Mutagenetix > Incidental Mutation

Incidental Mutation 'R2138:Grm7'

235955

Institutional Source

Beutler Lab

Gene Symbol

Grm7

Ensembl Gene

ENSMUSG00000056755

Gene Name

glutamate receptor, metabotropic 7

Synonyms

Gpr1g, mGlu7a receptor, mGluR7, E130018M02Rik, 6330570A01Rik

MMRRC Submission

040141-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R2138 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

110645581-111567230 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 110646137 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Lysine at position 90 (N90K)

Ref Sequence

ENSEMBL: ENSMUSP00000134635 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000071076] [ENSMUST00000172951] [ENSMUST00000174018]

AlphaFold

Q68ED2

Predicted Effect

probably damaging
Transcript: ENSMUST00000071076
AA Change: N90K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000064404
Gene: ENSMUSG00000056755
AA Change: N90K

Domain	Start	End	E-Value	Type
low complexity region	18	32	N/A	INTRINSIC
Pfam:ANF_receptor	77	484	3e-108	PFAM
Pfam:Peripla_BP_6	144	371	3e-11	PFAM
Pfam:NCD3G	519	569	1.2e-13	PFAM
Pfam:7tm_3	602	847	5.1e-59	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000172951
AA Change: N90K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000133957
Gene: ENSMUSG00000056755
AA Change: N90K

Domain	Start	End	E-Value	Type
low complexity region	18	32	N/A	INTRINSIC
Pfam:ANF_receptor	77	484	1.7e-103	PFAM
Pfam:Peripla_BP_6	144	487	1e-12	PFAM
Pfam:NCD3G	519	569	1.2e-17	PFAM
Pfam:7tm_3	600	848	1.4e-87	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000173609

Predicted Effect

probably damaging
Transcript: ENSMUST00000174018
AA Change: N90K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000134635
Gene: ENSMUSG00000056755
AA Change: N90K

Domain	Start	End	E-Value	Type
low complexity region	18	32	N/A	INTRINSIC
Pfam:ANF_receptor	77	176	4.9e-20	PFAM

