Incidental Mutation 'R2139:Zfp507'
ID236041
Institutional Source Beutler Lab
Gene Symbol Zfp507
Ensembl Gene ENSMUSG00000044452
Gene Namezinc finger protein 507
Synonyms1810022O10Rik, A230056M16Rik
MMRRC Submission 040142-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.319) question?
Stock #R2139 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location35772343-35803003 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 35793723 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Arginine at position 632 (C632R)
Ref Sequence ENSEMBL: ENSMUSP00000058609 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061586] [ENSMUST00000187282] [ENSMUST00000205670] [ENSMUST00000206615]
Predicted Effect probably damaging
Transcript: ENSMUST00000061586
AA Change: C632R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000058609
Gene: ENSMUSG00000044452
AA Change: C632R

DomainStartEndE-ValueType
ZnF_C2H2 122 144 1.56e-2 SMART
ZnF_C2H2 152 175 2.49e-1 SMART
low complexity region 178 192 N/A INTRINSIC
ZnF_C2H2 237 259 8.52e0 SMART
ZnF_C2H2 630 652 2.75e-3 SMART
ZnF_C2H2 658 680 1.26e-2 SMART
ZnF_C2H2 686 709 5.42e-2 SMART
ZnF_C2H2 746 768 4.79e-3 SMART
ZnF_C2H2 774 796 1.45e-2 SMART
ZnF_C2H2 899 921 3.83e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000187282
SMART Domains Protein: ENSMUSP00000140940
Gene: ENSMUSG00000044452

