Incidental Mutation 'R2138:Thsd7a'
ID235950
Institutional Source Beutler Lab
Gene Symbol Thsd7a
Ensembl Gene ENSMUSG00000032625
Gene Namethrombospondin, type I, domain containing 7A
SynonymsLOC330267
MMRRC Submission 040141-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2138 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location12311610-12749410 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 12471073 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 515 (Y515*)
Ref Sequence ENSEMBL: ENSMUSP00000131662 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000119581] [ENSMUST00000172356]
Predicted Effect probably null
Transcript: ENSMUST00000046121
AA Change: Y515*
SMART Domains Protein: ENSMUSP00000040176
Gene: ENSMUSG00000032625
AA Change: Y515*

DomainStartEndE-ValueType
signal peptide 1 38 N/A INTRINSIC
TSP1 49 105 4.88e0 SMART
TSP1 186 236 1.58e-16 SMART
low complexity region 264 278 N/A INTRINSIC
low complexity region 290 304 N/A INTRINSIC
TSP1 352 408 9.98e-5 SMART
TSP1 415 499 3.14e0 SMART
TSP1 504 563 6.62e-1 SMART
TSP1 626 684 1.24e-9 SMART
TSP1 687 758 1.48e0 SMART
TSP1 763 820 6.24e-6 SMART
TSP1 898 948 7.31e-2 SMART
TSP1 1027 1084 1.2e-7 SMART
TSP1 1087 1152 5.82e-1 SMART
TSP1 1157 1209 4.24e-2 SMART
TSP1 1212 1273 1e0 SMART
TSP1 1278 1330 3.55e-10 SMART
TSP1 1331 1401 7.5e-2 SMART
TSP1 1406 1464 1.55e-1 SMART
transmembrane domain 1596 1618 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000119443
SMART Domains Protein: ENSMUSP00000113780
Gene: ENSMUSG00000032625

DomainStartEndE-ValueType
TSP1 14 70 9.98e-5 SMART
TSP1 77 161 3.14e0 SMART
TSP1 166 225 6.62e-1 SMART
Blast:TSP1 226 262 1e-8 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000119581
AA Change: Y515*
SMART Domains Protein: ENSMUSP00000113681
Gene: ENSMUSG00000032625
AA Change: Y515*

DomainStartEndE-ValueType
signal peptide 1 38 N/A INTRINSIC
TSP1 49 105 4.88e0 SMART
TSP1 186 236 1.58e-16 SMART
low complexity region 264 278 N/A INTRINSIC
low complexity region 290 304 N/A INTRINSIC
TSP1 352 408 9.98e-5 SMART
TSP1 415 499 3.14e0 SMART
TSP1 504 563 6.62e-1 SMART
TSP1 626 684 1.24e-9 SMART
TSP1 687 758 1.48e0 SMART
TSP1 763 820 6.24e-6 SMART
TSP1 898 948 7.31e-2 SMART
TSP1 1027 1082 9.09e-8 SMART
TSP1 1085 1150 5.82e-1 SMART
TSP1 1155 1207 4.24e-2 SMART
TSP1 1210 1271 1e0 SMART
TSP1 1276 1328 3.55e-10 SMART
TSP1 1329 1399 7.5e-2 SMART
TSP1 1404 1462 1.55e-1 SMART
transmembrane domain 1594 1616 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000172356
AA Change: Y515*
SMART Domains Protein: ENSMUSP00000131662
Gene: ENSMUSG00000032625
AA Change: Y515*

DomainStartEndE-ValueType
signal peptide 1 38 N/A INTRINSIC
TSP1 49 105 4.88e0 SMART
TSP1 186 236 1.58e-16 SMART
low complexity region 264 278 N/A INTRINSIC
low complexity region 290 304 N/A INTRINSIC
TSP1 352 408 9.98e-5 SMART
TSP1 415 499 3.14e0 SMART
TSP1 504 563 6.62e-1 SMART
TSP1 626 684 1.24e-9 SMART
