Mutagenetix > Incidental Mutation

Incidental Mutation 'R2138:Mgam'

235951

Institutional Source

Beutler Lab

Gene Symbol

Mgam

Ensembl Gene

ENSMUSG00000068587

Gene Name

maltase-glucoamylase

Synonyms

6030407P20Rik

MMRRC Submission

040141-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.180) question?

Stock #

R2138 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

40628831-40769123 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 40756450 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Proline to Serine at position 839 (P839S)

Ref Sequence

ENSEMBL: ENSMUSP00000144627 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000071535] [ENSMUST00000201148] [ENSMUST00000202779] [ENSMUST00000202966]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000071535
AA Change: P1466S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000071466
Gene: ENSMUSG00000068587
AA Change: P1466S

Domain	Start	End	E-Value	Type
transmembrane domain	12	34	N/A	INTRINSIC
low complexity region	47	59	N/A	INTRINSIC
PD	63	111	1.81e-8	SMART
Pfam:NtCtMGAM_N	124	233	6.2e-36	PFAM
Pfam:Glyco_hydro_31	323	795	3.4e-145	PFAM
PD	924	977	4.52e-9	SMART
Pfam:NtCtMGAM_N	988	1101	1.5e-30	PFAM
Blast:ANK	1141	1171	1e-7	BLAST
Pfam:Glyco_hydro_31	1189	1691	2e-139	PFAM
low complexity region	1776	1791	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000201148
AA Change: P1466S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000143946
Gene: ENSMUSG00000068587
AA Change: P1466S

Domain	Start	End	E-Value	Type
transmembrane domain	12	34	N/A	INTRINSIC
low complexity region	47	59	N/A	INTRINSIC
PD	63	111	1.81e-8	SMART
Pfam:NtCtMGAM_N	124	233	6.2e-36	PFAM
Pfam:Glyco_hydro_31	323	795	3.4e-145	PFAM
PD	924	977	4.52e-9	SMART
Pfam:NtCtMGAM_N	988	1101	1.5e-30	PFAM
Blast:ANK	1141	1171	1e-7	BLAST
Pfam:Glyco_hydro_31	1189	1691	2e-139	PFAM
low complexity region	1776	1791	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000202775

Predicted Effect

probably damaging
Transcript: ENSMUST00000202779
AA Change: P839S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000144627
Gene: ENSMUSG00000068587
AA Change: P839S

Domain	Start	End	E-Value	Type
Pfam:Glyco_hydro_31	2	170	1.4e-53	PFAM
PD	297	350	1.4e-14	SMART
Pfam:NtCtMGAM_N	361	474	1.5e-26	PFAM
Blast:ANK	514	544	7e-8	BLAST
Pfam:Glyco_hydro_31	562	1064	2.2e-137	PFAM
low complexity region	1149	1164	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000202966
AA Change: P720S

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000144680
Gene: ENSMUSG00000068587
AA Change: P720S

Domain	Start	End	E-Value	Type
internal_repeat_1	2	88	2.6e-19	PROSPERO
PD	178	231	1.4e-14	SMART
Pfam:NtCtMGAM_N	242	355	1.1e-26	PFAM
Blast:ANK	395	425	6e-8	BLAST
Pfam:Glyco_hydro_31	443	945	1.3e-137	PFAM