DomainStartEndE-ValueType
ZnF_C2H2 107 129 1.6e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000205670
Predicted Effect probably damaging
Transcript: ENSMUST00000206615
AA Change: C108R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931429L15Rik A T 9: 46,304,295 F318I probably damaging Het
Bfsp2 T C 9: 103,449,875 K221R probably benign Het
Cacna1b A C 2: 24,679,473 M813R probably benign Het
Chaf1a T C 17: 56,065,226 L798P probably damaging Het
Chd8 G A 14: 52,236,971 T201I probably benign Het
Col23a1 T C 11: 51,574,034 S436P probably benign Het
Cubn T C 2: 13,336,167 I2248V probably benign Het
Cyp4f39 A G 17: 32,491,189 I440M probably benign Het
Dhcr24 G T 4: 106,572,302 E191* probably null Het
Dlg5 T C 14: 24,170,544 D522G probably damaging Het
Dnaja4 A T 9: 54,709,222 M170L probably benign Het
Dopey2 T C 16: 93,771,007 S1441P possibly damaging Het
Egr2 T A 10: 67,540,872 S383T probably damaging Het
Elovl1 A G 4: 118,431,106 D94G probably damaging Het
Erbb4 A G 1: 68,346,629 V267A probably damaging Het
Esp38 T A 17: 39,953,384 I11N probably damaging Het
Esrrb T C 12: 86,421,966 probably null Het
Fbxo24 A T 5: 137,613,065 S488T probably damaging Het
Fgfr1 T G 8: 25,570,866 V618G probably damaging Het
Gak C T 5: 108,606,877 probably null Het
Gm11639 C T 11: 104,751,911 T1120I possibly damaging Het
Gpr61 A T 3: 108,150,761 C195S probably damaging Het
Greb1l A C 18: 10,555,011 N1686H probably damaging Het
Hapln4 T C 8: 70,088,138 F274L probably benign Het
Hoxc10 A T 15: 102,967,477 Q207L probably benign Het
Hspa12a A G 19: 58,799,482 V636A probably benign Het
Il1f8 A G 2: 24,154,660 N24S probably benign Het
Il22ra2 T A 10: 19,632,870 F215L probably benign Het
Kank1 G A 19: 25,411,753 G930D probably benign Het
Kif13a T C 13: 46,752,469 D666G possibly damaging Het
Krt86 A T 15: 101,473,758 I70F probably benign Het
Lgi4 A T 7: 31,063,123 I112F probably damaging Het
Lrrc8c T G 5: 105,606,692 I111S probably damaging Het
Ltbp2 T C 12: 84,815,979 N600S probably damaging Het
Marc1 G A 1: 184,795,435 T276I probably benign Het
Mbd3l2 A T 9: 18,444,958 D193V probably damaging Het
Mroh5 T A 15: 73,790,091 D417V probably damaging Het
Ms4a18 A T 19: 10,997,331 V332D possibly damaging Het
Muc4 T A 16: 32,761,225 I2488N unknown Het
Myrf C G 19: 10,216,467 A532P probably damaging Het
Nav3 T C 10: 109,853,135 N427S probably benign Het
Neb T C 2: 52,212,588 S4315G probably damaging Het
Nyap2 A G 1: 81,241,268 D335G probably damaging Het
Olfm4 T C 14: 80,014,315 L225P probably benign Het
Olfr1199 T A 2: 88,756,093 N194I probably damaging Het
Olfr283 T C 15: 98,378,264 N282S probably damaging Het
Olfr419 A T 1: 174,250,736 probably null Het
Olfr616 A T 7: 103,564,754 I175K possibly damaging Het
Pcdhac2 T G 18: 37,146,086 Y706* probably null Het
Pgbd1 A G 13: 21,423,020 S335P probably damaging Het
Pkhd1l1 A C 15: 44,529,818 I1850L possibly damaging Het
Pogz T C 3: 94,871,007 V304A possibly damaging Het
Rap1a T C 3: 105,739,540 I100V probably damaging Het
Slc4a4 A T 5: 89,046,264 K201M probably damaging Het
Slc6a1 T C 6: 114,304,061 F8S possibly damaging Het
St18 T G 1: 6,810,615 M444R possibly damaging Het
Syna G T 5: 134,559,252 S281* probably null Het
Tgm1 A G 14: 55,709,543 V336A probably damaging Het
Tle6 G T 10: 81,594,034 T400K probably damaging Het
Tmem181a T C 17: 6,298,206 W328R probably damaging Het
Trim7 T C 11: 48,838,894 F193L probably benign Het
Txndc16 A T 14: 45,172,589 M178K probably damaging Het
Unc80 C T 1: 66,521,581 H823Y possibly damaging Het
Vmn1r74 A G 7: 11,847,316 Y181C probably damaging Het
Vmn2r56 T A 7: 12,712,963 K421* probably null Het
Vwa7 T G 17: 35,023,430 S503R probably benign Het
Washc5 G A 15: 59,350,142 T135M probably damaging Het
Wdr6 T C 9: 108,574,123 I854V probably benign Het
Other mutations in Zfp507
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00715:Zfp507 APN 7 35794712 missense possibly damaging 0.93
IGL00835:Zfp507 APN 7 35776038 missense probably damaging 1.00
IGL01083:Zfp507 APN 7 35794038 missense probably benign 0.00
IGL01359:Zfp507 APN 7 35794502 missense probably damaging 1.00
IGL01418:Zfp507 APN 7 35793812 intron probably null
IGL02122:Zfp507 APN 7 35776095 missense probably damaging 1.00
IGL02506:Zfp507 APN 7 35776466 missense probably damaging 1.00
IGL02601:Zfp507 APN 7 35791711 missense probably damaging 1.00
IGL02643:Zfp507 APN 7 35795231 missense probably damaging 0.99
IGL03129:Zfp507 APN 7 35794206 missense probably damaging 1.00
R0400:Zfp507 UTSW 7 35791746 missense probably damaging 1.00
R0812:Zfp507 UTSW 7 35802623 intron probably benign
R1183:Zfp507 UTSW 7 35794890 missense probably damaging 0.99
R1381:Zfp507 UTSW 7 35776010 missense possibly damaging 0.91
R1542:Zfp507 UTSW 7 35794801 missense possibly damaging 0.71
R1626:Zfp507 UTSW 7 35795433 missense probably damaging 1.00
R1759:Zfp507 UTSW 7 35775978 missense probably damaging 0.99
R1843:Zfp507 UTSW 7 35793725 missense probably damaging 0.97
R1852:Zfp507 UTSW 7 35787751 missense probably damaging 1.00
R1893:Zfp507 UTSW 7 35802627 intron probably benign
R1923:Zfp507 UTSW 7 35793725 missense probably damaging 0.97
R1925:Zfp507 UTSW 7 35793725 missense probably damaging 0.97
R1927:Zfp507 UTSW 7 35793725 missense probably damaging 0.97
R2191:Zfp507 UTSW 7 35794843 missense probably damaging 1.00
R2431:Zfp507 UTSW 7 35795402 missense probably benign 0.08
R2921:Zfp507 UTSW 7 35794799 missense probably damaging 1.00
R2922:Zfp507 UTSW 7 35794799 missense probably damaging 1.00
R3436:Zfp507 UTSW 7 35787770 missense probably damaging 1.00
R4483:Zfp507 UTSW 7 35787716 critical splice donor site probably null
R4751:Zfp507 UTSW 7 35794382 missense probably damaging 0.99
R4852:Zfp507 UTSW 7 35794055 missense probably benign 0.01
R5298:Zfp507 UTSW 7 35775996 missense probably damaging 0.99
R5602:Zfp507 UTSW 7 35776238 nonsense probably null
R5707:Zfp507 UTSW 7 35794163 missense probably damaging 1.00
R5785:Zfp507 UTSW 7 35787742 missense probably benign 0.20
R6140:Zfp507 UTSW 7 35794188 missense probably damaging 1.00
R6674:Zfp507 UTSW 7 35794734 missense probably damaging 0.98
R6714:Zfp507 UTSW 7 35787727 missense probably damaging 0.99
R7045:Zfp507 UTSW 7 35795553 missense possibly damaging 0.56
R7334:Zfp507 UTSW 7 35776080 missense probably damaging 1.00
R7365:Zfp507 UTSW 7 35776418 missense unknown
R7569:Zfp507 UTSW 7 35794544 missense probably damaging 0.99
R7662:Zfp507 UTSW 7 35787804 nonsense probably null
R7846:Zfp507 UTSW 7 35794538 missense probably damaging 1.00
R7929:Zfp507 UTSW 7 35794538 missense probably damaging 1.00
Z1088:Zfp507 UTSW 7 35794277 missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- CCGCTCACCTTGTAATGGAAAG -3'
(R):5'- TTAAGACAGGCATCAGTATGTCC -3'

Sequencing Primer
(F):5'- TGGAAAGATTCTTTGCACTGC -3'
(R):5'- AGTATGTCCCTTCTTACCGTAATAG -3'
Posted On2014-10-01