Incidental Mutation 'R2139:Dnaja4'
ID236048
Institutional Source Beutler Lab
Gene Symbol Dnaja4
Ensembl Gene ENSMUSG00000032285
Gene NameDnaJ heat shock protein family (Hsp40) member A4
Synonyms1110021L12Rik, Hsj4, Dj4
MMRRC Submission 040142-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2139 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location54698873-54716315 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 54709222 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 170 (M170L)
Ref Sequence ENSEMBL: ENSMUSP00000112520 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070070] [ENSMUST00000120452] [ENSMUST00000154690]
Predicted Effect probably benign
Transcript: ENSMUST00000070070
AA Change: M170L

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000070413
Gene: ENSMUSG00000032285
AA Change: M170L

DomainStartEndE-ValueType
DnaJ 5 60 1.41e-31 SMART
low complexity region 75 85 N/A INTRINSIC
low complexity region 94 105 N/A INTRINSIC
Pfam:DnaJ_CXXCXGXG 135 201 2.1e-15 PFAM
Pfam:CTDII 258 340 4.1e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000120452
AA Change: M170L

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000112520
Gene: ENSMUSG00000032285
AA Change: M170L

DomainStartEndE-ValueType
DnaJ 5 60 1.41e-31 SMART
low complexity region 75 85 N/A INTRINSIC
low complexity region 94 105 N/A INTRINSIC
Pfam:DnaJ_C 108 330 9.7e-35 PFAM
Pfam:DnaJ_CXXCXGXG 135 201 1.5e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000154690
AA Change: M170L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000119602
Gene: ENSMUSG00000032285
AA Change: M170L

