Incidental Mutation 'R0201:Psmd1'
ID 23596
Institutional Source Beutler Lab
Gene Symbol Psmd1
Ensembl Gene ENSMUSG00000026229
Gene Name proteasome (prosome, macropain) 26S subunit, non-ATPase, 1
Synonyms P112, S1
MMRRC Submission 038458-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.962) question?
Stock # R0201 (G1)
Quality Score 225
Status Validated
Chromosome 1
Chromosomal Location 85992341-86067017 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 86046338 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Methionine at position 702 (T702M)
Ref Sequence ENSEMBL: ENSMUSP00000027432 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027432] [ENSMUST00000139715]
AlphaFold Q3TXS7
Predicted Effect probably benign
Transcript: ENSMUST00000027432
AA Change: T702M

PolyPhen 2 Score 0.106 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000027432
Gene: ENSMUSG00000026229
AA Change: T702M

DomainStartEndE-ValueType
Pfam:PC_rep 441 474 5.1e-9 PFAM
Pfam:PC_rep 476 510 8.4e-8 PFAM
Pfam:PC_rep 511 545 1.1e-7 PFAM
Pfam:HEAT_2 599 693 3.3e-15 PFAM
Pfam:PC_rep 651 685 1.1e-11 PFAM
low complexity region 818 828 N/A INTRINSIC
low complexity region 837 872 N/A INTRINSIC
low complexity region 936 949 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000139715
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152184
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195317
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 94.2%
Validation Efficiency 97% (91/94)
MGI Phenotype FUNCTION: In eukaryotic cells, most proteins in the cytosol and nucleus are degraded via the ubiquitin-proteasome pathway. The 26S proteasome is a self-compartmentalizing protease comprised of approximately 31 different subunits. It contains a barrel-shaped proteolytic core complex (the 20S proteasome), capped at one or both ends by 19S regulatory complexes, which recognize ubiquitinated proteins. Protein degradation by proteasomes is the source of most antigenic peptides presented on MHC class I molecules. This gene encodes a non-ATPase subunit of the 26S proteasome. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamdec1 A G 14: 68,819,406 (GRCm39) probably null Het
Adamts16 T A 13: 70,927,763 (GRCm39) Q492L possibly damaging Het
Aplnr A G 2: 84,967,521 (GRCm39) D182G probably damaging Het
Arnt2 G T 7: 84,010,867 (GRCm39) S3* probably null Het
Asxl3 T C 18: 22,656,211 (GRCm39) V1407A probably benign Het
Atg13 A T 2: 91,515,107 (GRCm39) probably null Het
Atm A T 9: 53,365,579 (GRCm39) probably benign Het
Birc6 T G 17: 74,916,322 (GRCm39) V1746G possibly damaging Het
Cbln1 G T 8: 88,198,741 (GRCm39) T43K probably benign Het
Cbx5 T C 15: 103,108,127 (GRCm39) T173A probably damaging Het
Cc2d2a A G 5: 43,894,854 (GRCm39) Y1437C probably damaging Het
Ccdc78 C A 17: 26,008,210 (GRCm39) probably benign Het
Cd2bp2 A G 7: 126,793,000 (GRCm39) Y341H probably damaging Het
Cdhr5 T A 7: 140,856,291 (GRCm39) D88V probably damaging Het
Ces1f T A 8: 93,993,957 (GRCm39) T275S probably null Het
Cimip4 T A 15: 78,263,028 (GRCm39) M209L probably damaging Het
Clca4a T C 3: 144,666,478 (GRCm39) N458S probably benign Het
Cog5 A G 12: 31,889,840 (GRCm39) K521R probably damaging Het
Csf2ra T A 19: 61,214,006 (GRCm39) T305S probably benign Het
Csmd3 T A 15: 47,483,125 (GRCm39) probably benign Het
Cts6 T A 13: 61,349,313 (GRCm39) R132* probably null Het
D5Ertd579e G T 5: 36,773,809 (GRCm39) N195K probably damaging Het
Ddx1 A G 12: 13,273,809 (GRCm39) V606A probably damaging Het
Dip2b G A 15: 100,084,028 (GRCm39) D884N probably damaging Het
Ehhadh A G 16: 21,592,243 (GRCm39) probably null Het
Enpp1 T A 10: 24,529,815 (GRCm39) T608S probably benign Het
Fancm T C 12: 65,148,406 (GRCm39) Y674H probably damaging Het
