Incidental Mutation 'R2138:Nampt'
ID235989
Institutional Source Beutler Lab
Gene Symbol Nampt
Ensembl Gene ENSMUSG00000020572
Gene Namenicotinamide phosphoribosyltransferase
SynonymsPbef1, 1110035O14Rik, Visfatin
MMRRC Submission 040141-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2138 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location32819545-32853349 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 32838422 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Asparagine at position 191 (H191N)
Ref Sequence ENSEMBL: ENSMUSP00000020886 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020886] [ENSMUST00000220200]
PDB Structure Crystal Structure of Murine NMPRTase [X-RAY DIFFRACTION]
Crystal Structure of Mouse Nicotinamide Phosphoribosyltransferase/Visfatin/Pre-B Cell Colony Enhancing Factor 1 [X-RAY DIFFRACTION]
Crystal Structure of Mouse Nicotinamide Phosphoribosyltransferase/Visfatin/Pre-B Cell Colony Enhancing Factor in Complex with Nicotinamide Mononuleotide [X-RAY DIFFRACTION]
Predicted Effect possibly damaging
Transcript: ENSMUST00000020886
AA Change: H191N

PolyPhen 2 Score 0.459 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000020886
Gene: ENSMUSG00000020572
AA Change: H191N

DomainStartEndE-ValueType
Pfam:NAPRTase 188 466 1.6e-73 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218491
Predicted Effect probably benign
Transcript: ENSMUST00000220200
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that catalyzes the condensation of nicotinamide with 5-phosphoribosyl-1-pyrophosphate to yield nicotinamide mononucleotide, one step in the biosynthesis of nicotinamide adenine dinucleotide. The protein belongs to the nicotinic acid phosphoribosyltransferase (NAPRTase) family and is thought to be involved in many important biological processes, including metabolism, stress response and aging. This gene has a pseudogene on chromosome 10. [provided by RefSeq, Feb 2011]
PHENOTYPE: Mice homozygous for a null allele exhibit embryonic lethality prior to E10.5. Mice heterozygous for a null allele exhibit increased fasted glucose in male mice and impaired glucose tolerance and decresed glucose-stimulated insulin secretion in female mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aamp A G 1: 74,283,963 V6A probably benign Het
Abcc6 A G 7: 45,981,051 F1262L probably damaging Het
Acot13 A T 13: 24,818,205 probably null Het
Adgrv1 T C 13: 81,445,320 I4183V probably benign Het
Aff4 T G 11: 53,372,512 S120A possibly damaging Het
Afp A G 5: 90,499,647 E250G probably damaging Het
Ankrd34b A T 13: 92,439,406 D382V probably damaging Het
Arhgef19 A T 4: 141,250,800 I577F probably damaging Het
Arl6 A G 16: 59,622,467 probably benign Het
Atp2b2 A T 6: 113,796,307 M333K probably benign Het
Atp8b3 C A 10: 80,527,105 A635S possibly damaging Het
Baiap2 A G 11: 119,957,102 T19A possibly damaging Het
Bcar3 A G 3: 122,512,996 D206G probably damaging Het
Ccdc162 A T 10: 41,581,297 M85K probably benign Het
Clec4a4 A G 6: 123,023,978 N217D probably damaging Het
Csmd1 T C 8: 15,929,088 Y2832C probably damaging Het
Cubn A G 2: 13,444,378 I962T probably damaging Het
Dennd4a A G 9: 64,889,337 Y852C probably damaging Het
Dhcr24 G T 4: 106,572,302 E191* probably null Het
Dusp12 G A 1: 170,880,597 Q114* probably null Het
Elfn2 G T 15: 78,674,038 T103K probably benign Het
Eme1 A T 11: 94,648,192 V314E probably damaging Het
Epb41l3 A G 17: 69,207,880 E4G probably damaging Het
Exoc6b A T 6: 84,989,482 L170Q probably damaging Het
Fam129a G A 1: 151,696,251 V316M probably damaging Het
Fbln5 C T 12: 101,761,920 M261I probably benign Het
Fgf22 T C 10: 79,756,601 V64A probably damaging Het
Gak C T 5: 108,606,877 probably null Het
Gatad2b T A 3: 90,352,113 S401R probably damaging Het
Gen1 A T 12: 11,241,621 S722R probably damaging Het
Gm10754 A T 10: 97,682,270 probably benign Het