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.4%
20x: 95.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] L-glutamate is the major excitatory neurotransmitter in the central nervous system, and it activates both ionotropic and metabotropic glutamate receptors. Glutamatergic neurotransmission is involved in most aspects of normal brain function and can be perturbed in many neuropathologic conditions. The metabotropic glutamate receptors are a family of G protein-coupled receptors that have been divided into three groups on the basis of sequence homology, putative signal transduction mechanisms, and pharmacologic properties. Group I includes GRM1 and GRM5, and these receptors have been shown to activate phospholipase C. Group II includes GRM2 and GRM3, while Group III includes GRM4, GRM6, GRM7 and GRM8. Group II and III receptors are linked to the inhibition of the cyclic AMP cascade but differ in their agonist selectivities. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jun 2009]
PHENOTYPE: Nullizygous mice exhibit epilepsy and deficits in fear response and conditioned taste aversion. Homozygotes for a knock-in allele show impaired spatial working memory and higher susceptibility to PTZ. Homozygotes for a reporter allele show impaired coordination and higher susceptibility to metrazol. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 74 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aamp	A	G	1: 74,283,963	V6A	probably benign	Het
Abcc6	A	G	7: 45,981,051	F1262L	probably damaging	Het
Acot13	A	T	13: 24,818,205		probably null	Het
Adgrv1	T	C	13: 81,445,320	I4183V	probably benign	Het
Aff4	T	G	11: 53,372,512	S120A	possibly damaging	Het
Afp	A	G	5: 90,499,647	E250G	probably damaging	Het
Ankrd34b	A	T	13: 92,439,406	D382V	probably damaging	Het
Arhgef19	A	T	4: 141,250,800	I577F	probably damaging	Het
Arl6	A	G	16: 59,622,467		probably benign	Het
Atp2b2	A	T	6: 113,796,307	M333K	probably benign	Het
Atp8b3	C	A	10: 80,527,105	A635S	possibly damaging	Het
Baiap2	A	G	11: 119,957,102	T19A	possibly damaging	Het
Bcar3	A	G	3: 122,512,996	D206G	probably damaging	Het
Ccdc162	A	T	10: 41,581,297	M85K	probably benign	Het
Clec4a4	A	G	6: 123,023,978	N217D	probably damaging	Het
Csmd1	T	C	8: 15,929,088	Y2832C	probably damaging	Het
Cubn	A	G	2: 13,444,378	I962T	probably damaging	Het
Dennd4a	A	G	9: 64,889,337	Y852C	probably damaging	Het
Dhcr24	G	T	4: 106,572,302	E191*	probably null	Het
Dusp12	G	A	1: 170,880,597	Q114*	probably null	Het
Elfn2	G	T	15: 78,674,038	T103K	probably benign	Het
Eme1	A	T	11: 94,648,192	V314E	probably damaging	Het
Epb41l3	A	G	17: 69,207,880	E4G	probably damaging	Het
Exoc6b	A	T	6: 84,989,482	L170Q	probably damaging	Het
Fam129a	G	A	1: 151,696,251	V316M	probably damaging	Het
Fbln5	C	T	12: 101,761,920	M261I	probably benign	Het
Fgf22	T	C	10: 79,756,601	V64A	probably damaging	Het
Gak	C	T	5: 108,606,877		probably null	Het
Gatad2b	T	A	3: 90,352,113	S401R	probably damaging	Het
Gen1	A	T	12: 11,241,621	S722R	probably damaging	Het
Gm10754	A	T	10: 97,682,270		probably benign	Het
Gm8897	A	T	5: 11,419,085	R68*	probably null	Het
Grid2	G	A	6: 64,345,798	R594Q	probably damaging	Het
Herc1	G	A	9: 66,470,307	V3452M	possibly damaging	Het
Il22ra2	T	A	10: 19,632,870	F215L	probably benign	Het
Kank1	G	A	19: 25,411,753	G930D	probably benign	Het
Klra3	A	T	6: 130,333,158	V133D	probably benign	Het
Lims2	A	G	18: 31,955,407	E220G	possibly damaging	Het
Mbd3l2	A	T	9: 18,444,958	D193V	probably damaging	Het
Mbl1	T	A	14: 41,153,691	I34K	possibly damaging	Het
Mgam	C	T	6: 40,756,450	P839S	probably damaging	Het
Mmp9	G	T	2: 164,952,467	E460*	probably null	Het
Mov10	T	C	3: 104,804,242	H316R	probably benign	Het
Ms4a18	A	T	19: 10,997,331	V332D	possibly damaging	Het
Myo15b	T	C	11: 115,883,807	S2082P	probably benign	Het
Myrfl	G	A	10: 116,795,538	T706I	probably benign	Het
Nampt	C	A	12: 32,838,422	H191N	possibly damaging	Het
Nphp3	A	G	9: 104,025,903	E693G	possibly damaging	Het
Obscn	A	T	11: 59,003,665	Y1191*	probably null	Het
Olfr19	A	G	16: 16,673,205	Y259H	probably damaging	Het
Olfr398	A	T	11: 73,984,303	Y102N	probably damaging	Het
Olfr419	A	T	1: 174,250,736		probably null	Het
Osbpl10	A	G	9: 115,232,134	N760S	probably benign	Het
Otof	A	G	5: 30,461,770	V10A	probably benign	Het
Pkhd1l1	A	C	15: 44,501,457	E664A	probably damaging	Het
Pnp2	T	C	14: 50,963,704	S178P	probably damaging	Het
Pvr	G	A	7: 19,917,002	T199I	probably damaging	Het
Rbp3	C	T	14: 33,956,018	T641M	probably damaging	Het
Rnaseh2b	T	C	14: 62,361,345	V173A	probably benign	Het
Sept12	C	T	16: 4,992,206	R155H	probably damaging	Het
Slco6d1	G	T	1: 98,443,660	R290L	probably benign	Het
Snx32	A	G	19: 5,496,129	V335A	probably damaging	Het
Son	T	C	16: 91,659,372	V1669A	possibly damaging	Het
Tbata	C	T	10: 61,179,284	T116I	probably benign	Het
Tdrd1	T	A	19: 56,842,589	S279T	probably benign	Het
Thsd7a	A	T	6: 12,471,073	Y515*	probably null	Het
Tmem102	T	G	11: 69,805,114	L40F	probably damaging	Het
Tmem169	A	G	1: 72,300,996	N195S	probably damaging	Het
Tmem201	A	T	4: 149,718,080	S613T	probably damaging	Het
Tnfaip6	A	T	2: 52,052,332	I218F	possibly damaging	Het
Tube1	C	A	10: 39,147,351	H331Q	probably benign	Het
Wwc1	G	A	11: 35,841,887	T998I	possibly damaging	Het
Xpc	A	T	6: 91,498,122	Y638*	probably null	Het
Zdhhc4	A	T	5: 143,324,262	Y80*	probably null	Het