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.4%
20x: 95.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes maltase-glucoamylase, which is a brush border membrane enzyme that plays a role in the final steps of digestion of starch. The protein has two catalytic sites identical to those of sucrase-isomaltase, but the proteins are only 59% homologous. Both are members of glycosyl hydrolase family 31, which has a variety of substrate specificities. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele display abnormalities in starch digestion and prandial glucose homeostasis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 74 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aamp	A	G	1: 74,283,963	V6A	probably benign	Het
Abcc6	A	G	7: 45,981,051	F1262L	probably damaging	Het
Acot13	A	T	13: 24,818,205		probably null	Het
Adgrv1	T	C	13: 81,445,320	I4183V	probably benign	Het
Aff4	T	G	11: 53,372,512	S120A	possibly damaging	Het
Afp	A	G	5: 90,499,647	E250G	probably damaging	Het
Ankrd34b	A	T	13: 92,439,406	D382V	probably damaging	Het
Arhgef19	A	T	4: 141,250,800	I577F	probably damaging	Het
Arl6	A	G	16: 59,622,467		probably benign	Het
Atp2b2	A	T	6: 113,796,307	M333K	probably benign	Het
Atp8b3	C	A	10: 80,527,105	A635S	possibly damaging	Het
Baiap2	A	G	11: 119,957,102	T19A	possibly damaging	Het
Bcar3	A	G	3: 122,512,996	D206G	probably damaging	Het
Ccdc162	A	T	10: 41,581,297	M85K	probably benign	Het
Clec4a4	A	G	6: 123,023,978	N217D	probably damaging	Het
Csmd1	T	C	8: 15,929,088	Y2832C	probably damaging	Het
Cubn	A	G	2: 13,444,378	I962T	probably damaging	Het
Dennd4a	A	G	9: 64,889,337	Y852C	probably damaging	Het
Dhcr24	G	T	4: 106,572,302	E191*	probably null	Het
Dusp12	G	A	1: 170,880,597	Q114*	probably null	Het
Elfn2	G	T	15: 78,674,038	T103K	probably benign	Het
Eme1	A	T	11: 94,648,192	V314E	probably damaging	Het
Epb41l3	A	G	17: 69,207,880	E4G	probably damaging	Het
Exoc6b	A	T	6: 84,989,482	L170Q	probably damaging	Het
Fam129a	G	A	1: 151,696,251	V316M	probably damaging	Het
Fbln5	C	T	12: 101,761,920	M261I	probably benign	Het
Fgf22	T	C	10: 79,756,601	V64A	probably damaging	Het
Gak	C	T	5: 108,606,877		probably null	Het
Gatad2b	T	A	3: 90,352,113	S401R	probably damaging	Het
Gen1	A	T	12: 11,241,621	S722R	probably damaging	Het
Gm10754	A	T	10: 97,682,270		probably benign	Het
Gm8897	A	T	5: 11,419,085	R68*	probably null	Het
Grid2	G	A	6: 64,345,798	R594Q	probably damaging	Het
Grm7	C	A	6: 110,646,137	N90K	probably damaging	Het
Herc1	G	A	9: 66,470,307	V3452M	possibly damaging	Het
Il22ra2	T	A	10: 19,632,870	F215L	probably benign	Het
Kank1	G	A	19: 25,411,753	G930D	probably benign	Het
Klra3	A	T	6: 130,333,158	V133D	probably benign	Het
Lims2	A	G	18: 31,955,407	E220G	possibly damaging	Het
Mbd3l2	A	T	9: 18,444,958	D193V	probably damaging	Het
Mbl1	T	A	14: 41,153,691	I34K	possibly damaging	Het
Mmp9	G	T	2: 164,952,467	E460*	probably null	Het
Mov10	T	C	3: 104,804,242	H316R	probably benign	Het
Ms4a18	A	T	19: 10,997,331	V332D	possibly damaging	Het
Myo15b	T	C	11: 115,883,807	S2082P	probably benign	Het
Myrfl	G	A	10: 116,795,538	T706I	probably benign	Het
Nampt	C	A	12: 32,838,422	H191N	possibly damaging	Het
Nphp3	A	G	9: 104,025,903	E693G	possibly damaging	Het
Obscn	A	T	11: 59,003,665	Y1191*	probably null	Het
Olfr19	A	G	16: 16,673,205	Y259H	probably damaging	Het
Olfr398	A	T	11: 73,984,303	Y102N	probably damaging	Het
Olfr419	A	T	1: 174,250,736		probably null	Het
Osbpl10	A	G	9: 115,232,134	N760S	probably benign	Het
Otof	A	G	5: 30,461,770	V10A	probably benign	Het
Pkhd1l1	A	C	15: 44,501,457	E664A	probably damaging	Het
Pnp2	T	C	14: 50,963,704	S178P	probably damaging	Het
Pvr	G	A	7: 19,917,002	T199I	probably damaging	Het
Rbp3	C	T	14: 33,956,018	T641M	probably damaging	Het
Rnaseh2b	T	C	14: 62,361,345	V173A	probably benign	Het
Sept12	C	T	16: 4,992,206	R155H	probably damaging	Het
Slco6d1	G	T	1: 98,443,660	R290L	probably benign	Het
Snx32	A	G	19: 5,496,129	V335A	probably damaging	Het
Son	T	C	16: 91,659,372	V1669A	possibly damaging	Het
Tbata	C	T	10: 61,179,284	T116I	probably benign	Het
Tdrd1	T	A	19: 56,842,589	S279T	probably benign	Het
Thsd7a	A	T	6: 12,471,073	Y515*	probably null	Het
Tmem102	T	G	11: 69,805,114	L40F	probably damaging	Het
Tmem169	A	G	1: 72,300,996	N195S	probably damaging	Het
Tmem201	A	T	4: 149,718,080	S613T	probably damaging	Het
Tnfaip6	A	T	2: 52,052,332	I218F	possibly damaging	Het
Tube1	C	A	10: 39,147,351	H331Q	probably benign	Het
Wwc1	G	A	11: 35,841,887	T998I	possibly damaging	Het
Xpc	A	T	6: 91,498,122	Y638*	probably null	Het
Zdhhc4	A	T	5: 143,324,262	Y80*	probably null	Het