TSP1 687 758 1.48e0 SMART
TSP1 763 820 6.24e-6 SMART
TSP1 898 948 7.31e-2 SMART
TSP1 1027 1084 1.95e-7 SMART
TSP1 1087 1152 5.82e-1 SMART
TSP1 1157 1209 4.24e-2 SMART
TSP1 1212 1273 1e0 SMART
TSP1 1278 1330 3.55e-10 SMART
TSP1 1331 1401 7.5e-2 SMART
TSP1 1406 1464 1.55e-1 SMART
transmembrane domain 1596 1618 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is found almost exclusively in endothelial cells from placenta and umbilical cord. The encoded protein appears to interact with alpha(V)beta(3) integrin and paxillin to inhibit endothelial cell migration and tube formation. This protein may be involved in cytoskeletal organization. Variations in this gene may be associated with low bone mineral density in osteoporosis. [provided by RefSeq, Aug 2010]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aamp A G 1: 74,283,963 V6A probably benign Het
Abcc6 A G 7: 45,981,051 F1262L probably damaging Het
Acot13 A T 13: 24,818,205 probably null Het
Adgrv1 T C 13: 81,445,320 I4183V probably benign Het
Aff4 T G 11: 53,372,512 S120A possibly damaging Het
Afp A G 5: 90,499,647 E250G probably damaging Het
Ankrd34b A T 13: 92,439,406 D382V probably damaging Het
Arhgef19 A T 4: 141,250,800 I577F probably damaging Het
Arl6 A G 16: 59,622,467 probably benign Het
Atp2b2 A T 6: 113,796,307 M333K probably benign Het
Atp8b3 C A 10: 80,527,105 A635S possibly damaging Het
Baiap2 A G 11: 119,957,102 T19A possibly damaging Het
Bcar3 A G 3: 122,512,996 D206G probably damaging Het
Ccdc162 A T 10: 41,581,297 M85K probably benign Het
Clec4a4 A G 6: 123,023,978 N217D probably damaging Het
Csmd1 T C 8: 15,929,088 Y2832C probably damaging Het
Cubn A G 2: 13,444,378 I962T probably damaging Het
Dennd4a A G 9: 64,889,337 Y852C probably damaging Het
Dhcr24 G T 4: 106,572,302 E191* probably null Het
Dusp12 G A 1: 170,880,597 Q114* probably null Het
Elfn2 G T 15: 78,674,038 T103K probably benign Het
Eme1 A T 11: 94,648,192 V314E probably damaging Het
Epb41l3 A G 17: 69,207,880 E4G probably damaging Het
Exoc6b A T 6: 84,989,482 L170Q probably damaging Het
Fam129a G A 1: 151,696,251 V316M probably damaging Het
Fbln5 C T 12: 101,761,920 M261I probably benign Het
Fgf22 T C 10: 79,756,601 V64A probably damaging Het
Gak C T 5: 108,606,877 probably null Het
Gatad2b T A 3: 90,352,113 S401R probably damaging Het
Gen1 A T 12: 11,241,621 S722R probably damaging Het
Gm10754 A T 10: 97,682,270 probably benign Het
Gm8897 A T 5: 11,419,085 R68* probably null Het
Grid2 G A 6: 64,345,798 R594Q probably damaging Het
Grm7 C A 6: 110,646,137 N90K probably damaging Het
Herc1 G A 9: 66,470,307 V3452M possibly damaging Het
Il22ra2 T A 10: 19,632,870 F215L probably benign Het
Kank1 G A 19: 25,411,753 G930D probably benign Het
Klra3 A T 6: 130,333,158 V133D probably benign Het
Lims2 A G 18: 31,955,407 E220G possibly damaging Het
Mbd3l2 A T 9: 18,444,958 D193V probably damaging Het
Mbl1 T A 14: 41,153,691 I34K possibly damaging Het
