Mutagenetix > Incidental Mutation

Incidental Mutation 'R2138:Rbp3'

235995

Institutional Source

Beutler Lab

Gene Symbol

Rbp3

Ensembl Gene

ENSMUSG00000041534

Gene Name

retinol binding protein 3, interstitial

Synonyms

Rbp-3, Irbp

MMRRC Submission

040141-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.114) question?

Stock #

R2138 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

33954003-33964216 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 33956018 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Methionine at position 641 (T641M)

Ref Sequence

ENSEMBL: ENSMUSP00000040249 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000035695]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000035695
AA Change: T641M

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000040249
Gene: ENSMUSG00000041534
AA Change: T641M

Domain	Start	End	E-Value	Type
signal peptide	1	17	N/A	INTRINSIC
TSPc	109	308	5.72e-69	SMART
TSPc	416	616	1.98e-63	SMART
TSPc	720	917	5.34e-69	SMART
TSPc	1019	1216	2.13e-68	SMART

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.4%
20x: 95.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Interphotoreceptor retinol-binding protein is a large glycoprotein known to bind retinoids and found primarily in the interphotoreceptor matrix of the retina between the retinal pigment epithelium and the photoreceptor cells. It is thought to transport retinoids between the retinal pigment epithelium and the photoreceptors, a critical role in the visual process.The human IRBP gene is approximately 9.5 kbp in length and consists of four exons separated by three introns. The introns are 1.6-1.9 kbp long. The gene is transcribed by photoreceptor and retinoblastoma cells into an approximately 4.3-kilobase mRNA that is translated and processed into a glycosylated protein of 135,000 Da. The amino acid sequence of human IRBP can be divided into four contiguous homology domains with 33-38% identity, suggesting a series of gene duplication events. In the gene, the boundaries of these domains are not defined by exon-intron junctions, as might have been expected. The first three homology domains and part of the fourth are all encoded by the first large exon, which is 3,180 base pairs long. The remainder of the fourth domain is encoded in the last three exons, which are 191, 143, and approximately 740 base pairs long, respectively. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene experience photoreceptor degeneration. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 74 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aamp	A	G	1: 74,283,963	V6A	probably benign	Het
Abcc6	A	G	7: 45,981,051	F1262L	probably damaging	Het
Acot13	A	T	13: 24,818,205		probably null	Het
Adgrv1	T	C	13: 81,445,320	I4183V	probably benign	Het
Aff4	T	G	11: 53,372,512	S120A	possibly damaging	Het
Afp	A	G	5: 90,499,647	E250G	probably damaging	Het
Ankrd34b	A	T	13: 92,439,406	D382V	probably damaging	Het
Arhgef19	A	T	4: 141,250,800	I577F	probably damaging	Het
Arl6	A	G	16: 59,622,467		probably benign	Het
Atp2b2	A	T	6: 113,796,307	M333K	probably benign	Het
Atp8b3	C	A	10: 80,527,105	A635S	possibly damaging	Het
Baiap2	A	G	11: 119,957,102	T19A	possibly damaging	Het
