Mutagenetix > Incidental Mutations

Incidental Mutation 'R2139:Slc4a4'

236031

Institutional Source

Beutler Lab

Gene Symbol

Slc4a4

Ensembl Gene

ENSMUSG00000060961

Gene Name

solute carrier family 4 (anion exchanger), member 4

Synonyms

NBC1, NBC

MMRRC Submission

040142-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R2139 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

88886818-89239653 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 89046264 bp

Zygosity

Heterozygous

Amino Acid Change

Lysine to Methionine at position 201 (K201M)

Ref Sequence

ENSEMBL: ENSMUSP00000121744 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000113216] [ENSMUST00000113218] [ENSMUST00000130041] [ENSMUST00000134303] [ENSMUST00000148750] [ENSMUST00000156238]

Predicted Effect

probably benign
Transcript: ENSMUST00000113216

SMART Domains

Protein: ENSMUSP00000108842
Gene: ENSMUSG00000060961

Domain	Start	End	E-Value	Type
Pfam:Band_3_cyto	93	149	4.2e-19	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000113218
AA Change: K201M

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000108844
Gene: ENSMUSG00000060961
AA Change: K201M

Domain	Start	End	E-Value	Type
low complexity region	40	59	N/A	INTRINSIC
low complexity region	76	87	N/A	INTRINSIC
Pfam:Band_3_cyto	137	379	1.1e-100	PFAM
low complexity region	408	423	N/A	INTRINSIC
Pfam:HCO3_cotransp	426	947	3e-246	PFAM
transmembrane domain	953	975	N/A	INTRINSIC
low complexity region	999	1015	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000130041
AA Change: K157M

PolyPhen 2 Score 0.927 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000118413
Gene: ENSMUSG00000060961
AA Change: K157M

Domain	Start	End	E-Value	Type
Pfam:Band_3_cyto	93	344	1.5e-101	PFAM
low complexity region	373	388	N/A	INTRINSIC
Pfam:HCO3_cotransp	391	912	2.7e-246	PFAM
transmembrane domain	918	940	N/A	INTRINSIC
low complexity region	964	980	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000134303
AA Change: K157M

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000119976
Gene: ENSMUSG00000060961
AA Change: K157M

Domain	Start	End	E-Value	Type
Pfam:Band_3_cyto	93	233	1.4e-36	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000148750
AA Change: K201M

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000119325
Gene: ENSMUSG00000060961
AA Change: K201M

Domain	Start	End	E-Value	Type
low complexity region	40	59	N/A	INTRINSIC
low complexity region	76	87	N/A	INTRINSIC
Pfam:Band_3_cyto	137	388	3.7e-101	PFAM
low complexity region	417	432	N/A	INTRINSIC
Pfam:HCO3_cotransp	435	956	7.3e-246	PFAM
transmembrane domain	962	984	N/A	INTRINSIC
low complexity region	1008	1024	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000156238
AA Change: K201M

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000121744
Gene: ENSMUSG00000060961
AA Change: K201M

Domain	Start	End	E-Value	Type
low complexity region	40	59	N/A	INTRINSIC
low complexity region	76	87	N/A	INTRINSIC
Pfam:Band_3_cyto	137	388	4.6e-101	PFAM
low complexity region	417	432	N/A	INTRINSIC
Pfam:HCO3_cotransp	436	956	4.1e-231	PFAM
transmembrane domain	962	984	N/A	INTRINSIC
low complexity region	1008	1024	N/A	INTRINSIC