Other mutations in Mgam

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01024:Mgam	APN	6	40643010	missense	probably benign
IGL01065:Mgam	APN	6	40662710	critical splice donor site	probably null
IGL01402:Mgam	APN	6	40644945	missense	probably benign	0.01
IGL01404:Mgam	APN	6	40644945	missense	probably benign	0.01
IGL01413:Mgam	APN	6	40661277	missense	probably damaging	1.00
IGL01546:Mgam	APN	6	40654693	missense	probably damaging	0.98
IGL01596:Mgam	APN	6	40658270	missense	probably damaging	1.00
IGL02133:Mgam	APN	6	40643076	missense	probably damaging	0.98
IGL02734:Mgam	APN	6	40662694	missense	probably damaging	1.00
BB002:Mgam	UTSW	6	40759051	missense	probably damaging	0.99
BB012:Mgam	UTSW	6	40759051	missense	probably damaging	0.99
R0012:Mgam	UTSW	6	40765256	splice site	probably null
R0116:Mgam	UTSW	6	40658987	missense	probably damaging	1.00
R0310:Mgam	UTSW	6	40761035	splice site	probably benign
R0452:Mgam	UTSW	6	40759090	missense	probably damaging	1.00
R0497:Mgam	UTSW	6	40664892	missense	probably damaging	1.00
R0699:Mgam	UTSW	6	40643019	missense	possibly damaging	0.84
R0738:Mgam	UTSW	6	40754935	missense	probably benign	0.01
R1033:Mgam	UTSW	6	40680624	missense	probably benign	0.07
R1403:Mgam	UTSW	6	40666881	missense	possibly damaging	0.93
R1403:Mgam	UTSW	6	40666881	missense	possibly damaging	0.93
R1430:Mgam	UTSW	6	40756371	missense	probably benign	0.08
R1432:Mgam	UTSW	6	40756367	missense	probably damaging	1.00
R1443:Mgam	UTSW	6	40759780	nonsense	probably null
R1470:Mgam	UTSW	6	40759128	missense	probably damaging	1.00
R1470:Mgam	UTSW	6	40759128	missense	probably damaging	1.00
R1519:Mgam	UTSW	6	40661683	missense	probably benign	0.45
R1654:Mgam	UTSW	6	40757487	missense	probably damaging	1.00
R1667:Mgam	UTSW	6	40677044	missense	possibly damaging	0.62
R1730:Mgam	UTSW	6	40664860	missense	possibly damaging	0.92
R1781:Mgam	UTSW	6	40669863	missense	probably damaging	1.00
R1783:Mgam	UTSW	6	40664860	missense	possibly damaging	0.92
R1829:Mgam	UTSW	6	40666892	missense	probably damaging	1.00
R1833:Mgam	UTSW	6	40654718	critical splice donor site	probably null
R1872:Mgam	UTSW	6	40661300	nonsense	probably null
R1912:Mgam	UTSW	6	40764185	nonsense	probably null
R1977:Mgam	UTSW	6	40664880	missense	probably benign	0.01
R2048:Mgam	UTSW	6	40656429	missense	possibly damaging	0.80
R2086:Mgam	UTSW	6	40761028	splice site	probably null
R2224:Mgam	UTSW	6	40764274	splice site	probably null
R2408:Mgam	UTSW	6	40686522	missense	probably damaging	1.00
R2508:Mgam	UTSW	6	40759783	missense	probably damaging	1.00
R2842:Mgam	UTSW	6	40661345	missense	probably benign	0.01
R2847:Mgam	UTSW	6	40652715	missense	possibly damaging	0.67
R2848:Mgam	UTSW	6	40652715	missense	possibly damaging	0.67
R2965:Mgam	UTSW	6	40768220	missense	possibly damaging	0.46
R2966:Mgam	UTSW	6	40768220	missense	possibly damaging	0.46
R3035:Mgam	UTSW	6	40663530	missense	probably benign
R3895:Mgam	UTSW	6	40759120	missense	probably damaging	1.00
R4027:Mgam	UTSW	6	40754902	missense	probably damaging	1.00
R4030:Mgam	UTSW	6	40754902	missense	probably damaging	1.00
R4302:Mgam	UTSW	6	40763085	missense	probably benign	0.02
R4707:Mgam	UTSW	6	40714632	splice site	probably null
R4826:Mgam	UTSW	6	40680648	missense	possibly damaging	0.52
R4898:Mgam	UTSW	6	40643054	missense	probably benign
R5438:Mgam	UTSW	6	40684521	missense	probably damaging	1.00
R5492:Mgam	UTSW	6	40756363	missense	probably damaging	1.00
R5770:Mgam	UTSW	6	40669804	missense	probably benign	0.01
R5839:Mgam	UTSW	6	40740064	missense	possibly damaging	0.90