Mgam C T 6: 40,756,450 P839S probably damaging Het
Mmp9 G T 2: 164,952,467 E460* probably null Het
Mov10 T C 3: 104,804,242 H316R probably benign Het
Ms4a18 A T 19: 10,997,331 V332D possibly damaging Het
Myo15b T C 11: 115,883,807 S2082P probably benign Het
Myrfl G A 10: 116,795,538 T706I probably benign Het
Nampt C A 12: 32,838,422 H191N possibly damaging Het
Nphp3 A G 9: 104,025,903 E693G possibly damaging Het
Obscn A T 11: 59,003,665 Y1191* probably null Het
Olfr19 A G 16: 16,673,205 Y259H probably damaging Het
Olfr398 A T 11: 73,984,303 Y102N probably damaging Het
Olfr419 A T 1: 174,250,736 probably null Het
Osbpl10 A G 9: 115,232,134 N760S probably benign Het
Otof A G 5: 30,461,770 V10A probably benign Het
Pkhd1l1 A C 15: 44,501,457 E664A probably damaging Het
Pnp2 T C 14: 50,963,704 S178P probably damaging Het
Pvr G A 7: 19,917,002 T199I probably damaging Het
Rbp3 C T 14: 33,956,018 T641M probably damaging Het
Rnaseh2b T C 14: 62,361,345 V173A probably benign Het
Sept12 C T 16: 4,992,206 R155H probably damaging Het
Slco6d1 G T 1: 98,443,660 R290L probably benign Het
Snx32 A G 19: 5,496,129 V335A probably damaging Het
Son T C 16: 91,659,372 V1669A possibly damaging Het
Tbata C T 10: 61,179,284 T116I probably benign Het
Tdrd1 T A 19: 56,842,589 S279T probably benign Het
Tmem102 T G 11: 69,805,114 L40F probably damaging Het
Tmem169 A G 1: 72,300,996 N195S probably damaging Het
Tmem201 A T 4: 149,718,080 S613T probably damaging Het
Tnfaip6 A T 2: 52,052,332 I218F possibly damaging Het
Tube1 C A 10: 39,147,351 H331Q probably benign Het
Wwc1 G A 11: 35,841,887 T998I possibly damaging Het
Xpc A T 6: 91,498,122 Y638* probably null Het
Zdhhc4 A T 5: 143,324,262 Y80* probably null Het
Other mutations in Thsd7a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00562:Thsd7a APN 6 12379659 splice site probably null
IGL00563:Thsd7a APN 6 12379659 splice site probably null
IGL00753:Thsd7a APN 6 12327529 missense probably damaging 1.00
IGL00835:Thsd7a APN 6 12554934 missense probably damaging 1.00
IGL01486:Thsd7a APN 6 12471080 missense probably damaging 1.00
IGL01730:Thsd7a APN 6 12554981 missense probably benign 0.05
IGL01931:Thsd7a APN 6 12504099 missense probably damaging 1.00
IGL01935:Thsd7a APN 6 12317419 missense probably damaging 1.00
IGL01978:Thsd7a APN 6 12331006 missense probably benign 0.01
IGL02233:Thsd7a APN 6 12555258 missense probably benign 0.00
IGL02354:Thsd7a APN 6 12348193 splice site probably benign
IGL02361:Thsd7a APN 6 12348193 splice site probably benign
IGL02375:Thsd7a APN 6 12343265 missense probably damaging 1.00
IGL02468:Thsd7a APN 6 12318171 missense probably damaging 0.98
IGL02616:Thsd7a APN 6 12408985 missense probably damaging 0.98
IGL02820:Thsd7a APN 6 12321072 missense probably damaging 1.00
IGL02858:Thsd7a APN 6 12500995 missense probably benign 0.16
IGL03074:Thsd7a APN 6 12324681 missense probably damaging 0.99