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 95.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a sodium bicarbonate cotransporter (NBC) involved in the regulation of bicarbonate secretion and absorption and intracellular pH. Mutations in this gene are associated with proximal renal tubular acidosis. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit smaller birth size, growth retardation, postnatal lethality, bowel obstructions, altered blood chemistry, acidosis, spleen defects and defects in ion homeostasis. Heterozygotes have decreased levels of circulating bicarbonate. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 68 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4931429L15Rik	A	T	9: 46,304,295	F318I	probably damaging	Het
Bfsp2	T	C	9: 103,449,875	K221R	probably benign	Het
Cacna1b	A	C	2: 24,679,473	M813R	probably benign	Het
Chaf1a	T	C	17: 56,065,226	L798P	probably damaging	Het
Chd8	G	A	14: 52,236,971	T201I	probably benign	Het
Col23a1	T	C	11: 51,574,034	S436P	probably benign	Het
Cubn	T	C	2: 13,336,167	I2248V	probably benign	Het
Cyp4f39	A	G	17: 32,491,189	I440M	probably benign	Het
Dhcr24	G	T	4: 106,572,302	E191*	probably null	Het
Dlg5	T	C	14: 24,170,544	D522G	probably damaging	Het
Dnaja4	A	T	9: 54,709,222	M170L	probably benign	Het
Dopey2	T	C	16: 93,771,007	S1441P	possibly damaging	Het
Egr2	T	A	10: 67,540,872	S383T	probably damaging	Het
Elovl1	A	G	4: 118,431,106	D94G	probably damaging	Het
Erbb4	A	G	1: 68,346,629	V267A	probably damaging	Het
Esp38	T	A	17: 39,953,384	I11N	probably damaging	Het
Esrrb	T	C	12: 86,421,966		probably null	Het
Fbxo24	A	T	5: 137,613,065	S488T	probably damaging	Het
Fgfr1	T	G	8: 25,570,866	V618G	probably damaging	Het
Gak	C	T	5: 108,606,877		probably null	Het
Gm11639	C	T	11: 104,751,911	T1120I	possibly damaging	Het
Gpr61	A	T	3: 108,150,761	C195S	probably damaging	Het
Greb1l	A	C	18: 10,555,011	N1686H	probably damaging	Het
Hapln4	T	C	8: 70,088,138	F274L	probably benign	Het
Hoxc10	A	T	15: 102,967,477	Q207L	probably benign	Het
Hspa12a	A	G	19: 58,799,482	V636A	probably benign	Het
Il1f8	A	G	2: 24,154,660	N24S	probably benign	Het
Il22ra2	T	A	10: 19,632,870	F215L	probably benign	Het
Kank1	G	A	19: 25,411,753	G930D	probably benign	Het
Kif13a	T	C	13: 46,752,469	D666G	possibly damaging	Het
Krt86	A	T	15: 101,473,758	I70F	probably benign	Het
Lgi4	A	T	7: 31,063,123	I112F	probably damaging	Het
Lrrc8c	T	G	5: 105,606,692	I111S	probably damaging	Het
Ltbp2	T	C	12: 84,815,979	N600S	probably damaging	Het
Marc1	G	A	1: 184,795,435	T276I	probably benign	Het
Mbd3l2	A	T	9: 18,444,958	D193V	probably damaging	Het
Mroh5	T	A	15: 73,790,091	D417V	probably damaging	Het
Ms4a18	A	T	19: 10,997,331	V332D	possibly damaging	Het
Muc4	T	A	16: 32,761,225	I2488N	unknown	Het
Myrf	C	G	19: 10,216,467	A532P	probably damaging	Het
Nav3	T	C	10: 109,853,135	N427S	probably benign	Het
Neb	T	C	2: 52,212,588	S4315G	probably damaging	Het
Nyap2	A	G	1: 81,241,268	D335G	probably damaging	Het
Olfm4	T	C	14: 80,014,315	L225P	probably benign	Het
Olfr1199	T	A	2: 88,756,093	N194I	probably damaging	Het
Olfr283	T	C	15: 98,378,264	N282S	probably damaging	Het
Olfr419	A	T	1: 174,250,736		probably null	Het
Olfr616	A	T	7: 103,564,754	I175K	possibly damaging	Het
Pcdhac2	T	G	18: 37,146,086	Y706*	probably null	Het
Pgbd1	A	G	13: 21,423,020	S335P	probably damaging	Het
Pkhd1l1	A	C	15: 44,529,818	I1850L	possibly damaging	Het
Pogz	T	C	3: 94,871,007	V304A	possibly damaging	Het
Rap1a	T	C	3: 105,739,540	I100V	probably damaging	Het
Slc6a1	T	C	6: 114,304,061	F8S	possibly damaging	Het
St18	T	G	1: 6,810,615	M444R	possibly damaging	Het
Syna	G	T	5: 134,559,252	S281*	probably null	Het
Tgm1	A	G	14: 55,709,543	V336A	probably damaging	Het
Tle6	G	T	10: 81,594,034	T400K	probably damaging	Het
Tmem181a	T	C	17: 6,298,206	W328R	probably damaging	Het
Trim7	T	C	11: 48,838,894	F193L	probably benign	Het
Txndc16	A	T	14: 45,172,589	M178K	probably damaging	Het
Unc80	C	T	1: 66,521,581	H823Y	possibly damaging	Het
Vmn1r74	A	G	7: 11,847,316	Y181C	probably damaging	Het
Vmn2r56	T	A	7: 12,712,963	K421*	probably null	Het
Vwa7	T	G	17: 35,023,430	S503R	probably benign	Het
Washc5	G	A	15: 59,350,142	T135M	probably damaging	Het
Wdr6	T	C	9: 108,574,123	I854V	probably benign	Het
Zfp507	A	G	7: 35,793,723	C632R	probably damaging	Het

