Incidental Mutation 'R2139:Lgi4'
ID236040
Institutional Source Beutler Lab
Gene Symbol Lgi4
Ensembl Gene ENSMUSG00000036560
Gene Nameleucine-rich repeat LGI family, member 4
Synonymsclp
MMRRC Submission 040142-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2139 (G1)
Quality Score201
Status Not validated
Chromosome7
Chromosomal Location31059342-31070935 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 31063123 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 112 (I112F)
Ref Sequence ENSEMBL: ENSMUSP00000041579 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039775] [ENSMUST00000164725] [ENSMUST00000169785]
Predicted Effect probably damaging
Transcript: ENSMUST00000039775
AA Change: I112F

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000041579
Gene: ENSMUSG00000036560
AA Change: I112F

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 49 59 N/A INTRINSIC
LRR 75 98 7.17e1 SMART
LRR 99 122 2.76e1 SMART
LRR_TYP 123 146 2.43e-4 SMART
LRRCT 158 207 3.97e-5 SMART
Pfam:EPTP 214 251 1.1e-7 PFAM
Pfam:EPTP 396 438 2.7e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000164725
Predicted Effect probably damaging
Transcript: ENSMUST00000169785
AA Change: I50F

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
Predicted Effect probably benign
Transcript: ENSMUST00000172001
SMART Domains Protein: ENSMUSP00000125865
Gene: ENSMUSG00000036560

