Incidental Mutation 'R2139:Erbb4'
ID 236015
Institutional Source Beutler Lab
Gene Symbol Erbb4
Ensembl Gene ENSMUSG00000062209
Gene Name erb-b2 receptor tyrosine kinase 4
Synonyms Her4, ErbB4
MMRRC Submission 040142-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R2139 (G1)
Quality Score 225
Status Not validated
Chromosome 1
Chromosomal Location 68071345-69147218 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 68385788 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 267 (V267A)
Ref Sequence ENSEMBL: ENSMUSP00000114123 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000119142] [ENSMUST00000121473] [ENSMUST00000153432]
AlphaFold Q61527
Predicted Effect probably damaging
Transcript: ENSMUST00000119142
AA Change: V267A

PolyPhen 2 Score 0.957 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000112713
Gene: ENSMUSG00000062209
AA Change: V267A

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:Recep_L_domain 55 167 5e-34 PFAM
FU 183 223 2.07e1 SMART
FU 226 268 5.78e-10 SMART
Pfam:Recep_L_domain 358 478 1e-29 PFAM
FU 493 544 6.45e-8 SMART
FU 549 599 3.51e-9 SMART
FU 611 659 2.32e0 SMART
TyrKc 718 974 7.53e-133 SMART
low complexity region 1007 1023 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000121473
AA Change: V267A

PolyPhen 2 Score 0.957 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000114123
Gene: ENSMUSG00000062209
AA Change: V267A

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:Recep_L_domain 55 167 1.6e-34 PFAM
FU 183 223 2.07e1 SMART
FU 226 268 5.78e-10 SMART
Pfam:Recep_L_domain 358 478 5.5e-29 PFAM
FU 493 544 6.45e-8 SMART
FU 549 599 3.51e-9 SMART
FU 611 659 2.32e0 SMART
TyrKc 718 974 7.53e-133 SMART
low complexity region 1007 1023 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000153432
AA Change: V267A

PolyPhen 2 Score 0.900 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000115373
Gene: ENSMUSG00000062209
AA Change: V267A

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:Recep_L_domain 55 167 1.7e-34 PFAM
FU 183 223 2.07e1 SMART
FU 226 268 5.78e-10 SMART
Pfam:Recep_L_domain 358 478 5.7e-29 PFAM
FU 493 544 6.45e-8 SMART
FU 549 599 3.51e-9 SMART
FU 611 649 2.98e0 SMART
PDB:2R4B|B 680 732 1e-25 PDB
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the Tyr protein kinase family and the epidermal growth factor receptor subfamily. It encodes a single-pass type I membrane protein with multiple cysteine rich domains, a transmembrane domain, a tyrosine kinase domain, a phosphotidylinositol-3 kinase binding site and a PDZ domain binding motif. The protein binds to and is activated by neuregulins and other factors and induces a variety of cellular responses including mitogenesis and differentiation. Multiple proteolytic events allow for the release of a cytoplasmic fragment and an extracellular fragment. Mutations in this gene have been associated with cancer. Alternatively spliced variants which encode different protein isoforms have been described; however, not all variants have been fully characterized. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit cardiac defects, alterations in hindbrain development, and midgestational lethality. Heterozygotes show schizophrenia-like behavior. Genetically rescued females show mammary defects. [provided by MGI curators]
Allele List at MGI

All alleles(7) : Targeted(6) Gene trapped(1)

Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931429L15Rik A T 9: 46,215,593 (GRCm39) F318I probably damaging Het
Bfsp2 T C 9: 103,327,074 (GRCm39) K221R probably benign Het
Cacna1b A C 2: 24,569,485 (GRCm39) M813R probably benign Het
Chaf1a T C 17: 56,372,226 (GRCm39) L798P probably damaging Het
Chd8 G A 14: 52,474,428 (GRCm39) T201I probably benign Het
Col23a1 T C 11: 51,464,861 (GRCm39) S436P probably benign Het
Cubn T C 2: 13,340,978 (GRCm39) I2248V probably benign Het
Cyp4f39 A G 17: 32,710,163 (GRCm39) I440M probably benign Het
Dhcr24 G T 4: 106,429,499 (GRCm39) E191* probably null Het
Dlg5 T C 14: 24,220,612 (GRCm39) D522G probably damaging Het
Dnaja4 A T 9: 54,616,506 (GRCm39) M170L probably benign Het
Dop1b T C 16: 93,567,895 (GRCm39) S1441P possibly damaging Het
Efcab3 C T 11: 104,642,737 (GRCm39) T1120I possibly damaging Het
Egr2 T A 10: 67,376,702 (GRCm39) S383T probably damaging Het
Elovl1 A G 4: 118,288,303 (GRCm39) D94G probably damaging Het
Esp38 T A 17: 40,264,275 (GRCm39) I11N probably damaging Het
Esrrb T C 12: 86,468,740 (GRCm39) probably null Het
Fbxo24 A T 5: 137,611,327 (GRCm39) S488T probably damaging Het
Fgfr1 T G 8: 26,060,882 (GRCm39) V618G probably damaging Het
Gak C T 5: 108,754,743 (GRCm39) probably null Het
Gpr61 A T 3: 108,058,077 (GRCm39) C195S probably damaging Het
Greb1l A C 18: 10,555,011 (GRCm39) N1686H probably damaging Het
Hapln4 T C 8: 70,540,788 (GRCm39) F274L probably benign Het
Hoxc10 A T 15: 102,875,912 (GRCm39) Q207L probably benign Het
Hspa12a A G 19: 58,787,914 (GRCm39) V636A probably benign Het
Il22ra2 T A 10: 19,508,618 (GRCm39) F215L probably benign Het
Il36b A G 2: 24,044,672 (GRCm39) N24S probably benign Het
Kank1 G A 19: 25,389,117 (GRCm39) G930D probably benign Het
Kif13a T C 13: 46,905,945 (GRCm39) D666G possibly damaging Het
Krt86 A T 15: 101,371,639 (GRCm39) I70F probably benign Het
Lgi4 A T 7: 30,762,548 (GRCm39) I112F probably damaging Het
Lrrc8c T G 5: 105,754,558 (GRCm39) I111S probably damaging Het
Ltbp2 T C 12: 84,862,753 (GRCm39) N600S probably damaging Het
Mbd3l2 A T 9: 18,356,254 (GRCm39) D193V probably damaging Het
Mroh5 T A 15: 73,661,940 (GRCm39) D417V probably damaging Het
Ms4a18 A T 19: 10,974,695 (GRCm39) V332D possibly damaging Het
Mtarc1 G A 1: 184,527,632 (GRCm39) T276I probably benign Het
Muc4 T A 16: 32,581,599 (GRCm39) I2488N unknown Het
Myrf C G 19: 10,193,831 (GRCm39) A532P probably damaging Het
Nav3 T C 10: 109,688,996 (GRCm39) N427S probably benign Het
Neb T C 2: 52,102,600 (GRCm39) S4315G probably damaging Het
Nyap2 A G 1: 81,218,983 (GRCm39) D335G probably damaging Het
Olfm4 T C 14: 80,251,755 (GRCm39) L225P probably benign Het
Or10z1 A T 1: 174,078,302 (GRCm39) probably null Het
Or4c104 T A 2: 88,586,437 (GRCm39) N194I probably damaging Het
Or51ac3 A T 7: 103,213,961 (GRCm39) I175K possibly damaging Het