Other mutations in Slc4a4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00827:Slc4a4	APN	5	89179686	missense	probably benign	0.01
IGL00976:Slc4a4	APN	5	88954798	missense	probably damaging	1.00
IGL01074:Slc4a4	APN	5	89179774	missense	probably damaging	1.00
IGL01120:Slc4a4	APN	5	89132379	missense	probably damaging	1.00
IGL01284:Slc4a4	APN	5	89129673	missense	probably benign	0.22
IGL01375:Slc4a4	APN	5	89179734	missense	probably damaging	1.00
IGL01399:Slc4a4	APN	5	89228935	missense	probably damaging	1.00
IGL01487:Slc4a4	APN	5	89228856	missense	probably benign	0.19
IGL02501:Slc4a4	APN	5	89129649	missense	probably benign	0.13
IGL03104:Slc4a4	APN	5	89149372	missense	probably damaging	1.00
IGL03157:Slc4a4	APN	5	89156513	missense	probably damaging	0.99
IGL03205:Slc4a4	APN	5	89149330	missense	probably benign	0.00
IGL03356:Slc4a4	APN	5	89122483	missense	probably benign	0.00
IGL03372:Slc4a4	APN	5	89156426	missense	probably damaging	1.00
IGL03382:Slc4a4	APN	5	89228836	missense	probably damaging	1.00
camera	UTSW	5	89132507	missense	probably damaging	1.00
pixels	UTSW	5	89122403	missense	probably damaging	0.99
Shutter	UTSW	5	89225948	missense	probably damaging	1.00
Tetrapod	UTSW	5	89228972	missense	probably damaging	1.00
tripod	UTSW	5	89149333	missense	possibly damaging	0.52
BB008:Slc4a4	UTSW	5	89170781	missense	probably benign	0.00
BB018:Slc4a4	UTSW	5	89170781	missense	probably benign	0.00
PIT4515001:Slc4a4	UTSW	5	89133253	missense	probably damaging	1.00
PIT4544001:Slc4a4	UTSW	5	89038543	missense	probably damaging	1.00
R0007:Slc4a4	UTSW	5	89038578	missense	probably damaging	1.00
R0052:Slc4a4	UTSW	5	89156336	missense	possibly damaging	0.71
R0052:Slc4a4	UTSW	5	89156336	missense	possibly damaging	0.71
R0054:Slc4a4	UTSW	5	89156336	missense	possibly damaging	0.71
R0055:Slc4a4	UTSW	5	89156336	missense	possibly damaging	0.71
R0230:Slc4a4	UTSW	5	89156336	missense	possibly damaging	0.71
R0234:Slc4a4	UTSW	5	89156336	missense	possibly damaging	0.71
R0234:Slc4a4	UTSW	5	89156336	missense	possibly damaging	0.71
R0632:Slc4a4	UTSW	5	89129641	missense	probably damaging	1.00
R1199:Slc4a4	UTSW	5	89215794	critical splice donor site	probably null
R1597:Slc4a4	UTSW	5	89135728	missense	probably benign	0.01
R1783:Slc4a4	UTSW	5	89132414	missense	probably damaging	1.00
R1813:Slc4a4	UTSW	5	89046308	missense	probably damaging	0.98
R1896:Slc4a4	UTSW	5	89046308	missense	probably damaging	0.98
R2000:Slc4a4	UTSW	5	89028347	missense	probably damaging	1.00
R2163:Slc4a4	UTSW	5	89214576	missense	probably damaging	1.00
R2513:Slc4a4	UTSW	5	89156398	missense	probably benign	0.00
R2873:Slc4a4	UTSW	5	89135764	missense	probably damaging	1.00
R2995:Slc4a4	UTSW	5	88934814	missense	probably damaging	1.00
R3054:Slc4a4	UTSW	5	89225948	missense	probably damaging	1.00
R3055:Slc4a4	UTSW	5	89132507	missense	probably damaging	1.00
