Incidental Mutation 'R2138:Abcc6'
ID 235961
Institutional Source Beutler Lab
Gene Symbol Abcc6
Ensembl Gene ENSMUSG00000030834
Gene Name ATP-binding cassette, sub-family C member 6
Synonyms DCC, Mrp6, Dyscalc1
MMRRC Submission 040141-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.822) question?
Stock # R2138 (G1)
Quality Score 195
Status Not validated
Chromosome 7
Chromosomal Location 45625804-45679915 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 45630475 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Leucine at position 1262 (F1262L)
Ref Sequence ENSEMBL: ENSMUSP00000002850 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002850]
AlphaFold Q9R1S7
Predicted Effect probably damaging
Transcript: ENSMUST00000002850
AA Change: F1262L

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000002850
Gene: ENSMUSG00000030834
AA Change: F1262L

DomainStartEndE-ValueType
transmembrane domain 44 61 N/A INTRINSIC
transmembrane domain 81 100 N/A INTRINSIC
transmembrane domain 110 129 N/A INTRINSIC
transmembrane domain 142 161 N/A INTRINSIC
transmembrane domain 171 193 N/A INTRINSIC
Pfam:ABC_membrane 309 580 3.5e-29 PFAM
AAA 653 828 1.19e-9 SMART
low complexity region 871 885 N/A INTRINSIC
Pfam:ABC_membrane 942 1211 2.5e-32 PFAM
AAA 1286 1473 1.71e-10 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209985
Predicted Effect probably benign
Transcript: ENSMUST00000211220
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: The protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the MRP subfamily which is involved in multi-drug resistance. The specific function of this protein is unknown; however, a similar rat protein has been identified as the major canalicular bile salt export pump of liver. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice display patchy mineralization which may include the capsule surrounding the sinuses of vibrissae, medium sized arteries, skin, retina, kidney, and interscapular brown fat. Strain differences at this locus may lead to altered susceptibility to cardiac calcinosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aamp A G 1: 74,323,122 (GRCm39) V6A probably benign Het
Acot13 A T 13: 25,002,188 (GRCm39) probably null Het
Adgrv1 T C 13: 81,593,439 (GRCm39) I4183V probably benign Het
Aff4 T G 11: 53,263,339 (GRCm39) S120A possibly damaging Het
Afp A G 5: 90,647,506 (GRCm39) E250G probably damaging Het
Ankrd34b A T 13: 92,575,914 (GRCm39) D382V probably damaging Het
Arhgef19 A T 4: 140,978,111 (GRCm39) I577F probably damaging Het
Arl6 A G 16: 59,442,830 (GRCm39) probably benign Het
Atp2b2 A T 6: 113,773,268 (GRCm39) M333K probably benign Het
Atp8b3 C A 10: 80,362,939 (GRCm39) A635S possibly damaging Het
Baiap2 A G 11: 119,847,928 (GRCm39) T19A possibly damaging Het
Bcar3 A G 3: 122,306,645 (GRCm39) D206G probably damaging Het
Ccdc162 A T 10: 41,457,293 (GRCm39) M85K probably benign Het
Clec4a4 A G 6: 123,000,937 (GRCm39) N217D probably damaging Het
Csmd1 T C 8: 15,979,088 (GRCm39) Y2832C probably damaging Het