Bcar3	A	G	3: 122,512,996	D206G	probably damaging	Het
Ccdc162	A	T	10: 41,581,297	M85K	probably benign	Het
Clec4a4	A	G	6: 123,023,978	N217D	probably damaging	Het
Csmd1	T	C	8: 15,929,088	Y2832C	probably damaging	Het
Cubn	A	G	2: 13,444,378	I962T	probably damaging	Het
Dennd4a	A	G	9: 64,889,337	Y852C	probably damaging	Het
Dhcr24	G	T	4: 106,572,302	E191*	probably null	Het
Dusp12	G	A	1: 170,880,597	Q114*	probably null	Het
Elfn2	G	T	15: 78,674,038	T103K	probably benign	Het
Eme1	A	T	11: 94,648,192	V314E	probably damaging	Het
Epb41l3	A	G	17: 69,207,880	E4G	probably damaging	Het
Exoc6b	A	T	6: 84,989,482	L170Q	probably damaging	Het
Fam129a	G	A	1: 151,696,251	V316M	probably damaging	Het
Fbln5	C	T	12: 101,761,920	M261I	probably benign	Het
Fgf22	T	C	10: 79,756,601	V64A	probably damaging	Het
Gak	C	T	5: 108,606,877		probably null	Het
Gatad2b	T	A	3: 90,352,113	S401R	probably damaging	Het
Gen1	A	T	12: 11,241,621	S722R	probably damaging	Het
Gm10754	A	T	10: 97,682,270		probably benign	Het
Gm8897	A	T	5: 11,419,085	R68*	probably null	Het
Grid2	G	A	6: 64,345,798	R594Q	probably damaging	Het
Grm7	C	A	6: 110,646,137	N90K	probably damaging	Het
Herc1	G	A	9: 66,470,307	V3452M	possibly damaging	Het
Il22ra2	T	A	10: 19,632,870	F215L	probably benign	Het
Kank1	G	A	19: 25,411,753	G930D	probably benign	Het
Klra3	A	T	6: 130,333,158	V133D	probably benign	Het
Lims2	A	G	18: 31,955,407	E220G	possibly damaging	Het
Mbd3l2	A	T	9: 18,444,958	D193V	probably damaging	Het
Mbl1	T	A	14: 41,153,691	I34K	possibly damaging	Het
Mgam	C	T	6: 40,756,450	P839S	probably damaging	Het
Mmp9	G	T	2: 164,952,467	E460*	probably null	Het
Mov10	T	C	3: 104,804,242	H316R	probably benign	Het
Ms4a18	A	T	19: 10,997,331	V332D	possibly damaging	Het
Myo15b	T	C	11: 115,883,807	S2082P	probably benign	Het
Myrfl	G	A	10: 116,795,538	T706I	probably benign	Het
Nampt	C	A	12: 32,838,422	H191N	possibly damaging	Het
Nphp3	A	G	9: 104,025,903	E693G	possibly damaging	Het
Obscn	A	T	11: 59,003,665	Y1191*	probably null	Het
Olfr19	A	G	16: 16,673,205	Y259H	probably damaging	Het
Olfr398	A	T	11: 73,984,303	Y102N	probably damaging	Het
Olfr419	A	T	1: 174,250,736		probably null	Het
Osbpl10	A	G	9: 115,232,134	N760S	probably benign	Het
Otof	A	G	5: 30,461,770	V10A	probably benign	Het
Pkhd1l1	A	C	15: 44,501,457	E664A	probably damaging	Het
Pnp2	T	C	14: 50,963,704	S178P	probably damaging	Het
Pvr	G	A	7: 19,917,002	T199I	probably damaging	Het
Rnaseh2b	T	C	14: 62,361,345	V173A	probably benign	Het
Sept12	C	T	16: 4,992,206	R155H	probably damaging	Het
Slco6d1	G	T	1: 98,443,660	R290L	probably benign	Het
Snx32	A	G	19: 5,496,129	V335A	probably damaging	Het
Son	T	C	16: 91,659,372	V1669A	possibly damaging	Het
Tbata	C	T	10: 61,179,284	T116I	probably benign	Het
Tdrd1	T	A	19: 56,842,589	S279T	probably benign	Het
Thsd7a	A	T	6: 12,471,073	Y515*	probably null	Het
Tmem102	T	G	11: 69,805,114	L40F	probably damaging	Het
Tmem169	A	G	1: 72,300,996	N195S	probably damaging	Het
Tmem201	A	T	4: 149,718,080	S613T	probably damaging	Het
Tnfaip6	A	T	2: 52,052,332	I218F	possibly damaging	Het
Tube1	C	A	10: 39,147,351	H331Q	probably benign	Het
Wwc1	G	A	11: 35,841,887	T998I	possibly damaging	Het
Xpc	A	T	6: 91,498,122	Y638*	probably null	Het
Zdhhc4	A	T	5: 143,324,262	Y80*	probably null	Het