IGL03234:Thsd7a APN 6 12343178 missense probably damaging 1.00
IGL03244:Thsd7a APN 6 12504168 splice site probably benign
IGL03337:Thsd7a APN 6 12405174 missense probably damaging 1.00
PIT4354001:Thsd7a UTSW 6 12331927 critical splice donor site probably null
R0095:Thsd7a UTSW 6 12320970 missense probably damaging 0.99
R0127:Thsd7a UTSW 6 12554908 missense probably benign 0.01
R0142:Thsd7a UTSW 6 12418335 missense probably damaging 1.00
R0226:Thsd7a UTSW 6 12321900 missense possibly damaging 0.94
R0242:Thsd7a UTSW 6 12503916 missense probably benign 0.32
R0242:Thsd7a UTSW 6 12503916 missense probably benign 0.32
R0359:Thsd7a UTSW 6 12352031 missense probably damaging 1.00
R0365:Thsd7a UTSW 6 12321887 critical splice donor site probably null
R0504:Thsd7a UTSW 6 12379594 missense probably damaging 0.99
R0512:Thsd7a UTSW 6 12379605 missense possibly damaging 0.67
R0540:Thsd7a UTSW 6 12331542 splice site probably null
R0577:Thsd7a UTSW 6 12321048 missense possibly damaging 0.50
R0607:Thsd7a UTSW 6 12331542 splice site probably null
R0755:Thsd7a UTSW 6 12555369 missense probably damaging 1.00
R0771:Thsd7a UTSW 6 12327577 missense probably benign 0.09
R0780:Thsd7a UTSW 6 12337274 missense probably damaging 1.00
R0870:Thsd7a UTSW 6 12337274 missense probably damaging 1.00
R0871:Thsd7a UTSW 6 12337274 missense probably damaging 1.00
R0872:Thsd7a UTSW 6 12337274 missense probably damaging 1.00
R0873:Thsd7a UTSW 6 12337274 missense probably damaging 1.00
R1102:Thsd7a UTSW 6 12555702 missense possibly damaging 0.58
R1144:Thsd7a UTSW 6 12471027 splice site probably benign
R1265:Thsd7a UTSW 6 12317419 missense probably damaging 0.99
R1276:Thsd7a UTSW 6 12418370 missense probably damaging 1.00
R1381:Thsd7a UTSW 6 12555439 missense probably damaging 1.00
R1473:Thsd7a UTSW 6 12338622 missense probably benign 0.08
R1519:Thsd7a UTSW 6 12471175 missense probably benign 0.01
R1633:Thsd7a UTSW 6 12471104 nonsense probably null
R1659:Thsd7a UTSW 6 12504064 missense possibly damaging 0.73
R1769:Thsd7a UTSW 6 12555715 nonsense probably null
R1824:Thsd7a UTSW 6 12409042 splice site probably null
R1840:Thsd7a UTSW 6 12330974 missense probably benign 0.03
R1845:Thsd7a UTSW 6 12321041 missense probably damaging 1.00
R1874:Thsd7a UTSW 6 12555435 missense possibly damaging 0.76
R2023:Thsd7a UTSW 6 12327536 missense probably benign 0.16
R2039:Thsd7a UTSW 6 12408923 missense possibly damaging 0.77
R2058:Thsd7a UTSW 6 12318106 splice site probably benign
R2155:Thsd7a UTSW 6 12379633 missense probably damaging 1.00
R2175:Thsd7a UTSW 6 12331944 missense possibly damaging 0.95
R2216:Thsd7a UTSW 6 12337268 missense possibly damaging 0.95
R2318:Thsd7a UTSW 6 12405147 missense probably damaging 1.00
R2375:Thsd7a UTSW 6 12337362 missense probably damaging 1.00
R3857:Thsd7a UTSW 6 12555226 missense probably benign 0.15
R3858:Thsd7a UTSW 6 12555226 missense probably benign 0.15
