Incidental Mutation 'R2138:Rbp3'
ID235995
Institutional Source Beutler Lab
Gene Symbol Rbp3
Ensembl Gene ENSMUSG00000041534
Gene Nameretinol binding protein 3, interstitial
SynonymsRbp-3, Irbp
MMRRC Submission 040141-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.635) question?
Stock #R2138 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location33954003-33964216 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 33956018 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 641 (T641M)
Ref Sequence ENSEMBL: ENSMUSP00000040249 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035695]
Predicted Effect probably damaging
Transcript: ENSMUST00000035695
AA Change: T641M

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000040249
Gene: ENSMUSG00000041534
AA Change: T641M

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
TSPc 109 308 5.72e-69 SMART
TSPc 416 616 1.98e-63 SMART
TSPc 720 917 5.34e-69 SMART
TSPc 1019 1216 2.13e-68 SMART
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Interphotoreceptor retinol-binding protein is a large glycoprotein known to bind retinoids and found primarily in the interphotoreceptor matrix of the retina between the retinal pigment epithelium and the photoreceptor cells. It is thought to transport retinoids between the retinal pigment epithelium and the photoreceptors, a critical role in the visual process.The human IRBP gene is approximately 9.5 kbp in length and consists of four exons separated by three introns. The introns are 1.6-1.9 kbp long. The gene is transcribed by photoreceptor and retinoblastoma cells into an approximately 4.3-kilobase mRNA that is translated and processed into a glycosylated protein of 135,000 Da. The amino acid sequence of human IRBP can be divided into four contiguous homology domains with 33-38% identity, suggesting a series of gene duplication events. In the gene, the boundaries of these domains are not defined by exon-intron junctions, as might have been expected. The first three homology domains and part of the fourth are all encoded by the first large exon, which is 3,180 base pairs long. The remainder of the fourth domain is encoded in the last three exons, which are 191, 143, and approximately 740 base pairs long, respectively. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene experience photoreceptor degeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aamp A G 1: 74,283,963 V6A probably benign Het
Abcc6 A G 7: 45,981,051 F1262L probably damaging Het
Acot13 A T 13: 24,818,205 probably null Het
Adgrv1 T C 13: 81,445,320 I4183V probably benign Het
Aff4 T G 11: 53,372,512 S120A possibly damaging Het
Afp A G 5: 90,499,647 E250G probably damaging Het
Ankrd34b A T 13: 92,439,406 D382V probably damaging Het
Arhgef19 A T 4: 141,250,800 I577F probably damaging Het
Arl6 A G 16: 59,622,467 probably benign Het
Atp2b2 A T 6: 113,796,307 M333K probably benign Het
Atp8b3 C A 10: 80,527,105 A635S possibly damaging Het
Baiap2 A G 11: 119,957,102 T19A possibly damaging Het
Bcar3 A G 3: 122,512,996 D206G probably damaging Het
Ccdc162 A T 10: 41,581,297 M85K probably benign Het
Clec4a4 A G 6: 123,023,978 N217D probably damaging Het
Csmd1 T C 8: 15,929,088 Y2832C probably damaging Het
Cubn A G 2: 13,444,378 I962T probably damaging Het
Dennd4a A G 9: 64,889,337 Y852C probably damaging Het
Dhcr24 G T 4: 106,572,302 E191* probably null Het
Dusp12 G A 1: 170,880,597 Q114* probably null Het
Elfn2 G T 15: 78,674,038 T103K probably benign Het
Eme1 A T 11: 94,648,192 V314E probably damaging Het
Epb41l3 A G 17: 69,207,880 E4G probably damaging Het
Exoc6b A T 6: 84,989,482 L170Q probably damaging Het
Fam129a G A 1: 151,696,251 V316M probably damaging Het