Or8s2 T C 15: 98,276,145 (GRCm39) N282S probably damaging Het
Pcdhac2 T G 18: 37,279,139 (GRCm39) Y706* probably null Het
Pgbd1 A G 13: 21,607,190 (GRCm39) S335P probably damaging Het
Pkhd1l1 A C 15: 44,393,214 (GRCm39) I1850L possibly damaging Het
Pogz T C 3: 94,778,318 (GRCm39) V304A possibly damaging Het
Rap1a T C 3: 105,646,856 (GRCm39) I100V probably damaging Het
Slc4a4 A T 5: 89,194,123 (GRCm39) K201M probably damaging Het
Slc6a1 T C 6: 114,281,022 (GRCm39) F8S possibly damaging Het
St18 T G 1: 6,880,839 (GRCm39) M444R possibly damaging Het
Syna G T 5: 134,588,106 (GRCm39) S281* probably null Het
Tgm1 A G 14: 55,947,000 (GRCm39) V336A probably damaging Het
Tle6 G T 10: 81,429,868 (GRCm39) T400K probably damaging Het
Tmem181a T C 17: 6,348,481 (GRCm39) W328R probably damaging Het
Trim7 T C 11: 48,729,721 (GRCm39) F193L probably benign Het
Txndc16 A T 14: 45,410,046 (GRCm39) M178K probably damaging Het
Unc80 C T 1: 66,560,740 (GRCm39) H823Y possibly damaging Het
Vmn1r74 A G 7: 11,581,243 (GRCm39) Y181C probably damaging Het
Vmn2r56 T A 7: 12,446,890 (GRCm39) K421* probably null Het
Vwa7 T G 17: 35,242,406 (GRCm39) S503R probably benign Het
Washc5 G A 15: 59,221,991 (GRCm39) T135M probably damaging Het
Wdr6 T C 9: 108,451,322 (GRCm39) I854V probably benign Het
Zfp507 A G 7: 35,493,148 (GRCm39) C632R probably damaging Het
Other mutations in Erbb4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00965:Erbb4 APN 1 68,110,789 (GRCm39) nonsense probably null
IGL01020:Erbb4 APN 1 68,337,608 (GRCm39) splice site probably benign
IGL01349:Erbb4 APN 1 68,385,752 (GRCm39) missense probably benign 0.00
IGL01386:Erbb4 APN 1 68,383,090 (GRCm39) missense probably damaging 1.00
IGL01516:Erbb4 APN 1 68,367,404 (GRCm39) nonsense probably null
IGL01536:Erbb4 APN 1 68,329,441 (GRCm39) missense probably benign 0.00
IGL01721:Erbb4 APN 1 68,293,722 (GRCm39) missense possibly damaging 0.46
IGL01832:Erbb4 APN 1 68,293,725 (GRCm39) missense possibly damaging 0.84
IGL02002:Erbb4 APN 1 68,119,885 (GRCm39) missense probably damaging 1.00
IGL02040:Erbb4 APN 1 68,081,694 (GRCm39) missense probably damaging 1.00
IGL02371:Erbb4 APN 1 68,329,453 (GRCm39) missense probably benign 0.00
IGL02399:Erbb4 APN 1 68,081,596 (GRCm39) splice site probably benign
IGL02553:Erbb4 APN 1 68,345,023 (GRCm39) missense probably benign 0.17
IGL03118:Erbb4 APN 1 68,081,878 (GRCm39) missense probably benign 0.11
IGL03329:Erbb4 APN 1 68,367,281 (GRCm39) missense probably benign 0.30
IGL03405:Erbb4 APN 1 68,369,397 (GRCm39) missense probably benign 0.02
earthworm UTSW 1 68,289,739 (GRCm39) missense possibly damaging 0.67
excrescence UTSW 1 68,369,405 (GRCm39) missense probably damaging 1.00
Mole UTSW 1 68,599,735 (GRCm39) missense probably damaging 1.00
P0018:Erbb4 UTSW 1 68,110,835 (GRCm39) missense probably benign 0.05