Other mutations in Rbp3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01364:Rbp3	APN	14	33954188	missense	possibly damaging	0.82
IGL01643:Rbp3	APN	14	33956836	missense	probably benign	0.18
IGL01665:Rbp3	APN	14	33956131	missense	probably benign	0.02
IGL01809:Rbp3	APN	14	33955300	missense	probably damaging	1.00
IGL01975:Rbp3	APN	14	33958645	missense	probably damaging	1.00
IGL02349:Rbp3	APN	14	33955719	missense	probably damaging	0.97
IGL02447:Rbp3	APN	14	33954503	missense	probably damaging	1.00
IGL03192:Rbp3	APN	14	33958583	missense	possibly damaging	0.52
IGL03302:Rbp3	APN	14	33954659	missense	probably damaging	0.97
Behagt	UTSW	14	33954454	missense	probably benign	0.00
jagt	UTSW	14	33956482	missense	probably damaging	0.97
muntre	UTSW	14	33956356	missense	possibly damaging	0.95
Rotwild	UTSW	14	33956018	missense	probably damaging	1.00
P4717OSA:Rbp3	UTSW	14	33955499	missense	probably damaging	0.96
R0234:Rbp3	UTSW	14	33955901	missense	probably damaging	0.98
R0234:Rbp3	UTSW	14	33955901	missense	probably damaging	0.98
R0432:Rbp3	UTSW	14	33954773	missense	probably damaging	1.00
R0469:Rbp3	UTSW	14	33962419	missense	possibly damaging	0.95
R0652:Rbp3	UTSW	14	33958648	missense	possibly damaging	0.89
R0739:Rbp3	UTSW	14	33958647	missense	probably benign	0.28
R0747:Rbp3	UTSW	14	33956278	missense	possibly damaging	0.51
R0836:Rbp3	UTSW	14	33956638	missense	possibly damaging	0.84
R1102:Rbp3	UTSW	14	33956356	missense	possibly damaging	0.95
R1583:Rbp3	UTSW	14	33954524	missense	possibly damaging	0.45
R1589:Rbp3	UTSW	14	33955792	missense	probably damaging	0.99
R1595:Rbp3	UTSW	14	33956198	missense	possibly damaging	0.93
R1720:Rbp3	UTSW	14	33956909	missense	probably benign	0.38
R1830:Rbp3	UTSW	14	33954644	missense	probably benign	0.31
R1982:Rbp3	UTSW	14	33954545	missense	probably damaging	0.99
R1985:Rbp3	UTSW	14	33956018	missense	probably damaging	1.00
R1985:Rbp3	UTSW	14	33956461	missense	probably benign	0.00
R2007:Rbp3	UTSW	14	33956018	missense	probably damaging	1.00
R2027:Rbp3	UTSW	14	33956018	missense	probably damaging	1.00
R2100:Rbp3	UTSW	14	33956018	missense	probably damaging	1.00
R2101:Rbp3	UTSW	14	33956018	missense	probably damaging	1.00
R2113:Rbp3	UTSW	14	33956057	missense	probably benign	0.00
R2183:Rbp3	UTSW	14	33956018	missense	probably damaging	1.00
R2248:Rbp3	UTSW	14	33956018	missense	probably damaging	1.00
R2277:Rbp3	UTSW	14	33956018	missense	probably damaging	1.00
R2306:Rbp3	UTSW	14	33962563	missense	probably damaging	1.00
R2504:Rbp3	UTSW	14	33956018	missense	probably damaging	1.00
R2696:Rbp3	UTSW	14	33956018	missense	probably damaging	1.00
R2697:Rbp3	UTSW	14	33956018	missense	probably damaging	1.00
R2698:Rbp3	UTSW	14	33956018	missense	probably damaging	1.00
R2920:Rbp3	UTSW	14	33956018	missense	probably damaging	1.00
R2940:Rbp3	UTSW	14	33956018	missense	probably damaging	1.00
R2971:Rbp3	UTSW	14	33954454	missense	probably benign	0.00
R3111:Rbp3	UTSW	14	33954112	missense	probably benign	0.01
R3155:Rbp3	UTSW	14	33957114	missense	probably damaging	0.98
R3156:Rbp3	UTSW	14	33957114	missense	probably damaging	0.98
R3751:Rbp3	UTSW	14	33956012	missense	probably damaging	0.98
R3752:Rbp3	UTSW	14	33956012	missense	probably damaging	0.98