R3890:Thsd7a UTSW 6 12418337 missense probably benign 0.09
R3910:Thsd7a UTSW 6 12331549 missense probably damaging 0.96
R3933:Thsd7a UTSW 6 12555226 missense probably benign 0.15
R4369:Thsd7a UTSW 6 12468908 missense probably damaging 1.00
R4447:Thsd7a UTSW 6 12324635 missense probably damaging 0.98
R4664:Thsd7a UTSW 6 12337314 missense possibly damaging 0.79
R4664:Thsd7a UTSW 6 12504013 missense possibly damaging 0.90
R4665:Thsd7a UTSW 6 12337314 missense possibly damaging 0.79
R4665:Thsd7a UTSW 6 12504013 missense possibly damaging 0.90
R4666:Thsd7a UTSW 6 12337314 missense possibly damaging 0.79
R4666:Thsd7a UTSW 6 12504013 missense possibly damaging 0.90
R4668:Thsd7a UTSW 6 12408968 missense probably damaging 0.98
R4886:Thsd7a UTSW 6 12327660 nonsense probably null
R4918:Thsd7a UTSW 6 12327559 missense probably damaging 1.00
R4938:Thsd7a UTSW 6 12330992 missense probably benign 0.09
R5064:Thsd7a UTSW 6 12330952 missense possibly damaging 0.66
R5153:Thsd7a UTSW 6 12338655 missense probably benign 0.00
R5177:Thsd7a UTSW 6 12379583 nonsense probably null
R5242:Thsd7a UTSW 6 12327583 missense probably damaging 1.00
R5267:Thsd7a UTSW 6 12379602 missense probably damaging 1.00
R5442:Thsd7a UTSW 6 12748800 missense probably benign 0.00
R5506:Thsd7a UTSW 6 12332017 missense possibly damaging 0.85
R5525:Thsd7a UTSW 6 12332007 missense possibly damaging 0.52
R5544:Thsd7a UTSW 6 12379471 missense possibly damaging 0.94
R5651:Thsd7a UTSW 6 12343213 missense probably damaging 1.00
R5716:Thsd7a UTSW 6 12343148 missense probably benign 0.00
R5848:Thsd7a UTSW 6 12503923 missense probably damaging 1.00
R5958:Thsd7a UTSW 6 12337262 missense probably benign 0.02
R6012:Thsd7a UTSW 6 12379389 splice site probably null
R6139:Thsd7a UTSW 6 12379573 missense possibly damaging 0.93
R6243:Thsd7a UTSW 6 12327602 missense probably damaging 1.00
R6257:Thsd7a UTSW 6 12408988 nonsense probably null
R6273:Thsd7a UTSW 6 12408836 missense probably damaging 0.99
R6300:Thsd7a UTSW 6 12471104 nonsense probably null
R6314:Thsd7a UTSW 6 12554997 missense possibly damaging 0.87
R6392:Thsd7a UTSW 6 12468929 missense probably damaging 0.99
R6418:Thsd7a UTSW 6 12555082 nonsense probably null
R6515:Thsd7a UTSW 6 12501086 missense possibly damaging 0.47
R6725:Thsd7a UTSW 6 12555631 missense possibly damaging 0.87
R6742:Thsd7a UTSW 6 12408816 missense probably damaging 1.00
R6776:Thsd7a UTSW 6 12555637 missense possibly damaging 0.53
R6838:Thsd7a UTSW 6 12504075 missense probably damaging 0.99
R7104:Thsd7a UTSW 6 12379430 missense
R7170:Thsd7a UTSW 6 12352091 missense
R7349:Thsd7a UTSW 6 12352068 missense
R7460:Thsd7a UTSW 6 12554934 missense
R7467:Thsd7a UTSW 6 12331585 missense
R7666:Thsd7a UTSW 6 12379438 missense
Predicted Primers PCR Primer
(F):5'- GGAGCCAGCGTTAGTGAATG -3'
(R):5'- TCTTCTCTGAGAACACATGGG -3'

Sequencing Primer
(F):5'- GCCAGCGTTAGTGAATGACTAC -3'
(R):5'- GCTTCAAAACCAGTGGACT -3'
Posted On2014-10-01