PIT4480001:Erbb4 UTSW 1 68,114,702 (GRCm39) missense probably damaging 1.00
R0193:Erbb4 UTSW 1 68,083,119 (GRCm39) intron probably benign
R0329:Erbb4 UTSW 1 68,337,439 (GRCm39) splice site probably benign
R0335:Erbb4 UTSW 1 68,298,418 (GRCm39) missense probably benign
R0362:Erbb4 UTSW 1 68,369,429 (GRCm39) missense probably damaging 0.99
R0579:Erbb4 UTSW 1 68,081,621 (GRCm39) missense probably benign 0.17
R0730:Erbb4 UTSW 1 68,298,449 (GRCm39) missense probably damaging 0.98
R1029:Erbb4 UTSW 1 68,348,773 (GRCm39) missense probably damaging 0.96
R1444:Erbb4 UTSW 1 68,293,759 (GRCm39) missense probably damaging 1.00
R1469:Erbb4 UTSW 1 68,599,841 (GRCm39) missense probably damaging 0.99
R1469:Erbb4 UTSW 1 68,599,841 (GRCm39) missense probably damaging 0.99
R1503:Erbb4 UTSW 1 68,385,705 (GRCm39) missense probably benign 0.00
R1523:Erbb4 UTSW 1 68,435,411 (GRCm39) missense possibly damaging 0.95
R1528:Erbb4 UTSW 1 68,117,741 (GRCm39) nonsense probably null
R1604:Erbb4 UTSW 1 68,385,728 (GRCm39) missense possibly damaging 0.88
R1611:Erbb4 UTSW 1 68,079,547 (GRCm39) missense probably damaging 1.00
R1642:Erbb4 UTSW 1 68,370,393 (GRCm39) missense probably damaging 1.00
R1905:Erbb4 UTSW 1 68,114,569 (GRCm39) splice site probably benign
R1929:Erbb4 UTSW 1 68,238,047 (GRCm39) missense probably damaging 0.98
R2046:Erbb4 UTSW 1 68,337,482 (GRCm39) missense probably benign 0.02
R2271:Erbb4 UTSW 1 68,238,047 (GRCm39) missense probably damaging 0.98
R2298:Erbb4 UTSW 1 68,081,690 (GRCm39) missense probably damaging 1.00
R2356:Erbb4 UTSW 1 68,117,755 (GRCm39) missense probably benign 0.00
R3821:Erbb4 UTSW 1 68,345,072 (GRCm39) missense probably damaging 0.97
R4007:Erbb4 UTSW 1 68,779,560 (GRCm39) missense probably damaging 1.00
R4012:Erbb4 UTSW 1 68,599,735 (GRCm39) missense probably damaging 1.00
R4077:Erbb4 UTSW 1 68,079,496 (GRCm39) missense probably benign 0.07
R4196:Erbb4 UTSW 1 68,383,014 (GRCm39) missense possibly damaging 0.90
R4536:Erbb4 UTSW 1 68,385,781 (GRCm39) missense probably damaging 1.00
R4561:Erbb4 UTSW 1 68,383,080 (GRCm39) nonsense probably null
R4642:Erbb4 UTSW 1 68,289,791 (GRCm39) missense probably damaging 1.00
R4737:Erbb4 UTSW 1 68,383,059 (GRCm39) missense probably damaging 0.98
R4739:Erbb4 UTSW 1 68,383,059 (GRCm39) missense probably damaging 0.98
R4780:Erbb4 UTSW 1 68,337,473 (GRCm39) missense probably damaging 1.00
R4801:Erbb4 UTSW 1 68,369,405 (GRCm39) missense probably damaging 1.00
R4802:Erbb4 UTSW 1 68,369,405 (GRCm39) missense probably damaging 1.00
R4811:Erbb4 UTSW 1 68,293,703 (GRCm39) missense probably damaging 1.00
R4832:Erbb4 UTSW 1 68,369,397 (GRCm39) missense probably benign 0.02
R5068:Erbb4 UTSW 1 68,083,061 (GRCm39) splice site probably null
R5546:Erbb4 UTSW 1 68,337,452 (GRCm39) missense probably damaging 0.99
R5755:Erbb4 UTSW 1 68,599,678 (GRCm39) missense possibly damaging 0.96