Cubn A G 2: 13,449,189 (GRCm39) I962T probably damaging Het
Dennd4a A G 9: 64,796,619 (GRCm39) Y852C probably damaging Het
Dhcr24 G T 4: 106,429,499 (GRCm39) E191* probably null Het
Dusp12 G A 1: 170,708,166 (GRCm39) Q114* probably null Het
Elfn2 G T 15: 78,558,238 (GRCm39) T103K probably benign Het
Eme1 A T 11: 94,539,018 (GRCm39) V314E probably damaging Het
Epb41l3 A G 17: 69,514,875 (GRCm39) E4G probably damaging Het
Exoc6b A T 6: 84,966,464 (GRCm39) L170Q probably damaging Het
Fbln5 C T 12: 101,728,179 (GRCm39) M261I probably benign Het
Fgf22 T C 10: 79,592,435 (GRCm39) V64A probably damaging Het
Gak C T 5: 108,754,743 (GRCm39) probably null Het
Gatad2b T A 3: 90,259,420 (GRCm39) S401R probably damaging Het
Gen1 A T 12: 11,291,622 (GRCm39) S722R probably damaging Het
Gm10754 A T 10: 97,518,132 (GRCm39) probably benign Het
Grid2 G A 6: 64,322,782 (GRCm39) R594Q probably damaging Het
Grm7 C A 6: 110,623,098 (GRCm39) N90K probably damaging Het
Herc1 G A 9: 66,377,589 (GRCm39) V3452M possibly damaging Het
Il22ra2 T A 10: 19,508,618 (GRCm39) F215L probably benign Het
Kank1 G A 19: 25,389,117 (GRCm39) G930D probably benign Het
Klra3 A T 6: 130,310,121 (GRCm39) V133D probably benign Het
Lims2 A G 18: 32,088,460 (GRCm39) E220G possibly damaging Het
Mbd3l2 A T 9: 18,356,254 (GRCm39) D193V probably damaging Het
Mbl1 T A 14: 40,875,648 (GRCm39) I34K possibly damaging Het
Mgam C T 6: 40,733,384 (GRCm39) P839S probably damaging Het
Mmp9 G T 2: 164,794,387 (GRCm39) E460* probably null Het
Mov10 T C 3: 104,711,558 (GRCm39) H316R probably benign Het
Ms4a18 A T 19: 10,974,695 (GRCm39) V332D possibly damaging Het
Myo15b T C 11: 115,774,633 (GRCm39) S2082P probably benign Het
Myrfl G A 10: 116,631,443 (GRCm39) T706I probably benign Het
Nampt C A 12: 32,888,421 (GRCm39) H191N possibly damaging Het
Niban1 G A 1: 151,572,002 (GRCm39) V316M probably damaging Het
Nphp3 A G 9: 103,903,102 (GRCm39) E693G possibly damaging Het
Obscn A T 11: 58,894,491 (GRCm39) Y1191* probably null Het
Or10z1 A T 1: 174,078,302 (GRCm39) probably null Het
Or1r1 A T 11: 73,875,129 (GRCm39) Y102N probably damaging Het
Or7a40 A G 16: 16,491,069 (GRCm39) Y259H probably damaging Het
Osbpl10 A G 9: 115,061,202 (GRCm39) N760S probably benign Het
Otof A G 5: 30,619,114 (GRCm39) V10A probably benign Het
Pkhd1l1 A C 15: 44,364,853 (GRCm39) E664A probably damaging Het
Pnp2 T C 14: 51,201,161 (GRCm39) S178P probably damaging Het
Pvr G A 7: 19,650,927 (GRCm39) T199I probably damaging Het
Rbp3 C T 14: 33,677,975 (GRCm39) T641M probably damaging Het
Rnaseh2b T C 14: 62,598,794 (GRCm39) V173A probably benign Het
Septin12 C T 16: 4,810,070 (GRCm39) R155H probably damaging Het
Slco6d1 G T 1: 98,371,385 (GRCm39) R290L probably benign Het
Snx32 A G 19: 5,546,157 (GRCm39) V335A probably damaging Het
Son T C 16: 91,456,260 (GRCm39) V1669A possibly damaging Het
Speer1f A T 5: 11,469,052 (GRCm39) R68* probably null Het
Tbata C T 10: 61,015,063 (GRCm39) T116I probably benign Het
Tdrd1 T A 19: 56,831,021 (GRCm39) S279T probably benign Het