R5845:Mgam	UTSW	6	40675323	missense	possibly damaging	0.78
R5847:Mgam	UTSW	6	40684055	missense	probably benign	0.42
R5891:Mgam	UTSW	6	40744348	missense	probably benign
R6158:Mgam	UTSW	6	40757714	missense	probably damaging	1.00
R6193:Mgam	UTSW	6	40747920	nonsense	probably null
R6423:Mgam	UTSW	6	40677045	missense	possibly damaging	0.84
R6706:Mgam	UTSW	6	40744786	missense	probably benign	0.00
R6813:Mgam	UTSW	6	40750165	missense	probably damaging	0.99
R6863:Mgam	UTSW	6	40729009	missense	probably benign	0.00
R6906:Mgam	UTSW	6	40747919	missense	probably damaging	1.00
R7091:Mgam	UTSW	6	40768276	missense	possibly damaging	0.95
R7099:Mgam	UTSW	6	40661716	missense	probably benign	0.09
R7282:Mgam	UTSW	6	40656512	missense	possibly damaging	0.71
R7282:Mgam	UTSW	6	40763111	missense	probably benign
R7354:Mgam	UTSW	6	40744798	missense	probably damaging	1.00
R7374:Mgam	UTSW	6	40757439	missense	possibly damaging	0.89
R7399:Mgam	UTSW	6	40666854	missense	probably damaging	0.99
R7406:Mgam	UTSW	6	40663525	missense	probably benign	0.13
R7446:Mgam	UTSW	6	40746332	missense	probably damaging	1.00
R7466:Mgam	UTSW	6	40744789	missense	probably benign	0.00
R7525:Mgam	UTSW	6	40766020	missense	probably benign	0.01
R7530:Mgam	UTSW	6	40709218	splice site	probably null
R7570:Mgam	UTSW	6	40746433	missense	probably benign	0.16
R7669:Mgam	UTSW	6	40659010	missense	probably benign	0.00
R7679:Mgam	UTSW	6	40643046	missense	probably damaging	0.98
R7746:Mgam	UTSW	6	40668193	missense	probably damaging	0.99
R7859:Mgam	UTSW	6	40740179	missense	possibly damaging	0.75
R7925:Mgam	UTSW	6	40759051	missense	probably damaging	0.99
R8206:Mgam	UTSW	6	40680235	missense	probably benign	0.00
R8244:Mgam	UTSW	6	40750586	missense	probably damaging	1.00
R8309:Mgam	UTSW	6	40745177	missense	possibly damaging	0.88
R8472:Mgam	UTSW	6	40694526	splice site	probably null
R8758:Mgam	UTSW	6	40729043	missense	probably benign	0.41
R8777:Mgam	UTSW	6	40655251	missense	probably damaging	0.97
R8777-TAIL:Mgam	UTSW	6	40655251	missense	probably damaging	0.97
R8783:Mgam	UTSW	6	40656489	missense	probably damaging	0.99
R8939:Mgam	UTSW	6	40763203	critical splice donor site	probably null
R8968:Mgam	UTSW	6	40757811	critical splice acceptor site	probably null
R8987:Mgam	UTSW	6	40729636	missense	probably damaging	1.00
R9055:Mgam	UTSW	6	40714729	intron	probably benign
R9171:Mgam	UTSW	6	40768212	missense	possibly damaging	0.76
R9252:Mgam	UTSW	6	40729643	missense	probably damaging	0.99
R9258:Mgam	UTSW	6	40680187	missense	probably benign
R9262:Mgam	UTSW	6	40746488	critical splice donor site	probably null
R9287:Mgam	UTSW	6	40728971	intron	probably benign
R9521:Mgam	UTSW	6	40745184	missense	probably damaging	1.00
R9589:Mgam	UTSW	6	40750585	missense	probably damaging	1.00
R9658:Mgam	UTSW	6	40744377	missense	possibly damaging	0.93
R9784:Mgam	UTSW	6	40759090	missense	probably damaging	1.00
RF011:Mgam	UTSW	6	40757436	missense	probably damaging	1.00
RF020:Mgam	UTSW	6	40685309	missense	probably damaging	1.00
RF023:Mgam	UTSW	6	40680708	missense	probably benign
X0021:Mgam	UTSW	6	40659047	missense	probably damaging	1.00
Z1088:Mgam	UTSW	6	40643060	missense	probably benign	0.01
Z1176:Mgam	UTSW	6	40677644	critical splice donor site	probably null
Z1176:Mgam	UTSW	6	40729066	missense	probably damaging	1.00
Z1177:Mgam	UTSW	6	40740071	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CAATGAGAAGATTCAGAACTGCC -3'
(R):5'- TCTGTCTCCATGCAGAAGTACTC -3'

Sequencing Primer
(F):5'- GAAGATTCAGAACTGCCTTTCATTC -3'
(R):5'- TTGAAGGACCCTTTCACAGG -3'

Posted On

2014-10-01