Other mutations in Grm7

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01729:Grm7	APN	6	111246184	missense	probably benign	0.14
IGL02058:Grm7	APN	6	111358317	missense	probably damaging	1.00
IGL02650:Grm7	APN	6	111358958	missense	probably damaging	1.00
IGL02892:Grm7	APN	6	111254020	missense	probably damaging	0.99
IGL03074:Grm7	APN	6	111495643	splice site	probably null
IGL03185:Grm7	APN	6	110646222	missense	possibly damaging	0.84
Appropriated	UTSW	6	111495681	missense	possibly damaging	0.64
Consumed	UTSW	6	111358875	missense	probably damaging	1.00
Devoured	UTSW	6	111358824	missense	probably damaging	1.00
shaky	UTSW	6	111495791	nonsense	probably null
PIT4651001:Grm7	UTSW	6	110646089	missense	probably benign
R0539:Grm7	UTSW	6	111359094	splice site	probably benign
R0622:Grm7	UTSW	6	111358496	missense	probably damaging	1.00
R1356:Grm7	UTSW	6	111359024	missense	probably damaging	1.00
R1762:Grm7	UTSW	6	111358295	missense	probably damaging	1.00
R1783:Grm7	UTSW	6	111358295	missense	probably damaging	1.00
R1785:Grm7	UTSW	6	111358295	missense	probably damaging	1.00
R1816:Grm7	UTSW	6	111495791	nonsense	probably null
R1823:Grm7	UTSW	6	111207769	missense	probably benign	0.17
R1864:Grm7	UTSW	6	111080423	missense	probably benign	0.03
R1894:Grm7	UTSW	6	111358607	missense	probably benign
R1987:Grm7	UTSW	6	110914511	missense	probably damaging	1.00
R1993:Grm7	UTSW	6	111207808	missense	probably benign	0.13
R2214:Grm7	UTSW	6	111358997	missense	probably damaging	1.00
R2289:Grm7	UTSW	6	110646348	missense	probably damaging	1.00
R2296:Grm7	UTSW	6	110646348	missense	probably damaging	1.00
R2339:Grm7	UTSW	6	111495681	missense	possibly damaging	0.64
R2847:Grm7	UTSW	6	110646348	missense	probably damaging	1.00
R2849:Grm7	UTSW	6	110646348	missense	probably damaging	1.00
R2879:Grm7	UTSW	6	110646348	missense	probably damaging	1.00
R2884:Grm7	UTSW	6	110646348	missense	probably damaging	1.00
R2921:Grm7	UTSW	6	111495905	splice site	probably null
R2923:Grm7	UTSW	6	111495905	splice site	probably null
R3014:Grm7	UTSW	6	110646348	missense	probably damaging	1.00
R3015:Grm7	UTSW	6	110646348	missense	probably damaging	1.00
R3703:Grm7	UTSW	6	110646348	missense	probably damaging	1.00
R3713:Grm7	UTSW	6	110646348	missense	probably damaging	1.00
R3963:Grm7	UTSW	6	110646348	missense	probably damaging	1.00
R4009:Grm7	UTSW	6	111495722	missense	probably damaging	1.00
R4091:Grm7	UTSW	6	110914340	missense	probably damaging	1.00
R4131:Grm7	UTSW	6	110646348	missense	probably damaging	1.00
R4132:Grm7	UTSW	6	110646348	missense	probably damaging	1.00
R4161:Grm7	UTSW	6	111254020	missense	probably damaging	0.99
R4329:Grm7	UTSW	6	110914364	missense	probably damaging	1.00
R4357:Grm7	UTSW	6	110646348	missense	probably damaging	1.00
R4359:Grm7	UTSW	6	110646348	missense	probably damaging	1.00
R4379:Grm7	UTSW	6	110646348	missense	probably damaging	1.00