R3851:Rbp3	UTSW	14	33955507	missense	probably damaging	0.98
R4016:Rbp3	UTSW	14	33955390	missense	possibly damaging	0.82
R4276:Rbp3	UTSW	14	33958650	missense	probably benign	0.24
R4277:Rbp3	UTSW	14	33958650	missense	probably benign	0.24
R4278:Rbp3	UTSW	14	33958650	missense	probably benign	0.24
R4382:Rbp3	UTSW	14	33955296	missense	probably benign	0.12
R4383:Rbp3	UTSW	14	33955296	missense	probably benign	0.12
R4385:Rbp3	UTSW	14	33955296	missense	probably benign	0.12
R4625:Rbp3	UTSW	14	33956099	missense	probably benign
R4712:Rbp3	UTSW	14	33960658	missense	probably damaging	0.97
R4812:Rbp3	UTSW	14	33954774	missense	probably damaging	0.99
R4918:Rbp3	UTSW	14	33955411	missense	probably damaging	1.00
R4971:Rbp3	UTSW	14	33954470	missense	probably damaging	0.98
R5262:Rbp3	UTSW	14	33954850	missense	probably damaging	1.00
R5387:Rbp3	UTSW	14	33956413	missense	possibly damaging	0.95
R5468:Rbp3	UTSW	14	33956627	missense	possibly damaging	0.93
R5837:Rbp3	UTSW	14	33954273	missense	probably benign	0.00
R5994:Rbp3	UTSW	14	33954900	missense	probably damaging	1.00
R6010:Rbp3	UTSW	14	33954647	missense	probably damaging	1.00
R6041:Rbp3	UTSW	14	33956482	missense	probably damaging	0.97
R6266:Rbp3	UTSW	14	33954461	missense	probably benign
R6357:Rbp3	UTSW	14	33957034	missense	probably damaging	0.99
R6457:Rbp3	UTSW	14	33955267	nonsense	probably null
R6777:Rbp3	UTSW	14	33954273	missense	probably benign	0.00
R7158:Rbp3	UTSW	14	33955556	missense	probably benign	0.00
R7183:Rbp3	UTSW	14	33955204	missense	probably benign	0.02
R7256:Rbp3	UTSW	14	33962583	missense	possibly damaging	0.93
R7654:Rbp3	UTSW	14	33955840	missense	probably benign
R7756:Rbp3	UTSW	14	33954775	missense	probably benign	0.15
R7758:Rbp3	UTSW	14	33954775	missense	probably benign	0.15
R7784:Rbp3	UTSW	14	33954158	missense	probably benign	0.41
R7845:Rbp3	UTSW	14	33956464	missense	probably benign	0.24
R8176:Rbp3	UTSW	14	33955648	missense	possibly damaging	0.67
R8281:Rbp3	UTSW	14	33956363	missense	probably benign	0.00
R8393:Rbp3	UTSW	14	33956199	missense	possibly damaging	0.93
R8552:Rbp3	UTSW	14	33955664	missense	probably benign	0.01
R8717:Rbp3	UTSW	14	33956438	missense	probably damaging	0.99
R8730:Rbp3	UTSW	14	33955838	missense	probably benign
R8773:Rbp3	UTSW	14	33962535	missense	possibly damaging	0.71
R8836:Rbp3	UTSW	14	33958631	missense	possibly damaging	0.95
R8843:Rbp3	UTSW	14	33954565	missense	probably benign
R8880:Rbp3	UTSW	14	33956839	missense	probably benign	0.16
R8941:Rbp3	UTSW	14	33956529	missense	possibly damaging	0.92
R8971:Rbp3	UTSW	14	33955835	missense	probably damaging	1.00
R8998:Rbp3	UTSW	14	33962403	nonsense	probably null
R8999:Rbp3	UTSW	14	33962403	nonsense	probably null
R9436:Rbp3	UTSW	14	33955277	missense	possibly damaging	0.94
R9525:Rbp3	UTSW	14	33954445	missense	probably benign	0.00
R9563:Rbp3	UTSW	14	33955520	missense	probably damaging	1.00
R9564:Rbp3	UTSW	14	33955520	missense	probably damaging	1.00
Z1177:Rbp3	UTSW	14	33954538	missense	possibly damaging	0.58

Predicted Primers

PCR Primer
(F):5'- ACACTGGTCGGCGAAATCAC -3'
(R):5'- TCCCCAGGGCTATGGAATAC -3'

Sequencing Primer
(F):5'- AAATCACCGCGGGTAGC -3'
(R):5'- TGGAATACCAGCAGGCGGTG -3'

Posted On

2014-10-01