R6189:Erbb4 UTSW 1 68,083,075 (GRCm39) missense probably benign
R6257:Erbb4 UTSW 1 68,435,432 (GRCm39) missense probably damaging 1.00
R6276:Erbb4 UTSW 1 68,599,735 (GRCm39) missense probably damaging 1.00
R6521:Erbb4 UTSW 1 68,081,689 (GRCm39) missense probably damaging 1.00
R6602:Erbb4 UTSW 1 68,409,662 (GRCm39) missense probably damaging 0.99
R6808:Erbb4 UTSW 1 68,079,462 (GRCm39) missense probably benign 0.00
R7087:Erbb4 UTSW 1 68,779,650 (GRCm39) missense probably null 1.00
R7215:Erbb4 UTSW 1 68,378,619 (GRCm39) missense probably benign
R7356:Erbb4 UTSW 1 68,378,514 (GRCm39) critical splice donor site probably null
R7509:Erbb4 UTSW 1 68,289,739 (GRCm39) missense possibly damaging 0.67
R7593:Erbb4 UTSW 1 68,293,758 (GRCm39) missense probably damaging 0.99
R7743:Erbb4 UTSW 1 68,367,278 (GRCm39) missense probably benign 0.00
R7784:Erbb4 UTSW 1 68,114,658 (GRCm39) missense probably damaging 1.00
R7815:Erbb4 UTSW 1 68,081,885 (GRCm39) missense probably damaging 1.00
R7923:Erbb4 UTSW 1 68,298,368 (GRCm39) missense probably damaging 1.00
R8071:Erbb4 UTSW 1 68,435,470 (GRCm39) missense probably damaging 1.00
R8288:Erbb4 UTSW 1 68,337,509 (GRCm39) missense probably damaging 1.00
R8356:Erbb4 UTSW 1 68,110,789 (GRCm39) missense probably damaging 1.00
R8456:Erbb4 UTSW 1 68,110,789 (GRCm39) missense probably damaging 1.00
R8464:Erbb4 UTSW 1 68,348,785 (GRCm39) missense probably benign
R8783:Erbb4 UTSW 1 68,079,331 (GRCm39) missense possibly damaging 0.95
R8830:Erbb4 UTSW 1 68,114,627 (GRCm39) missense probably damaging 1.00
R8881:Erbb4 UTSW 1 68,382,997 (GRCm39) critical splice donor site probably null
R9053:Erbb4 UTSW 1 68,289,779 (GRCm39) missense possibly damaging 0.63
R9142:Erbb4 UTSW 1 68,388,552 (GRCm39) missense probably damaging 1.00
R9237:Erbb4 UTSW 1 68,081,601 (GRCm39) missense possibly damaging 0.72
R9350:Erbb4 UTSW 1 68,329,638 (GRCm39) missense probably benign 0.00
R9374:Erbb4 UTSW 1 68,779,642 (GRCm39) nonsense probably null
R9434:Erbb4 UTSW 1 68,081,773 (GRCm39) missense possibly damaging 0.84
R9499:Erbb4 UTSW 1 68,779,642 (GRCm39) nonsense probably null
R9551:Erbb4 UTSW 1 68,779,642 (GRCm39) nonsense probably null
R9753:Erbb4 UTSW 1 68,238,062 (GRCm39) missense probably benign 0.00
X0019:Erbb4 UTSW 1 68,112,304 (GRCm39) missense probably benign 0.00
Z1176:Erbb4 UTSW 1 68,367,418 (GRCm39) nonsense probably null
Z1176:Erbb4 UTSW 1 68,337,561 (GRCm39) frame shift probably null
Z1177:Erbb4 UTSW 1 68,348,802 (GRCm39) missense probably benign 0.06
Z1177:Erbb4 UTSW 1 68,329,635 (GRCm39) missense probably damaging 1.00
Z1177:Erbb4 UTSW 1 68,298,342 (GRCm39) frame shift probably null
Predicted Primers PCR Primer
(F):5'- GATAGGACCCACAGCCAATG -3'
(R):5'- ATGAACAGTTAAGGTCACAGTGAC -3'

Sequencing Primer
(F):5'- GAGCTCTAGTTATTTGACCTG -3'
(R):5'- GTGACTTACAATTTATCAGTTTGGGC -3'
Posted On 2014-10-01