Gm8897 A T 5: 11,419,085 R68* probably null Het
Grid2 G A 6: 64,345,798 R594Q probably damaging Het
Grm7 C A 6: 110,646,137 N90K probably damaging Het
Herc1 G A 9: 66,470,307 V3452M possibly damaging Het
Il22ra2 T A 10: 19,632,870 F215L probably benign Het
Kank1 G A 19: 25,411,753 G930D probably benign Het
Klra3 A T 6: 130,333,158 V133D probably benign Het
Lims2 A G 18: 31,955,407 E220G possibly damaging Het
Mbd3l2 A T 9: 18,444,958 D193V probably damaging Het
Mbl1 T A 14: 41,153,691 I34K possibly damaging Het
Mgam C T 6: 40,756,450 P839S probably damaging Het
Mmp9 G T 2: 164,952,467 E460* probably null Het
Mov10 T C 3: 104,804,242 H316R probably benign Het
Ms4a18 A T 19: 10,997,331 V332D possibly damaging Het
Myo15b T C 11: 115,883,807 S2082P probably benign Het
Myrfl G A 10: 116,795,538 T706I probably benign Het
Nphp3 A G 9: 104,025,903 E693G possibly damaging Het
Obscn A T 11: 59,003,665 Y1191* probably null Het
Olfr19 A G 16: 16,673,205 Y259H probably damaging Het
Olfr398 A T 11: 73,984,303 Y102N probably damaging Het
Olfr419 A T 1: 174,250,736 probably null Het
Osbpl10 A G 9: 115,232,134 N760S probably benign Het
Otof A G 5: 30,461,770 V10A probably benign Het
Pkhd1l1 A C 15: 44,501,457 E664A probably damaging Het
Pnp2 T C 14: 50,963,704 S178P probably damaging Het
Pvr G A 7: 19,917,002 T199I probably damaging Het
Rbp3 C T 14: 33,956,018 T641M probably damaging Het
Rnaseh2b T C 14: 62,361,345 V173A probably benign Het
Sept12 C T 16: 4,992,206 R155H probably damaging Het
Slco6d1 G T 1: 98,443,660 R290L probably benign Het
Snx32 A G 19: 5,496,129 V335A probably damaging Het
Son T C 16: 91,659,372 V1669A possibly damaging Het
Tbata C T 10: 61,179,284 T116I probably benign Het
Tdrd1 T A 19: 56,842,589 S279T probably benign Het
Thsd7a A T 6: 12,471,073 Y515* probably null Het
Tmem102 T G 11: 69,805,114 L40F probably damaging Het
Tmem169 A G 1: 72,300,996 N195S probably damaging Het
Tmem201 A T 4: 149,718,080 S613T probably damaging Het
Tnfaip6 A T 2: 52,052,332 I218F possibly damaging Het
Tube1 C A 10: 39,147,351 H331Q probably benign Het
Wwc1 G A 11: 35,841,887 T998I possibly damaging Het
Xpc A T 6: 91,498,122 Y638* probably null Het
Zdhhc4 A T 5: 143,324,262 Y80* probably null Het
Other mutations in Nampt
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02437:Nampt APN 12 32830216 missense probably damaging 1.00
IGL02512:Nampt APN 12 32830269 missense possibly damaging 0.72
IGL03095:Nampt APN 12 32842686 missense possibly damaging 0.85
Nacht UTSW 12 32833038 missense probably damaging 1.00
R0020:Nampt UTSW 12 32841013 missense probably damaging 0.97
R0417:Nampt UTSW 12 32833101 missense probably benign 0.01
R1087:Nampt UTSW 12 32833043 missense possibly damaging 0.88
R1781:Nampt UTSW 12 32833038 missense probably damaging 1.00
R2137:Nampt UTSW 12 32830310 missense probably benign
R3699:Nampt UTSW 12 32848759 splice site probably benign
R3970:Nampt UTSW 12 32833096 missense probably benign 0.02
R4434:Nampt UTSW 12 32838363 missense probably damaging 1.00
R4785:Nampt UTSW 12 32848714 missense possibly damaging 0.95
R5046:Nampt UTSW 12 32833038 missense probably damaging 1.00
R5055:Nampt UTSW 12 32833121 missense possibly damaging 0.94
R5427:Nampt UTSW 12 32834915 missense probably benign 0.00
R6063:Nampt UTSW 12 32848659 missense probably damaging 1.00
R6136:Nampt UTSW 12 32830302 missense probably benign 0.24
R6995:Nampt UTSW 12 32848743 missense probably benign 0.24
R7569:Nampt UTSW 12 32850434 missense probably benign
R8801:Nampt UTSW 12 32838374 missense possibly damaging 0.62
R8802:Nampt UTSW 12 32850436 missense probably benign 0.15
Predicted Primers PCR Primer
(F):5'- ATGATTTCCCCAGAAGGAGC -3'
(R):5'- AATTCTGGTTGAGAGGCCTC -3'

Sequencing Primer
(F):5'- CCCAGAAGGAGCCCAGTATTTTATG -3'
(R):5'- CTCACTGCAGCGGTTTAGACAAG -3'
Posted On2014-10-01