DomainStartEndE-ValueType
DnaJ 5 60 1.41e-31 SMART
low complexity region 75 85 N/A INTRINSIC
low complexity region 94 105 N/A INTRINSIC
Pfam:DnaJ_CXXCXGXG 135 201 3.9e-17 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176884
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931429L15Rik A T 9: 46,304,295 F318I probably damaging Het
Bfsp2 T C 9: 103,449,875 K221R probably benign Het
Cacna1b A C 2: 24,679,473 M813R probably benign Het
Chaf1a T C 17: 56,065,226 L798P probably damaging Het
Chd8 G A 14: 52,236,971 T201I probably benign Het
Col23a1 T C 11: 51,574,034 S436P probably benign Het
Cubn T C 2: 13,336,167 I2248V probably benign Het
Cyp4f39 A G 17: 32,491,189 I440M probably benign Het
Dhcr24 G T 4: 106,572,302 E191* probably null Het
Dlg5 T C 14: 24,170,544 D522G probably damaging Het
Dopey2 T C 16: 93,771,007 S1441P possibly damaging Het
Egr2 T A 10: 67,540,872 S383T probably damaging Het
Elovl1 A G 4: 118,431,106 D94G probably damaging Het
Erbb4 A G 1: 68,346,629 V267A probably damaging Het
Esp38 T A 17: 39,953,384 I11N probably damaging Het
Esrrb T C 12: 86,421,966 probably null Het
Fbxo24 A T 5: 137,613,065 S488T probably damaging Het
Fgfr1 T G 8: 25,570,866 V618G probably damaging Het
Gak C T 5: 108,606,877 probably null Het
Gm11639 C T 11: 104,751,911 T1120I possibly damaging Het
Gpr61 A T 3: 108,150,761 C195S probably damaging Het
Greb1l A C 18: 10,555,011 N1686H probably damaging Het
Hapln4 T C 8: 70,088,138 F274L probably benign Het
Hoxc10 A T 15: 102,967,477 Q207L probably benign Het
Hspa12a A G 19: 58,799,482 V636A probably benign Het
Il1f8 A G 2: 24,154,660 N24S probably benign Het
Il22ra2 T A 10: 19,632,870 F215L probably benign Het
Kank1 G A 19: 25,411,753 G930D probably benign Het
Kif13a T C 13: 46,752,469 D666G possibly damaging Het
Krt86 A T 15: 101,473,758 I70F probably benign Het
Lgi4 A T 7: 31,063,123 I112F probably damaging Het
Lrrc8c T G 5: 105,606,692 I111S probably damaging Het
Ltbp2 T C 12: 84,815,979 N600S probably damaging Het
Marc1 G A 1: 184,795,435 T276I probably benign Het
Mbd3l2 A T 9: 18,444,958 D193V probably damaging Het
Mroh5 T A 15: 73,790,091 D417V probably damaging Het
Ms4a18 A T 19: 10,997,331 V332D possibly damaging Het
Muc4 T A 16: 32,761,225 I2488N unknown Het
Myrf C G 19: 10,216,467 A532P probably damaging Het
Nav3 T C 10: 109,853,135 N427S probably benign Het
Neb T C 2: 52,212,588 S4315G probably damaging Het
Nyap2 A G 1: 81,241,268 D335G probably damaging Het
Olfm4 T C 14: 80,014,315 L225P probably benign Het
Olfr1199 T A 2: 88,756,093 N194I probably damaging Het
Olfr283 T C 15: 98,378,264 N282S probably damaging Het
Olfr419 A T 1: 174,250,736 probably null Het
Olfr616 A T 7: 103,564,754 I175K possibly damaging Het
Pcdhac2 T G 18: 37,146,086 Y706* probably null Het
Pgbd1 A G 13: 21,423,020 S335P probably damaging Het
Pkhd1l1 A C 15: 44,529,818 I1850L possibly damaging Het
Pogz T C 3: 94,871,007 V304A possibly damaging Het
Rap1a T C 3: 105,739,540 I100V probably damaging Het
Slc4a4 A T 5: 89,046,264 K201M probably damaging Het
Slc6a1 T C 6: 114,304,061 F8S possibly damaging Het
St18 T G 1: 6,810,615 M444R possibly damaging Het
Syna G T 5: 134,559,252 S281* probably null Het
Tgm1 A G 14: 55,709,543 V336A probably damaging Het
Tle6 G T 10: 81,594,034 T400K probably damaging Het
Tmem181a T C 17: 6,298,206 W328R probably damaging Het
Trim7 T C 11: 48,838,894 F193L probably benign Het
Txndc16 A T 14: 45,172,589 M178K probably damaging Het
Unc80 C T 1: 66,521,581 H823Y possibly damaging Het
Vmn1r74 A G 7: 11,847,316 Y181C probably damaging Het
Vmn2r56 T A 7: 12,712,963 K421* probably null Het
Vwa7 T G 17: 35,023,430 S503R probably benign Het
Washc5 G A 15: 59,350,142 T135M probably damaging Het
Wdr6 T C 9: 108,574,123 I854V probably benign Het
Zfp507 A G 7: 35,793,723 C632R probably damaging Het
Other mutations in Dnaja4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02977:Dnaja4 APN 9 54714510 missense possibly damaging 0.93
PIT4305001:Dnaja4 UTSW 9 54710634 missense probably benign 0.01
R4837:Dnaja4 UTSW 9 54710644 missense probably benign 0.00
R5087:Dnaja4 UTSW 9 54699739 missense probably damaging 0.99
R5862:Dnaja4 UTSW 9 54699341 unclassified probably benign
R6722:Dnaja4 UTSW 9 54699754 missense probably damaging 0.99
R6985:Dnaja4 UTSW 9 54708395 missense probably benign 0.06
R7165:Dnaja4 UTSW 9 54709232 missense probably damaging 1.00
R7228:Dnaja4 UTSW 9 54714285 missense possibly damaging 0.88
R7762:Dnaja4 UTSW 9 54709210 missense probably benign 0.03
X0057:Dnaja4 UTSW 9 54699804 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACACCTGGCTGTGATCTACTTG -3'
(R):5'- TGTGCGCCATGATTAGCAG -3'

Sequencing Primer
(F):5'- TGGCTGTGATCTACTTGACTATTC -3'
(R):5'- CCATGATTAGCAGGGTGGGC -3'
Posted On2014-10-01