Incidental Mutation 'R2138:Tbata'
ID235973
Institutional Source Beutler Lab
Gene Symbol Tbata
Ensembl Gene ENSMUSG00000020096
Gene Namethymus, brain and testes associated
SynonymsSpatial, 1700021K02Rik
MMRRC Submission 040141-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.098) question?
Stock #R2138 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location61171954-61188841 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 61179284 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 116 (T116I)
Ref Sequence ENSEMBL: ENSMUSP00000078227 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035894] [ENSMUST00000079235] [ENSMUST00000121297] [ENSMUST00000122261] [ENSMUST00000126831] [ENSMUST00000131879] [ENSMUST00000140456] [ENSMUST00000143207] [ENSMUST00000148181] [ENSMUST00000151886]
Predicted Effect probably benign
Transcript: ENSMUST00000035894
AA Change: T111I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000036422
Gene: ENSMUSG00000020096
AA Change: T111I

DomainStartEndE-ValueType
low complexity region 58 70 N/A INTRINSIC
low complexity region 73 87 N/A INTRINSIC
Pfam:SPATIAL 123 316 2.8e-64 PFAM
low complexity region 335 346 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000079235
AA Change: T116I

PolyPhen 2 Score 0.399 (Sensitivity: 0.89; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000078227
Gene: ENSMUSG00000020096
AA Change: T116I

DomainStartEndE-ValueType
low complexity region 63 75 N/A INTRINSIC
low complexity region 78 92 N/A INTRINSIC
Pfam:SPATIAL 128 230 2.4e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000121297
SMART Domains Protein: ENSMUSP00000113253
Gene: ENSMUSG00000020096

DomainStartEndE-ValueType
low complexity region 58 70 N/A INTRINSIC
Pfam:SPATIAL 82 191 2.2e-34 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000122261
SMART Domains Protein: ENSMUSP00000113902
Gene: ENSMUSG00000020096

DomainStartEndE-ValueType
low complexity region 58 70 N/A INTRINSIC
Pfam:SPATIAL 82 282 6.7e-76 PFAM
low complexity region 301 312 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000126831
SMART Domains Protein: ENSMUSP00000119957
Gene: ENSMUSG00000020096

DomainStartEndE-ValueType
Pfam:SPATIAL 1 155 1.9e-45 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000131879
SMART Domains Protein: ENSMUSP00000118942
Gene: ENSMUSG00000020096