R4379:Grm7	UTSW	6	111246374	missense	probably benign	0.05
R4380:Grm7	UTSW	6	110646348	missense	probably damaging	1.00
R4514:Grm7	UTSW	6	111358304	missense	possibly damaging	0.81
R4518:Grm7	UTSW	6	110914546	splice site	probably null
R4647:Grm7	UTSW	6	110914383	nonsense	probably null
R4714:Grm7	UTSW	6	111080422	missense	possibly damaging	0.52
R4775:Grm7	UTSW	6	110914371	missense	probably damaging	1.00
R4957:Grm7	UTSW	6	111358863	missense	probably damaging	1.00
R5056:Grm7	UTSW	6	111080443	missense	probably damaging	0.99
R5062:Grm7	UTSW	6	110646136	missense	probably damaging	1.00
R5256:Grm7	UTSW	6	111358221	missense	probably benign	0.01
R5431:Grm7	UTSW	6	111358426	missense	probably benign
R6026:Grm7	UTSW	6	111501539	nonsense	probably null
R6174:Grm7	UTSW	6	111246297	missense	probably benign
R6305:Grm7	UTSW	6	111358665	missense	probably damaging	1.00
R6318:Grm7	UTSW	6	111358875	missense	probably damaging	1.00
R6440:Grm7	UTSW	6	111254020	missense	probably damaging	1.00
R6519:Grm7	UTSW	6	111207752	missense	probably benign	0.00
R6531:Grm7	UTSW	6	111358425	missense	probably benign	0.29
R6888:Grm7	UTSW	6	111358353	missense	possibly damaging	0.79
R6949:Grm7	UTSW	6	110646304	missense	probably benign	0.03
R6949:Grm7	UTSW	6	111495729	missense	probably damaging	1.00
R6989:Grm7	UTSW	6	111207805	missense	probably damaging	1.00
R7076:Grm7	UTSW	6	111358152	missense	probably benign	0.04
R7203:Grm7	UTSW	6	111358569	missense	possibly damaging	0.94
R7208:Grm7	UTSW	6	111358569	missense	possibly damaging	0.94
R7217:Grm7	UTSW	6	111358824	missense	probably damaging	1.00
R7257:Grm7	UTSW	6	110646118	missense	probably damaging	1.00
R7297:Grm7	UTSW	6	110646013	missense	probably benign	0.16
R7470:Grm7	UTSW	6	111501515	missense
R7567:Grm7	UTSW	6	111358761	missense	probably damaging	0.96
R7806:Grm7	UTSW	6	111246353	nonsense	probably null
R8018:Grm7	UTSW	6	111207776	missense	probably benign	0.01
R8076:Grm7	UTSW	6	111566039	missense	probably damaging	1.00
R8409:Grm7	UTSW	6	110914336	missense	probably benign	0.02
R8420:Grm7	UTSW	6	111080354	missense	probably benign
R8523:Grm7	UTSW	6	111246319	missense	possibly damaging	0.76
R8816:Grm7	UTSW	6	111254005	missense	possibly damaging	0.46
R8958:Grm7	UTSW	6	111495822	missense	probably damaging	0.96
R9135:Grm7	UTSW	6	111495768	missense	probably benign	0.39
R9207:Grm7	UTSW	6	111358913	missense	probably damaging	1.00
R9210:Grm7	UTSW	6	110645908	missense	probably benign	0.01
R9438:Grm7	UTSW	6	111254116	missense	possibly damaging	0.94
R9448:Grm7	UTSW	6	111358232	missense	probably benign	0.01
Z1176:Grm7	UTSW	6	111358149	missense	probably benign	0.01
Z1176:Grm7	UTSW	6	111358490	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TTGATGAAGTTCCCCTGCTG -3'
(R):5'- TCTCTGGCTTGACGAAAACCG -3'

Sequencing Primer
(F):5'- AGGTGCTCCTGTGCGTGC -3'
(R):5'- CTTGACGAAAACCGGGGGC -3'

Posted On

2014-10-01