Incidental Mutation 'R2139:Rap1a'
ID236027
Institutional Source Beutler Lab
Gene Symbol Rap1a
Ensembl Gene ENSMUSG00000068798
Gene NameRAS-related protein 1a
SynonymsRap1, Krev-1
MMRRC Submission 040142-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.414) question?
Stock #R2139 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location105727267-105801336 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 105739540 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 100 (I100V)
Ref Sequence ENSEMBL: ENSMUSP00000142733 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090678] [ENSMUST00000197094] [ENSMUST00000198004] [ENSMUST00000199969]
Predicted Effect possibly damaging
Transcript: ENSMUST00000090678
AA Change: I100V

PolyPhen 2 Score 0.745 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000088174
Gene: ENSMUSG00000068798
AA Change: I100V

DomainStartEndE-ValueType
RAS 1 168 2.68e-120 SMART
low complexity region 173 179 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000197094
SMART Domains Protein: ENSMUSP00000142419
Gene: ENSMUSG00000068798

DomainStartEndE-ValueType
RAS 1 102 1.5e-45 SMART
low complexity region 107 113 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000198004
AA Change: I100V

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000142733
Gene: ENSMUSG00000068798
AA Change: I100V

DomainStartEndE-ValueType
RAS 1 109 1.9e-55 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000199969
AA Change: I100V

PolyPhen 2 Score 0.833 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000142634
Gene: ENSMUSG00000068798
AA Change: I100V