Thsd7a A T 6: 12,471,072 (GRCm39) Y515* probably null Het
Tmem102 T G 11: 69,695,940 (GRCm39) L40F probably damaging Het
Tmem169 A G 1: 72,340,155 (GRCm39) N195S probably damaging Het
Tmem201 A T 4: 149,802,537 (GRCm39) S613T probably damaging Het
Tnfaip6 A T 2: 51,942,344 (GRCm39) I218F possibly damaging Het
Tube1 C A 10: 39,023,347 (GRCm39) H331Q probably benign Het
Wwc1 G A 11: 35,732,714 (GRCm39) T998I possibly damaging Het
Xpc A T 6: 91,475,104 (GRCm39) Y638* probably null Het
Zdhhc4 A T 5: 143,310,017 (GRCm39) Y80* probably null Het
Other mutations in Abcc6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01589:Abcc6 APN 7 45,652,096 (GRCm39) splice site probably benign
IGL01731:Abcc6 APN 7 45,652,034 (GRCm39) missense possibly damaging 0.71
IGL01743:Abcc6 APN 7 45,646,238 (GRCm39) missense probably benign 0.02
IGL01757:Abcc6 APN 7 45,639,705 (GRCm39) splice site probably benign
IGL01895:Abcc6 APN 7 45,678,482 (GRCm39) missense possibly damaging 0.88
IGL01942:Abcc6 APN 7 45,635,997 (GRCm39) missense possibly damaging 0.89
IGL02251:Abcc6 APN 7 45,626,840 (GRCm39) missense probably damaging 1.00
IGL02277:Abcc6 APN 7 45,650,485 (GRCm39) missense probably benign 0.00
IGL02548:Abcc6 APN 7 45,654,686 (GRCm39) missense probably damaging 0.98
IGL03063:Abcc6 APN 7 45,665,856 (GRCm39) missense probably benign
IGL03092:Abcc6 APN 7 45,635,894 (GRCm39) missense probably damaging 1.00
IGL03251:Abcc6 APN 7 45,631,661 (GRCm39) unclassified probably benign
R0057:Abcc6 UTSW 7 45,669,567 (GRCm39) missense probably benign 0.03
R0944:Abcc6 UTSW 7 45,664,929 (GRCm39) missense possibly damaging 0.81
R1019:Abcc6 UTSW 7 45,663,531 (GRCm39) missense possibly damaging 0.77
R1183:Abcc6 UTSW 7 45,634,677 (GRCm39) missense probably damaging 0.99
R1543:Abcc6 UTSW 7 45,665,928 (GRCm39) missense probably benign 0.01
R1550:Abcc6 UTSW 7 45,654,668 (GRCm39) missense probably benign 0.25
R1725:Abcc6 UTSW 7 45,641,781 (GRCm39) missense possibly damaging 0.76
R1907:Abcc6 UTSW 7 45,663,593 (GRCm39) missense probably benign 0.04
R1908:Abcc6 UTSW 7 45,669,558 (GRCm39) splice site probably null
R1909:Abcc6 UTSW 7 45,669,558 (GRCm39) splice site probably null
R2145:Abcc6 UTSW 7 45,648,165 (GRCm39) missense probably benign 0.01
R2402:Abcc6 UTSW 7 45,664,999 (GRCm39) missense probably benign 0.04
R3983:Abcc6 UTSW 7 45,644,713 (GRCm39) missense probably benign
R4013:Abcc6 UTSW 7 45,668,104 (GRCm39) missense probably benign 0.01
R4051:Abcc6 UTSW 7 45,635,987 (GRCm39) missense probably damaging 1.00
R4052:Abcc6 UTSW 7 45,635,987 (GRCm39) missense probably damaging 1.00
R4208:Abcc6 UTSW 7 45,635,987 (GRCm39) missense probably damaging 1.00
R4362:Abcc6 UTSW 7 45,648,256 (GRCm39) splice site probably benign
R4385:Abcc6 UTSW 7 45,644,752 (GRCm39) missense possibly damaging 0.93
R4399:Abcc6 UTSW 7 45,652,031 (GRCm39) missense probably benign
R4479:Abcc6 UTSW 7 45,654,663 (GRCm39) missense possibly damaging 0.60
R4480:Abcc6 UTSW 7 45,654,663 (GRCm39) missense possibly damaging 0.60