Fbln5 C T 12: 101,761,920 M261I probably benign Het
Fgf22 T C 10: 79,756,601 V64A probably damaging Het
Gak C T 5: 108,606,877 probably null Het
Gatad2b T A 3: 90,352,113 S401R probably damaging Het
Gen1 A T 12: 11,241,621 S722R probably damaging Het
Gm10754 A T 10: 97,682,270 probably benign Het
Gm8897 A T 5: 11,419,085 R68* probably null Het
Grid2 G A 6: 64,345,798 R594Q probably damaging Het
Grm7 C A 6: 110,646,137 N90K probably damaging Het
Herc1 G A 9: 66,470,307 V3452M possibly damaging Het
Il22ra2 T A 10: 19,632,870 F215L probably benign Het
Kank1 G A 19: 25,411,753 G930D probably benign Het
Klra3 A T 6: 130,333,158 V133D probably benign Het
Lims2 A G 18: 31,955,407 E220G possibly damaging Het
Mbd3l2 A T 9: 18,444,958 D193V probably damaging Het
Mbl1 T A 14: 41,153,691 I34K possibly damaging Het
Mgam C T 6: 40,756,450 P839S probably damaging Het
Mmp9 G T 2: 164,952,467 E460* probably null Het
Mov10 T C 3: 104,804,242 H316R probably benign Het
Ms4a18 A T 19: 10,997,331 V332D possibly damaging Het
Myo15b T C 11: 115,883,807 S2082P probably benign Het
Myrfl G A 10: 116,795,538 T706I probably benign Het
Nampt C A 12: 32,838,422 H191N possibly damaging Het
Nphp3 A G 9: 104,025,903 E693G possibly damaging Het
Obscn A T 11: 59,003,665 Y1191* probably null Het
Olfr19 A G 16: 16,673,205 Y259H probably damaging Het
Olfr398 A T 11: 73,984,303 Y102N probably damaging Het
Olfr419 A T 1: 174,250,736 probably null Het
Osbpl10 A G 9: 115,232,134 N760S probably benign Het
Otof A G 5: 30,461,770 V10A probably benign Het
Pkhd1l1 A C 15: 44,501,457 E664A probably damaging Het
Pnp2 T C 14: 50,963,704 S178P probably damaging Het
Pvr G A 7: 19,917,002 T199I probably damaging Het
Rnaseh2b T C 14: 62,361,345 V173A probably benign Het
Sept12 C T 16: 4,992,206 R155H probably damaging Het
Slco6d1 G T 1: 98,443,660 R290L probably benign Het
Snx32 A G 19: 5,496,129 V335A probably damaging Het
Son T C 16: 91,659,372 V1669A possibly damaging Het
Tbata C T 10: 61,179,284 T116I probably benign Het
Tdrd1 T A 19: 56,842,589 S279T probably benign Het
Thsd7a A T 6: 12,471,073 Y515* probably null Het
Tmem102 T G 11: 69,805,114 L40F probably damaging Het
Tmem169 A G 1: 72,300,996 N195S probably damaging Het
Tmem201 A T 4: 149,718,080 S613T probably damaging Het
Tnfaip6 A T 2: 52,052,332 I218F possibly damaging Het
Tube1 C A 10: 39,147,351 H331Q probably benign Het
Wwc1 G A 11: 35,841,887 T998I possibly damaging Het
Xpc A T 6: 91,498,122 Y638* probably null Het
Zdhhc4 A T 5: 143,324,262 Y80* probably null Het
Other mutations in Rbp3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01364:Rbp3 APN 14 33954188 missense possibly damaging 0.82
IGL01643:Rbp3 APN 14 33956836 missense probably benign 0.18
IGL01665:Rbp3 APN 14 33956131 missense probably benign 0.02
IGL01809:Rbp3 APN 14 33955300 missense probably damaging 1.00
IGL01975:Rbp3 APN 14 33958645 missense probably damaging 1.00
IGL02349:Rbp3 APN 14 33955719 missense probably damaging 0.97
IGL02447:Rbp3 APN 14 33954503 missense probably damaging 1.00
IGL03192:Rbp3 APN 14 33958583 missense possibly damaging 0.52
IGL03302:Rbp3 APN 14 33954659 missense probably damaging 0.97
Behagt UTSW 14 33954454 missense probably benign 0.00
jagt UTSW 14 33956482 missense probably damaging 0.97
muntre UTSW 14 33956356 missense possibly damaging 0.95
Rotwild UTSW 14 33956018 missense probably damaging 1.00
P4717OSA:Rbp3 UTSW 14 33955499 missense probably damaging 0.96
R0234:Rbp3 UTSW 14 33955901 missense probably damaging 0.98
R0234:Rbp3 UTSW 14 33955901 missense probably damaging 0.98
R0432:Rbp3 UTSW 14 33954773 missense probably damaging 1.00
R0469:Rbp3 UTSW 14 33962419 missense possibly damaging 0.95
R0652:Rbp3 UTSW 14 33958648 missense possibly damaging 0.89