Fat4 T A 3: 38,945,745 (GRCm39) V1546D probably damaging Het
Fsd1 G A 17: 56,297,522 (GRCm39) A158T probably benign Het
Fzd2 T A 11: 102,496,948 (GRCm39) M464K probably damaging Het
Gjc2 A G 11: 59,068,416 (GRCm39) F22S possibly damaging Het
Gria2 T C 3: 80,615,145 (GRCm39) Y445C probably damaging Het
Hsdl1 T A 8: 120,292,995 (GRCm39) I147F possibly damaging Het
Ifi44 T C 3: 151,451,273 (GRCm39) Y226C probably damaging Het
Il16 A G 7: 83,371,516 (GRCm39) C97R probably damaging Het
Impg1 A T 9: 80,252,843 (GRCm39) S369T probably damaging Het
Jmjd1c A G 10: 67,054,888 (GRCm39) T390A unknown Het
Lgi1 A G 19: 38,289,741 (GRCm39) E269G possibly damaging Het
Lrp6 G T 6: 134,427,860 (GRCm39) Y1577* probably null Het
Lrrc74a G T 12: 86,808,547 (GRCm39) probably benign Het
Man1c1 A T 4: 134,367,709 (GRCm39) probably null Het
Map1lc3b A C 8: 122,317,289 (GRCm39) Q9P possibly damaging Het
Mboat1 G A 13: 30,386,358 (GRCm39) R124H probably benign Het
Mcu A G 10: 59,292,499 (GRCm39) L60P probably damaging Het
Mrs2 G T 13: 25,202,517 (GRCm39) Q75K probably benign Het
Muc2 CGTG CGTGTG 7: 141,699,185 (GRCm38) probably null Het
Neb G A 2: 52,096,890 (GRCm39) probably benign Het
Nlrp2 C T 7: 5,331,328 (GRCm39) G356D probably benign Het
Notch3 A G 17: 32,375,122 (GRCm39) probably benign Het
Npr2 A C 4: 43,641,617 (GRCm39) S474R probably damaging Het
Nup58 A G 14: 60,482,065 (GRCm39) F100L probably benign Het
Osbpl6 A C 2: 76,376,386 (GRCm39) D87A possibly damaging Het
Pabpc2 A T 18: 39,908,360 (GRCm39) M542L probably benign Het
Papln A G 12: 83,829,801 (GRCm39) probably benign Het
Parpbp T C 10: 87,928,758 (GRCm39) I561V possibly damaging Het
Pcdhb13 C T 18: 37,575,634 (GRCm39) A4V probably benign Het
Pelp1 T C 11: 70,286,530 (GRCm39) T533A possibly damaging Het
Poldip3 T A 15: 83,019,497 (GRCm39) M182L probably benign Het
Por T C 5: 135,760,032 (GRCm39) S240P possibly damaging Het
Pramel15 A T 4: 144,103,843 (GRCm39) probably benign Het
Pramel28 T C 4: 143,691,460 (GRCm39) E421G probably damaging Het
Prss22 A T 17: 24,215,275 (GRCm39) V167D probably damaging Het
Prss37 A C 6: 40,493,283 (GRCm39) L61R probably damaging Het
Pxdn G T 12: 30,052,430 (GRCm39) G869V possibly damaging Het
Rabgap1l A G 1: 160,281,315 (GRCm39) probably benign Het
Rapgef6 T C 11: 54,510,767 (GRCm39) V228A probably damaging Het
Rnf169 T C 7: 99,575,210 (GRCm39) R462G possibly damaging Het
Rnft2 A G 5: 118,332,745 (GRCm39) probably benign Het
Sgo2b T C 8: 64,379,670 (GRCm39) D1054G probably benign Het
Sh3bgr T C 16: 96,029,717 (GRCm39) probably benign Het
Slc12a4 A G 8: 106,671,982 (GRCm39) V910A possibly damaging Het
Slc6a12 A T 6: 121,332,331 (GRCm39) I222F probably benign Het
Spty2d1 G A 7: 46,647,649 (GRCm39) R427* probably null Het
Ssc5d A G 7: 4,947,662 (GRCm39) T1339A probably benign Het
Sspo A C 6: 48,432,686 (GRCm39) E854A possibly damaging Het
Stx7 A G 10: 24,060,977 (GRCm39) probably benign Het
Styk1 A T 6: 131,278,693 (GRCm39) probably benign Het
Tmem163 T G 1: 127,596,374 (GRCm39) probably benign Het
Tmppe C CT 9: 114,233,707 (GRCm39) probably null Het
Tmx2 A G 2: 84,503,426 (GRCm39) V229A probably benign Het
Top2b T C 14: 16,383,174 (GRCm38) L54P probably damaging Het
Trim62 A T 4: 128,796,343 (GRCm39) Y280F probably benign Het
Tssk4 A T 14: 55,889,016 (GRCm39) K181* probably null Het
Tssk4 A T 14: 55,889,017 (GRCm39) K181M probably damaging Het
Ubn1 A G 16: 4,882,478 (GRCm39) D313G probably damaging Het
Ugt1a10 C T 1: 88,142,845 (GRCm39) P113L probably damaging Het
Ugt1a10 C T 1: 88,145,971 (GRCm39) P473L probably damaging Het
Other mutations in Psmd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00772:Psmd1 APN 1 86,017,920 (GRCm39) splice site probably benign
