
R6853:Otof	UTSW	5	30388239	missense	probably damaging	1.00
R6940:Otof	UTSW	5	30371643	missense	probably damaging	0.96
R7037:Otof	UTSW	5	30381538	missense	probably benign	0.32
R7060:Otof	UTSW	5	30388356	missense	possibly damaging	0.84
R7089:Otof	UTSW	5	30371568	missense	possibly damaging	0.94
R7165:Otof	UTSW	5	30375620	missense	probably damaging	0.99
R7178:Otof	UTSW	5	30383534	missense	possibly damaging	0.50
R7298:Otof	UTSW	5	30388270	missense	probably damaging	1.00
R7393:Otof	UTSW	5	30370270	missense	probably benign	0.45
R7397:Otof	UTSW	5	30375707	missense	probably damaging	1.00
R7400:Otof	UTSW	5	30385188	missense	probably benign	0.04
R7428:Otof	UTSW	5	30389825	missense	probably damaging	1.00
R7456:Otof	UTSW	5	30394661	missense	probably damaging	1.00
R7505:Otof	UTSW	5	30371020	missense	probably benign	0.00
R7714:Otof	UTSW	5	30370253	missense	probably damaging	0.99
R8002:Otof	UTSW	5	30380610	missense	probably benign	0.10
R8032:Otof	UTSW	5	30461798	start codon destroyed	probably benign	0.07
R8153:Otof	UTSW	5	30388735	missense	probably damaging	1.00
R8158:Otof	UTSW	5	30380194	missense	probably benign	0.37
R8159:Otof	UTSW	5	30380194	missense	probably benign	0.37
R8441:Otof	UTSW	5	30380856	missense	probably damaging	0.99
R8738:Otof	UTSW	5	30388624	nonsense	probably null
R8813:Otof	UTSW	5	30382898	missense	probably benign	0.02
R8835:Otof	UTSW	5	30370920	missense	probably benign	0.44
R8852:Otof	UTSW	5	30371700	missense	possibly damaging	0.94
R8869:Otof	UTSW	5	30420981	missense	probably benign	0.08
R9029:Otof	UTSW	5	30370075	critical splice donor site	probably null
R9031:Otof	UTSW	5	30380188	missense	probably benign
R9061:Otof	UTSW	5	30388657	missense	possibly damaging	0.50
R9100:Otof	UTSW	5	30382352	missense	possibly damaging	0.80
R9121:Otof	UTSW	5	30379118	missense	probably benign	0.04
R9188:Otof	UTSW	5	30376751	missense	probably damaging	1.00
R9218:Otof	UTSW	5	30385125	missense	probably benign
R9280:Otof	UTSW	5	30371550	missense	probably damaging	0.98
R9395:Otof	UTSW	5	30375632	missense	probably damaging	1.00
R9400:Otof	UTSW	5	30383519	critical splice donor site	probably null
R9407:Otof	UTSW	5	30380921	missense	probably damaging	1.00
R9616:Otof	UTSW	5	30382364	missense	possibly damaging	0.95
R9665:Otof	UTSW	5	30427551	missense	probably benign	0.22
R9748:Otof	UTSW	5	30383654	missense	probably damaging	1.00
R9783:Otof	UTSW	5	30379232	missense	probably benign
Z1176:Otof	UTSW	5	30371586	missense	probably damaging	0.98
Z1177:Otof	UTSW	5	30376297	missense	probably damaging	1.00
Z1177:Otof	UTSW	5	30383658	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AAGCCTTGTAGCTACAGTGCC -3'
(R):5'- ACACATGCTGGGCTGACAAC -3'

Sequencing Primer
(F):5'- GTAGCTACAGTGCCATCCC -3'
(R):5'- TGGGCTGACAACCCAGAG -3'

Posted On

2014-10-01