DomainStartEndE-ValueType
low complexity region 58 70 N/A INTRINSIC
low complexity region 73 87 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000140456
Predicted Effect probably benign
Transcript: ENSMUST00000143207
Predicted Effect probably benign
Transcript: ENSMUST00000148181
Predicted Effect probably benign
Transcript: ENSMUST00000151886
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a putative transcription factor that is highly expressed in thymic cortical stromal cells, and may be involved in T-cell development. Its expression is developmentally regulated in the testis, where it is restricted to the haploid round spermatids during spermatogenesis, and thus this gene may also have a role in the control of male germ cell development. Alternative splicing of this gene results in two sets of transcript variants: the variants containing 5 additional exons at the 3' end encode long isoforms that are highly expressed in the testis, while the variants lacking the 3' end exons encode short isoforms that are highly expressed in the thymus. Most of the transcripts encoding the short isoforms have been shown to initiate translation from non-AUG (CUG) start sites. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased thymic pithelial cells and total thymocyte numbers without altering T cell development and function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aamp A G 1: 74,283,963 V6A probably benign Het
Abcc6 A G 7: 45,981,051 F1262L probably damaging Het
Acot13 A T 13: 24,818,205 probably null Het
Adgrv1 T C 13: 81,445,320 I4183V probably benign Het
Aff4 T G 11: 53,372,512 S120A possibly damaging Het
Afp A G 5: 90,499,647 E250G probably damaging Het
Ankrd34b A T 13: 92,439,406 D382V probably damaging Het
Arhgef19 A T 4: 141,250,800 I577F probably damaging Het
Arl6 A G 16: 59,622,467 probably benign Het
Atp2b2 A T 6: 113,796,307 M333K probably benign Het
Atp8b3 C A 10: 80,527,105 A635S possibly damaging Het
Baiap2 A G 11: 119,957,102 T19A possibly damaging Het
Bcar3 A G 3: 122,512,996 D206G probably damaging Het
Ccdc162 A T 10: 41,581,297 M85K probably benign Het
Clec4a4 A G 6: 123,023,978 N217D probably damaging Het
Csmd1 T C 8: 15,929,088 Y2832C probably damaging Het
Cubn A G 2: 13,444,378 I962T probably damaging Het
Dennd4a A G 9: 64,889,337 Y852C probably damaging Het
Dhcr24 G T 4: 106,572,302 E191* probably null Het
Dusp12 G A 1: 170,880,597 Q114* probably null Het
Elfn2 G T 15: 78,674,038 T103K probably benign Het
Eme1 A T 11: 94,648,192 V314E probably damaging Het
Epb41l3 A G 17: 69,207,880 E4G probably damaging Het
Exoc6b A T 6: 84,989,482 L170Q probably damaging Het
Fam129a G A 1: 151,696,251 V316M probably damaging Het
Fbln5 C T 12: 101,761,920 M261I probably benign Het
Fgf22 T C 10: 79,756,601 V64A probably damaging Het
Gak C T 5: 108,606,877 probably null Het
Gatad2b T A 3: 90,352,113 S401R probably damaging Het
Gen1 A T 12: 11,241,621 S722R probably damaging Het
Gm10754 A T 10: 97,682,270 probably benign Het
Gm8897 A T 5: 11,419,085 R68* probably null Het
Grid2 G A 6: 64,345,798 R594Q probably damaging Het
Grm7 C A 6: 110,646,137 N90K probably damaging Het
Herc1 G A 9: 66,470,307 V3452M possibly damaging Het
Il22ra2 T A 10: 19,632,870 F215L probably benign Het
Kank1 G A 19: 25,411,753 G930D probably benign Het
Klra3 A T 6: 130,333,158 V133D probably benign Het
Lims2 A G 18: 31,955,407 E220G possibly damaging Het
Mbd3l2 A T 9: 18,444,958 D193V probably damaging Het
Mbl1 T A 14: 41,153,691 I34K possibly damaging Het
Mgam C T 6: 40,756,450 P839S probably damaging Het
Mmp9 G T 2: 164,952,467 E460* probably null Het
Mov10 T C 3: 104,804,242 H316R probably benign Het
Ms4a18 A T 19: 10,997,331 V332D possibly damaging Het
Myo15b T C 11: 115,883,807 S2082P probably benign Het
Myrfl G A 10: 116,795,538 T706I probably benign Het
Nampt C A 12: 32,838,422 H191N possibly damaging Het
Nphp3 A G 9: 104,025,903 E693G possibly damaging Het
Obscn A T 11: 59,003,665 Y1191* probably null Het
Olfr19 A G 16: 16,673,205 Y259H probably damaging Het
Olfr398 A T 11: 73,984,303 Y102N probably damaging Het
Olfr419 A T 1: 174,250,736 probably null Het
Osbpl10 A G 9: 115,232,134 N760S probably benign Het
Otof A G 5: 30,461,770 V10A probably benign Het
Pkhd1l1 A C 15: 44,501,457 E664A probably damaging Het
Pnp2 T C 14: 50,963,704 S178P probably damaging Het
Pvr G A 7: 19,917,002 T199I probably damaging Het
Rbp3 C T 14: 33,956,018 T641M probably damaging Het
Rnaseh2b T C 14: 62,361,345 V173A probably benign Het
Sept12 C T 16: 4,992,206 R155H probably damaging Het
Slco6d1 G T 1: 98,443,660 R290L probably benign Het
Snx32 A G 19: 5,496,129 V335A probably damaging Het
Son T C 16: 91,659,372 V1669A possibly damaging Het
Tdrd1 T A 19: 56,842,589 S279T probably benign Het
Thsd7a A T 6: 12,471,073 Y515* probably null Het
Tmem102 T G 11: 69,805,114 L40F probably damaging Het
Tmem169 A G 1: 72,300,996 N195S probably damaging Het
Tmem201 A T 4: 149,718,080 S613T probably damaging Het
Tnfaip6 A T 2: 52,052,332 I218F possibly damaging Het
Tube1 C A 10: 39,147,351 H331Q probably benign Het
Wwc1 G A 11: 35,841,887 T998I possibly damaging Het
Xpc A T 6: 91,498,122 Y638* probably null Het
Zdhhc4 A T 5: 143,324,262 Y80* probably null Het
Other mutations in Tbata
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01569:Tbata APN 10 61175960 nonsense probably null
IGL02311:Tbata APN 10 61179455 nonsense probably null
R0417:Tbata UTSW 10 61180339 missense probably damaging 1.00
R1537:Tbata UTSW 10 61183491 splice site probably null
R1956:Tbata UTSW 10 61183477 missense probably damaging 0.99
R1959:Tbata UTSW 10 61175844 missense possibly damaging 0.86
R4835:Tbata UTSW 10 61183353 missense probably damaging 1.00
R6261:Tbata UTSW 10 61175865 missense possibly damaging 0.92
R6667:Tbata UTSW 10 61185363 missense probably damaging 1.00
R7355:Tbata UTSW 10 61174320 unclassified probably benign
X0066:Tbata UTSW 10 61188605 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGCTTGACTGTCTTGCCTC -3'
(R):5'- GTGTGGCCAAAGTACTCACC -3'

Sequencing Primer
(F):5'- CTGTGTGCCAAACTCACTGGTG -3'
(R):5'- ATTGGACTGTGGATCCCCAATG -3'
Posted On2014-10-01