IGL02410:Psmd1 APN 1 86,005,159 (GRCm39) missense probably damaging 0.97
IGL02455:Psmd1 APN 1 86,006,302 (GRCm39) missense probably damaging 0.97
IGL03015:Psmd1 APN 1 86,055,914 (GRCm39) missense probably damaging 0.97
IGL03100:Psmd1 APN 1 86,046,243 (GRCm39) missense possibly damaging 0.68
Neutralized UTSW 1 86,012,914 (GRCm39) missense probably damaging 0.98
Rickety UTSW 1 85,998,350 (GRCm39) critical splice donor site probably null
PIT4480001:Psmd1 UTSW 1 86,055,960 (GRCm39) missense probably damaging 0.99
R0027:Psmd1 UTSW 1 86,021,987 (GRCm39) splice site probably benign
R0115:Psmd1 UTSW 1 86,010,993 (GRCm39) missense possibly damaging 0.89
R0206:Psmd1 UTSW 1 86,061,463 (GRCm39) missense possibly damaging 0.94
R0208:Psmd1 UTSW 1 86,061,463 (GRCm39) missense possibly damaging 0.94
R0255:Psmd1 UTSW 1 86,006,304 (GRCm39) missense probably damaging 1.00
R0486:Psmd1 UTSW 1 86,022,012 (GRCm39) missense probably damaging 0.99
R0675:Psmd1 UTSW 1 86,009,761 (GRCm39) missense probably benign 0.03
R0790:Psmd1 UTSW 1 86,005,172 (GRCm39) missense possibly damaging 0.94
R1565:Psmd1 UTSW 1 86,019,719 (GRCm39) splice site probably benign
R1721:Psmd1 UTSW 1 85,999,567 (GRCm39) missense probably damaging 0.99
R2010:Psmd1 UTSW 1 86,003,719 (GRCm39) missense probably damaging 0.96
R2098:Psmd1 UTSW 1 86,009,823 (GRCm39) splice site probably null
R2118:Psmd1 UTSW 1 86,006,422 (GRCm39) missense possibly damaging 0.94
R2119:Psmd1 UTSW 1 86,006,422 (GRCm39) missense possibly damaging 0.94
R2120:Psmd1 UTSW 1 86,006,422 (GRCm39) missense possibly damaging 0.94
R2122:Psmd1 UTSW 1 86,006,422 (GRCm39) missense possibly damaging 0.94
R2504:Psmd1 UTSW 1 86,017,719 (GRCm39) missense possibly damaging 0.91
R3810:Psmd1 UTSW 1 86,060,437 (GRCm39) missense probably damaging 0.99
R3811:Psmd1 UTSW 1 86,060,437 (GRCm39) missense probably damaging 0.99
R3978:Psmd1 UTSW 1 86,055,909 (GRCm39) missense probably benign 0.05
R4131:Psmd1 UTSW 1 86,006,422 (GRCm39) missense probably damaging 0.98
R4360:Psmd1 UTSW 1 86,061,459 (GRCm39) missense probably damaging 0.97
R4386:Psmd1 UTSW 1 86,055,914 (GRCm39) missense possibly damaging 0.93
R4402:Psmd1 UTSW 1 86,003,673 (GRCm39) missense possibly damaging 0.59
R4591:Psmd1 UTSW 1 86,055,926 (GRCm39) missense probably benign 0.05
R4783:Psmd1 UTSW 1 86,006,434 (GRCm39) missense probably damaging 0.97
R4824:Psmd1 UTSW 1 86,064,820 (GRCm39) missense probably benign 0.08
R4937:Psmd1 UTSW 1 86,010,947 (GRCm39) missense probably damaging 0.98
R5443:Psmd1 UTSW 1 86,017,905 (GRCm39) missense probably damaging 0.99
R5486:Psmd1 UTSW 1 86,064,772 (GRCm39) missense possibly damaging 0.59
R5979:Psmd1 UTSW 1 86,017,775 (GRCm39) missense possibly damaging 0.92
R6033:Psmd1 UTSW 1 86,064,817 (GRCm39) missense probably damaging 1.00
R6425:Psmd1 UTSW 1 85,998,350 (GRCm39) critical splice donor site probably null
R7467:Psmd1 UTSW 1 86,044,355 (GRCm39) missense probably damaging 0.99
R8257:Psmd1 UTSW 1 86,006,345 (GRCm39) missense probably damaging 0.99
R8390:Psmd1 UTSW 1 86,006,329 (GRCm39) missense possibly damaging 0.59
R8750:Psmd1 UTSW 1 86,016,585 (GRCm39) missense probably damaging 0.99
R8890:Psmd1 UTSW 1 86,012,914 (GRCm39) missense probably damaging 0.98
R9017:Psmd1 UTSW 1 86,054,231 (GRCm39) missense probably damaging 0.99
R9142:Psmd1 UTSW 1 86,064,817 (GRCm39) missense probably damaging 1.00
R9330:Psmd1 UTSW 1 86,061,490 (GRCm39) missense probably damaging 1.00
R9799:Psmd1 UTSW 1 86,054,236 (GRCm39) missense possibly damaging 0.77
Z1177:Psmd1 UTSW 1 86,010,890 (GRCm39) missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- TGCAGCCATCTCAACCTCAGTTAAAG -3'
(R):5'- TGCATCTATGTAAAAGCACACAGGGAG -3'

Sequencing Primer
(F):5'- AACGACCCTGTGAACTACGT -3'
(R):5'- agaaagaaaggaaggaagaaagaag -3'
Posted On 2013-04-16