DomainStartEndE-ValueType
LRRCT 9 58 3.97e-5 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous mutant animals have an abnormal posture where the forelimbs are flexed and rotated inwards. The peripheral nervous system is delayed in myelination. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931429L15Rik A T 9: 46,304,295 F318I probably damaging Het
Bfsp2 T C 9: 103,449,875 K221R probably benign Het
Cacna1b A C 2: 24,679,473 M813R probably benign Het
Chaf1a T C 17: 56,065,226 L798P probably damaging Het
Chd8 G A 14: 52,236,971 T201I probably benign Het
Col23a1 T C 11: 51,574,034 S436P probably benign Het
Cubn T C 2: 13,336,167 I2248V probably benign Het
Cyp4f39 A G 17: 32,491,189 I440M probably benign Het
Dhcr24 G T 4: 106,572,302 E191* probably null Het
Dlg5 T C 14: 24,170,544 D522G probably damaging Het
Dnaja4 A T 9: 54,709,222 M170L probably benign Het
Dopey2 T C 16: 93,771,007 S1441P possibly damaging Het
Egr2 T A 10: 67,540,872 S383T probably damaging Het
Elovl1 A G 4: 118,431,106 D94G probably damaging Het
Erbb4 A G 1: 68,346,629 V267A probably damaging Het
Esp38 T A 17: 39,953,384 I11N probably damaging Het
Esrrb T C 12: 86,421,966 probably null Het
Fbxo24 A T 5: 137,613,065 S488T probably damaging Het
Fgfr1 T G 8: 25,570,866 V618G probably damaging Het
Gak C T 5: 108,606,877 probably null Het
Gm11639 C T 11: 104,751,911 T1120I possibly damaging Het
Gpr61 A T 3: 108,150,761 C195S probably damaging Het
Greb1l A C 18: 10,555,011 N1686H probably damaging Het
Hapln4 T C 8: 70,088,138 F274L probably benign Het
Hoxc10 A T 15: 102,967,477 Q207L probably benign Het
Hspa12a A G 19: 58,799,482 V636A probably benign Het
Il1f8 A G 2: 24,154,660 N24S probably benign Het
Il22ra2 T A 10: 19,632,870 F215L probably benign Het
Kank1 G A 19: 25,411,753 G930D probably benign Het
Kif13a T C 13: 46,752,469 D666G possibly damaging Het
Krt86 A T 15: 101,473,758 I70F probably benign Het
Lrrc8c T G 5: 105,606,692 I111S probably damaging Het
Ltbp2 T C 12: 84,815,979 N600S probably damaging Het
Marc1 G A 1: 184,795,435 T276I probably benign Het
Mbd3l2 A T 9: 18,444,958 D193V probably damaging Het
Mroh5 T A 15: 73,790,091 D417V probably damaging Het
Ms4a18 A T 19: 10,997,331 V332D possibly damaging Het
Muc4 T A 16: 32,761,225 I2488N unknown Het
Myrf C G 19: 10,216,467 A532P probably damaging Het
Nav3 T C 10: 109,853,135 N427S probably benign Het
Neb T C 2: 52,212,588 S4315G probably damaging Het
Nyap2 A G 1: 81,241,268 D335G probably damaging Het
Olfm4 T C 14: 80,014,315 L225P probably benign Het
Olfr1199 T A 2: 88,756,093 N194I probably damaging Het
Olfr283 T C 15: 98,378,264 N282S probably damaging Het
Olfr419 A T 1: 174,250,736 probably null Het
Olfr616 A T 7: 103,564,754 I175K possibly damaging Het
Pcdhac2 T G 18: 37,146,086 Y706* probably null Het
Pgbd1 A G 13: 21,423,020 S335P probably damaging Het
Pkhd1l1 A C 15: 44,529,818 I1850L possibly damaging Het
Pogz T C 3: 94,871,007 V304A possibly damaging Het
Rap1a T C 3: 105,739,540 I100V probably damaging Het
Slc4a4 A T 5: 89,046,264 K201M probably damaging Het
Slc6a1 T C 6: 114,304,061 F8S possibly damaging Het
St18 T G 1: 6,810,615 M444R possibly damaging Het
Syna G T 5: 134,559,252 S281* probably null Het
Tgm1 A G 14: 55,709,543 V336A probably damaging Het
Tle6 G T 10: 81,594,034 T400K probably damaging Het
Tmem181a T C 17: 6,298,206 W328R probably damaging Het
Trim7 T C 11: 48,838,894 F193L probably benign Het
Txndc16 A T 14: 45,172,589 M178K probably damaging Het
Unc80 C T 1: 66,521,581 H823Y possibly damaging Het
Vmn1r74 A G 7: 11,847,316 Y181C probably damaging Het
Vmn2r56 T A 7: 12,712,963 K421* probably null Het
Vwa7 T G 17: 35,023,430 S503R probably benign Het
Washc5 G A 15: 59,350,142 T135M probably damaging Het
Wdr6 T C 9: 108,574,123 I854V probably benign Het
Zfp507 A G 7: 35,793,723 C632R probably damaging Het
Other mutations in Lgi4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01288:Lgi4 APN 7 31069043 missense probably benign 0.01
IGL01624:Lgi4 APN 7 31067688 missense probably damaging 1.00
IGL02251:Lgi4 APN 7 31067263 splice site probably null
IGL02755:Lgi4 APN 7 31063105 missense probably damaging 1.00
IGL03153:Lgi4 APN 7 31060558 missense probably damaging 1.00
IGL03392:Lgi4 APN 7 31063180 splice site probably null
R0060:Lgi4 UTSW 7 31063571 missense probably damaging 0.97
R0575:Lgi4 UTSW 7 31060093 missense probably benign 0.12
R2276:Lgi4 UTSW 7 31060612 missense probably damaging 1.00
R2277:Lgi4 UTSW 7 31060612 missense probably damaging 1.00
R2278:Lgi4 UTSW 7 31060612 missense probably damaging 1.00
R2939:Lgi4 UTSW 7 31067828 nonsense probably null
R3039:Lgi4 UTSW 7 31060067 missense probably benign
R3922:Lgi4 UTSW 7 31067448 missense probably benign
R4650:Lgi4 UTSW 7 31069129 missense probably benign 0.38
R5184:Lgi4 UTSW 7 31070757 unclassified probably benign
R5583:Lgi4 UTSW 7 31061137 missense possibly damaging 0.92
R5837:Lgi4 UTSW 7 31070783 unclassified probably benign
R5917:Lgi4 UTSW 7 31060178 missense possibly damaging 0.76
R6198:Lgi4 UTSW 7 31069122 unclassified probably null
R6454:Lgi4 UTSW 7 31060132 missense probably benign
R6845:Lgi4 UTSW 7 31061085 missense probably damaging 0.99
R6897:Lgi4 UTSW 7 31068890 missense probably benign 0.00
R7232:Lgi4 UTSW 7 31067351 missense possibly damaging 0.67
R7354:Lgi4 UTSW 7 31060622 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCCGTGTCTATGCTAAGCTTG -3'
(R):5'- AATCTGGGTAGAGCCTCGAG -3'

Sequencing Primer
(F):5'- CCGTGTCTATGCTAAGCTTGACAATG -3'
(R):5'- AGAGCCTCGAGGTGGTTG -3'
Posted On2014-10-01