R4780:Abcc6 UTSW 7 45,646,115 (GRCm39) missense probably benign
R4791:Abcc6 UTSW 7 45,631,584 (GRCm39) missense probably benign 0.00
R4895:Abcc6 UTSW 7 45,630,414 (GRCm39) missense possibly damaging 0.95
R4898:Abcc6 UTSW 7 45,639,111 (GRCm39) missense probably damaging 0.96
R4905:Abcc6 UTSW 7 45,644,649 (GRCm39) missense probably benign
R4941:Abcc6 UTSW 7 45,661,947 (GRCm39) missense probably benign 0.00
R5040:Abcc6 UTSW 7 45,669,578 (GRCm39) missense probably benign 0.04
R5128:Abcc6 UTSW 7 45,639,070 (GRCm39) missense probably benign 0.00
R5284:Abcc6 UTSW 7 45,630,483 (GRCm39) missense probably benign 0.05
R5328:Abcc6 UTSW 7 45,641,735 (GRCm39) missense probably benign 0.01
R5459:Abcc6 UTSW 7 45,631,607 (GRCm39) missense probably benign 0.00
R5543:Abcc6 UTSW 7 45,638,960 (GRCm39) critical splice donor site probably null
R6178:Abcc6 UTSW 7 45,678,468 (GRCm39) missense probably benign
R6228:Abcc6 UTSW 7 45,679,680 (GRCm39) missense probably benign 0.02
R6532:Abcc6 UTSW 7 45,626,803 (GRCm39) missense probably damaging 1.00
R6605:Abcc6 UTSW 7 45,630,481 (GRCm39) missense probably damaging 1.00
R7000:Abcc6 UTSW 7 45,654,946 (GRCm39) missense possibly damaging 0.60
R7067:Abcc6 UTSW 7 45,668,114 (GRCm39) missense probably benign
R7553:Abcc6 UTSW 7 45,648,545 (GRCm39) missense probably damaging 1.00
R7597:Abcc6 UTSW 7 45,644,661 (GRCm39) missense probably damaging 1.00
R7718:Abcc6 UTSW 7 45,626,816 (GRCm39) missense possibly damaging 0.91
R7781:Abcc6 UTSW 7 45,655,030 (GRCm39) missense probably damaging 1.00
R7798:Abcc6 UTSW 7 45,626,277 (GRCm39) nonsense probably null
R7896:Abcc6 UTSW 7 45,626,803 (GRCm39) missense probably damaging 1.00
R8098:Abcc6 UTSW 7 45,646,089 (GRCm39) missense probably damaging 1.00
R8443:Abcc6 UTSW 7 45,629,449 (GRCm39) missense probably damaging 1.00
R8773:Abcc6 UTSW 7 45,634,569 (GRCm39) missense probably benign
R8784:Abcc6 UTSW 7 45,652,025 (GRCm39) missense probably benign
R8802:Abcc6 UTSW 7 45,658,283 (GRCm39) missense probably damaging 0.99
R8807:Abcc6 UTSW 7 45,648,431 (GRCm39) missense possibly damaging 0.67
R9006:Abcc6 UTSW 7 45,665,820 (GRCm39) missense probably benign 0.00
R9127:Abcc6 UTSW 7 45,629,184 (GRCm39) missense probably damaging 1.00
R9475:Abcc6 UTSW 7 45,665,892 (GRCm39) missense probably damaging 1.00
R9480:Abcc6 UTSW 7 45,629,197 (GRCm39) missense probably damaging 1.00
R9535:Abcc6 UTSW 7 45,626,687 (GRCm39) missense probably damaging 1.00
R9642:Abcc6 UTSW 7 45,639,765 (GRCm39) missense probably benign 0.07
R9715:Abcc6 UTSW 7 45,629,359 (GRCm39) missense probably damaging 1.00
R9731:Abcc6 UTSW 7 45,669,660 (GRCm39) nonsense probably null
X0065:Abcc6 UTSW 7 45,669,621 (GRCm39) missense probably damaging 0.99
Z1176:Abcc6 UTSW 7 45,641,730 (GRCm39) critical splice donor site probably null
Z1176:Abcc6 UTSW 7 45,629,158 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTCATACAGGGAGATCAAGGG -3'
(R):5'- TCCAAATGGAAGGTGTATCAGG -3'

Sequencing Primer
(F):5'- ACCCCTAGAGGCAGATCAGG -3'
(R):5'- ATCAGGAAGCTGAGGTTCTGG -3'
Posted On 2014-10-01