R3055:Slc4a4	UTSW	5	89225948	missense	probably damaging	1.00
R3056:Slc4a4	UTSW	5	89225948	missense	probably damaging	1.00
R3617:Slc4a4	UTSW	5	89234804	missense	probably benign	0.00
R3856:Slc4a4	UTSW	5	89232839	missense	probably benign	0.00
R3863:Slc4a4	UTSW	5	89135648	missense	possibly damaging	0.95
R3896:Slc4a4	UTSW	5	89197766	splice site	probably benign
R4007:Slc4a4	UTSW	5	89214593	missense	probably damaging	1.00
R4616:Slc4a4	UTSW	5	89038561	missense	probably damaging	1.00
R4740:Slc4a4	UTSW	5	89225894	missense	probably damaging	1.00
R5009:Slc4a4	UTSW	5	89149298	critical splice acceptor site	probably null
R5119:Slc4a4	UTSW	5	88954862	missense	probably null	0.97
R5228:Slc4a4	UTSW	5	89156525	missense	possibly damaging	0.50
R5394:Slc4a4	UTSW	5	89197764	critical splice donor site	probably null
R5396:Slc4a4	UTSW	5	89046217	missense	probably benign	0.00
R5662:Slc4a4	UTSW	5	89028244	missense	probably damaging	0.96
R5664:Slc4a4	UTSW	5	89028244	missense	probably damaging	0.96
R6021:Slc4a4	UTSW	5	89040402	intron	probably benign
R6088:Slc4a4	UTSW	5	89197704	missense	probably benign	0.12
R6337:Slc4a4	UTSW	5	89046372	missense	probably benign	0.21
R6416:Slc4a4	UTSW	5	89179729	missense	probably benign	0.26
R6452:Slc4a4	UTSW	5	89228980	missense	probably benign	0.05
R6524:Slc4a4	UTSW	5	89232764	missense	probably benign	0.01
R6566:Slc4a4	UTSW	5	89149333	missense	possibly damaging	0.52
R6727:Slc4a4	UTSW	5	89170765	missense	probably benign	0.00
R6844:Slc4a4	UTSW	5	89228972	missense	probably damaging	1.00
R6970:Slc4a4	UTSW	5	89179831	missense	probably damaging	0.98
R7021:Slc4a4	UTSW	5	89040346	splice site	probably null
R7180:Slc4a4	UTSW	5	89046236	missense	probably damaging	0.97
R7197:Slc4a4	UTSW	5	88934574	intron	probably benign
R7246:Slc4a4	UTSW	5	89122403	missense	probably damaging	0.99
R7309:Slc4a4	UTSW	5	89170751	missense	probably benign
R7412:Slc4a4	UTSW	5	89214647	splice site	probably null
R7492:Slc4a4	UTSW	5	89129650	missense	possibly damaging	0.92
R7561:Slc4a4	UTSW	5	89199697	missense	probably damaging	1.00
R7577:Slc4a4	UTSW	5	89225867	missense	probably damaging	0.97
R7609:Slc4a4	UTSW	5	89135686	missense	probably damaging	1.00
R7781:Slc4a4	UTSW	5	89228932	missense	possibly damaging	0.78
R7931:Slc4a4	UTSW	5	89170781	missense	probably benign	0.00
R7950:Slc4a4	UTSW	5	89058278	splice site	probably null
R8078:Slc4a4	UTSW	5	89179707	missense	probably benign	0.00
R8313:Slc4a4	UTSW	5	89046263	missense	possibly damaging	0.84
R8332:Slc4a4	UTSW	5	89179821	missense	probably benign	0.11
R8534:Slc4a4	UTSW	5	89135722	missense	probably damaging	1.00
Z1177:Slc4a4	UTSW	5	89132459	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ATTAATGCCAGCATCCTGTCC -3'
(R):5'- AATGACCATGGCGCGTGAAC -3'

Sequencing Primer
(F):5'- AGCATCCTGTCCCTTCCCATAAAG -3'
(R):5'- CATGGCGCGTGAACTTGAG -3'

Posted On

2014-10-01