R0739:Rbp3 UTSW 14 33958647 missense probably benign 0.28
R0747:Rbp3 UTSW 14 33956278 missense possibly damaging 0.51
R0836:Rbp3 UTSW 14 33956638 missense possibly damaging 0.84
R1102:Rbp3 UTSW 14 33956356 missense possibly damaging 0.95
R1583:Rbp3 UTSW 14 33954524 missense possibly damaging 0.45
R1589:Rbp3 UTSW 14 33955792 missense probably damaging 0.99
R1595:Rbp3 UTSW 14 33956198 missense possibly damaging 0.93
R1720:Rbp3 UTSW 14 33956909 missense probably benign 0.38
R1830:Rbp3 UTSW 14 33954644 missense probably benign 0.31
R1982:Rbp3 UTSW 14 33954545 missense probably damaging 0.99
R1985:Rbp3 UTSW 14 33956018 missense probably damaging 1.00
R1985:Rbp3 UTSW 14 33956461 missense probably benign 0.00
R2007:Rbp3 UTSW 14 33956018 missense probably damaging 1.00
R2027:Rbp3 UTSW 14 33956018 missense probably damaging 1.00
R2100:Rbp3 UTSW 14 33956018 missense probably damaging 1.00
R2101:Rbp3 UTSW 14 33956018 missense probably damaging 1.00
R2113:Rbp3 UTSW 14 33956057 missense probably benign 0.00
R2183:Rbp3 UTSW 14 33956018 missense probably damaging 1.00
R2248:Rbp3 UTSW 14 33956018 missense probably damaging 1.00
R2277:Rbp3 UTSW 14 33956018 missense probably damaging 1.00
R2306:Rbp3 UTSW 14 33962563 missense probably damaging 1.00
R2504:Rbp3 UTSW 14 33956018 missense probably damaging 1.00
R2696:Rbp3 UTSW 14 33956018 missense probably damaging 1.00
R2697:Rbp3 UTSW 14 33956018 missense probably damaging 1.00
R2698:Rbp3 UTSW 14 33956018 missense probably damaging 1.00
R2920:Rbp3 UTSW 14 33956018 missense probably damaging 1.00
R2940:Rbp3 UTSW 14 33956018 missense probably damaging 1.00
R2971:Rbp3 UTSW 14 33954454 missense probably benign 0.00
R3111:Rbp3 UTSW 14 33954112 missense probably benign 0.01
R3155:Rbp3 UTSW 14 33957114 missense probably damaging 0.98
R3156:Rbp3 UTSW 14 33957114 missense probably damaging 0.98
R3751:Rbp3 UTSW 14 33956012 missense probably damaging 0.98
R3752:Rbp3 UTSW 14 33956012 missense probably damaging 0.98
R3851:Rbp3 UTSW 14 33955507 missense probably damaging 0.98
R4016:Rbp3 UTSW 14 33955390 missense possibly damaging 0.82
R4276:Rbp3 UTSW 14 33958650 missense probably benign 0.24
R4277:Rbp3 UTSW 14 33958650 missense probably benign 0.24
R4278:Rbp3 UTSW 14 33958650 missense probably benign 0.24
R4382:Rbp3 UTSW 14 33955296 missense probably benign 0.12
R4383:Rbp3 UTSW 14 33955296 missense probably benign 0.12
R4385:Rbp3 UTSW 14 33955296 missense probably benign 0.12
R4625:Rbp3 UTSW 14 33956099 missense probably benign
R4712:Rbp3 UTSW 14 33960658 missense probably damaging 0.97
R4812:Rbp3 UTSW 14 33954774 missense probably damaging 0.99
R4918:Rbp3 UTSW 14 33955411 missense probably damaging 1.00
R4971:Rbp3 UTSW 14 33954470 missense probably damaging 0.98
R5262:Rbp3 UTSW 14 33954850 missense probably damaging 1.00
R5387:Rbp3 UTSW 14 33956413 missense possibly damaging 0.95
R5468:Rbp3 UTSW 14 33956627 missense possibly damaging 0.93
R5837:Rbp3 UTSW 14 33954273 missense probably benign 0.00
R5994:Rbp3 UTSW 14 33954900 missense probably damaging 1.00
R6010:Rbp3 UTSW 14 33954647 missense probably damaging 1.00
R6041:Rbp3 UTSW 14 33956482 missense probably damaging 0.97
R6266:Rbp3 UTSW 14 33954461 missense probably benign
R6357:Rbp3 UTSW 14 33957034 missense probably damaging 0.99
R6457:Rbp3 UTSW 14 33955267 nonsense probably null
R6777:Rbp3 UTSW 14 33954273 missense probably benign 0.00
R7158:Rbp3 UTSW 14 33955556 missense probably benign 0.00
R7183:Rbp3 UTSW 14 33955204 missense probably benign 0.02
R7256:Rbp3 UTSW 14 33962583 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- ACACTGGTCGGCGAAATCAC -3'
(R):5'- TCCCCAGGGCTATGGAATAC -3'

Sequencing Primer
(F):5'- AAATCACCGCGGGTAGC -3'
(R):5'- TGGAATACCAGCAGGCGGTG -3'
Posted On2014-10-01