DomainStartEndE-ValueType
RAS 1 158 2.53e-107 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Ras family of small GTPases. The encoded protein undergoes a change in conformational state and activity, depending on whether it is bound to GTP or GDP. This protein is activated by several types of guanine nucleotide exchange factors (GEFs), and inactivated by two groups of GTPase-activating proteins (GAPs). The activation status of the encoded protein is therefore affected by the balance of intracellular levels of GEFs and GAPs. The encoded protein regulates signaling pathways that affect cell proliferation and adhesion, and may play a role in tumor malignancy. Pseudogenes of this gene have been defined on chromosomes 14 and 17. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2014]
PHENOTYPE: Mice homozygous for a null allele exhibit impaired leukocyte migration and decreased angiogenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931429L15Rik A T 9: 46,304,295 F318I probably damaging Het
Bfsp2 T C 9: 103,449,875 K221R probably benign Het
Cacna1b A C 2: 24,679,473 M813R probably benign Het
Chaf1a T C 17: 56,065,226 L798P probably damaging Het
Chd8 G A 14: 52,236,971 T201I probably benign Het
Col23a1 T C 11: 51,574,034 S436P probably benign Het
Cubn T C 2: 13,336,167 I2248V probably benign Het
Cyp4f39 A G 17: 32,491,189 I440M probably benign Het
Dhcr24 G T 4: 106,572,302 E191* probably null Het
Dlg5 T C 14: 24,170,544 D522G probably damaging Het
Dnaja4 A T 9: 54,709,222 M170L probably benign Het
Dopey2 T C 16: 93,771,007 S1441P possibly damaging Het
Egr2 T A 10: 67,540,872 S383T probably damaging Het
Elovl1 A G 4: 118,431,106 D94G probably damaging Het
Erbb4 A G 1: 68,346,629 V267A probably damaging Het
Esp38 T A 17: 39,953,384 I11N probably damaging Het
Esrrb T C 12: 86,421,966 probably null Het
Fbxo24 A T 5: 137,613,065 S488T probably damaging Het
Fgfr1 T G 8: 25,570,866 V618G probably damaging Het
Gak C T 5: 108,606,877 probably null Het
Gm11639 C T 11: 104,751,911 T1120I possibly damaging Het
Gpr61 A T 3: 108,150,761 C195S probably damaging Het
Greb1l A C 18: 10,555,011 N1686H probably damaging Het
Hapln4 T C 8: 70,088,138 F274L probably benign Het
Hoxc10 A T 15: 102,967,477 Q207L probably benign Het
Hspa12a A G 19: 58,799,482 V636A probably benign Het
Il1f8 A G 2: 24,154,660 N24S probably benign Het
Il22ra2 T A 10: 19,632,870 F215L probably benign Het
Kank1 G A 19: 25,411,753 G930D probably benign Het
Kif13a T C 13: 46,752,469 D666G possibly damaging Het
Krt86 A T 15: 101,473,758 I70F probably benign Het
Lgi4 A T 7: 31,063,123 I112F probably damaging Het
Lrrc8c T G 5: 105,606,692 I111S probably damaging Het
Ltbp2 T C 12: 84,815,979 N600S probably damaging Het
Marc1 G A 1: 184,795,435 T276I probably benign Het
Mbd3l2 A T 9: 18,444,958 D193V probably damaging Het
Mroh5 T A 15: 73,790,091 D417V probably damaging Het
Ms4a18 A T 19: 10,997,331 V332D possibly damaging Het
Muc4 T A 16: 32,761,225 I2488N unknown Het
Myrf C G 19: 10,216,467 A532P probably damaging Het
Nav3 T C 10: 109,853,135 N427S probably benign Het
Neb T C 2: 52,212,588 S4315G probably damaging Het
Nyap2 A G 1: 81,241,268 D335G probably damaging Het
Olfm4 T C 14: 80,014,315 L225P probably benign Het
Olfr1199 T A 2: 88,756,093 N194I probably damaging Het
Olfr283 T C 15: 98,378,264 N282S probably damaging Het
Olfr419 A T 1: 174,250,736 probably null Het
Olfr616 A T 7: 103,564,754 I175K possibly damaging Het
Pcdhac2 T G 18: 37,146,086 Y706* probably null Het
Pgbd1 A G 13: 21,423,020 S335P probably damaging Het
Pkhd1l1 A C 15: 44,529,818 I1850L possibly damaging Het
Pogz T C 3: 94,871,007 V304A possibly damaging Het
Slc4a4 A T 5: 89,046,264 K201M probably damaging Het
Slc6a1 T C 6: 114,304,061 F8S possibly damaging Het
St18 T G 1: 6,810,615 M444R possibly damaging Het
Syna G T 5: 134,559,252 S281* probably null Het
Tgm1 A G 14: 55,709,543 V336A probably damaging Het
Tle6 G T 10: 81,594,034 T400K probably damaging Het
Tmem181a T C 17: 6,298,206 W328R probably damaging Het
Trim7 T C 11: 48,838,894 F193L probably benign Het
Txndc16 A T 14: 45,172,589 M178K probably damaging Het
Unc80 C T 1: 66,521,581 H823Y possibly damaging Het
Vmn1r74 A G 7: 11,847,316 Y181C probably damaging Het
Vmn2r56 T A 7: 12,712,963 K421* probably null Het
Vwa7 T G 17: 35,023,430 S503R probably benign Het
Washc5 G A 15: 59,350,142 T135M probably damaging Het
Wdr6 T C 9: 108,574,123 I854V probably benign Het
Zfp507 A G 7: 35,793,723 C632R probably damaging Het
Other mutations in Rap1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01135:Rap1a APN 3 105732035 missense probably benign 0.01
IGL03168:Rap1a APN 3 105750271 missense probably damaging 1.00
R5802:Rap1a UTSW 3 105745936 missense probably damaging 1.00
R5906:Rap1a UTSW 3 105737765 missense possibly damaging 0.90
R5941:Rap1a UTSW 3 105732069 missense possibly damaging 0.82
R6051:Rap1a UTSW 3 105750297 missense possibly damaging 0.91
R6136:Rap1a UTSW 3 105750282 missense probably damaging 1.00
R6251:Rap1a UTSW 3 105731995 nonsense probably null
R6856:Rap1a UTSW 3 105732068 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGTCACTTTGCCATACAAGTG -3'
(R):5'- TGAAACTAGCCTGAAGTCTTATGTC -3'

Sequencing Primer
(F):5'- ACTTTGCCATACAAGTGTTCATTTTC -3'
(R):5'- CTAGCCTGAAGTCTTATGTCAATATG -3'
Posted On2014-10-01