Incidental Mutation 'R0201:Osbpl6'
ID23605
Institutional Source Beutler Lab
Gene Symbol Osbpl6
Ensembl Gene ENSMUSG00000042359
Gene Nameoxysterol binding protein-like 6
Synonyms1110062M20Rik, ORP-6
MMRRC Submission 038458-MU
Accession Numbers

Genbank: NM_145525; MGI: 2139014

Is this an essential gene? Possibly non essential (E-score: 0.386) question?
Stock #R0201 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location76406508-76600647 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 76546042 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Alanine at position 87 (D87A)
Ref Sequence ENSEMBL: ENSMUSP00000077123 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077972] [ENSMUST00000111929] [ENSMUST00000111930] [ENSMUST00000184442]
Predicted Effect possibly damaging
Transcript: ENSMUST00000077972
AA Change: D87A

PolyPhen 2 Score 0.923 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000077123
Gene: ENSMUSG00000042359
AA Change: D87A

DomainStartEndE-ValueType
low complexity region 14 35 N/A INTRINSIC
PH 87 183 3.65e-7 SMART
low complexity region 200 211 N/A INTRINSIC
coiled coil region 255 285 N/A INTRINSIC
low complexity region 537 550 N/A INTRINSIC
Pfam:Oxysterol_BP 603 951 1.4e-135 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111929
AA Change: D87A

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000107560
Gene: ENSMUSG00000042359
AA Change: D87A

DomainStartEndE-ValueType
low complexity region 14 35 N/A INTRINSIC
PH 87 183 3.65e-7 SMART
low complexity region 200 211 N/A INTRINSIC
coiled coil region 255 285 N/A INTRINSIC
coiled coil region 441 472 N/A INTRINSIC
low complexity region 529 542 N/A INTRINSIC
Pfam:Oxysterol_BP 595 944 1.1e-139 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111930
AA Change: D87A

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000107561
Gene: ENSMUSG00000042359
AA Change: D87A

DomainStartEndE-ValueType
low complexity region 14 35 N/A INTRINSIC
PH 87 183 3.65e-7 SMART
low complexity region 200 211 N/A INTRINSIC
coiled coil region 255 285 N/A INTRINSIC
coiled coil region 410 441 N/A INTRINSIC
low complexity region 498 511 N/A INTRINSIC
Pfam:Oxysterol_BP 564 913 1e-139 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128034
Predicted Effect probably benign
Transcript: ENSMUST00000184442
SMART Domains Protein: ENSMUSP00000139363
Gene: ENSMUSG00000042359

DomainStartEndE-ValueType
Blast:PH 1 70 8e-41 BLAST
low complexity region 87 98 N/A INTRINSIC
coiled coil region 142 172 N/A INTRINSIC
coiled coil region 303 334 N/A INTRINSIC
low complexity region 391 404 N/A INTRINSIC
Pfam:Oxysterol_BP 457 794 2.6e-135 PFAM
Meta Mutation Damage Score 0.1018 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 94.2%
Validation Efficiency 97% (91/94)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the oxysterol-binding protein (OSBP) family, a group of intracellular lipid receptors. Most members contain an N-terminal pleckstrin homology domain and a highly conserved C-terminal OSBP-like sterol-binding domain. Transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
Allele List at MGI

All alleles(2) : Gene trapped(2)

 

Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamdec1 A G 14: 68,581,957 probably null Het
Adamts16 T A 13: 70,779,644 Q492L possibly damaging Het
Aplnr A G 2: 85,137,177 D182G probably damaging Het
Arnt2 G T 7: 84,361,659 S3* probably null Het
Asxl3 T C 18: 22,523,154 V1407A probably benign Het
Atg13 A T 2: 91,684,762 probably null Het
Atm A T 9: 53,454,279 probably benign Het
Birc6 T G 17: 74,609,327 V1746G possibly damaging Het
Cbln1 G T 8: 87,472,113 T43K probably benign Het
Cbx5 T C 15: 103,199,700 T173A probably damaging Het
Cc2d2a A G 5: 43,737,512 Y1437C probably damaging Het
Ccdc78 C A 17: 25,789,236 probably benign Het
Cd2bp2 A G 7: 127,193,828 Y341H probably damaging Het
Cdhr5 T A 7: 141,276,378 D88V probably damaging Het
Ces1f T A 8: 93,267,329 T275S probably null Het
Clca4a T C 3: 144,960,717 N458S probably benign Het
Cog5 A G 12: 31,839,841 K521R probably damaging Het
Csf2ra T A 19: 61,225,568 T305S probably benign Het
Csmd3 T A 15: 47,619,729 probably benign Het
Cts6 T A 13: 61,201,499 R132* probably null Het
D5Ertd579e G T 5: 36,616,465 N195K probably damaging Het
Ddx1 A G 12: 13,223,808 V606A probably damaging Het
Dip2b G A 15: 100,186,147 D884N probably damaging Het
Ehhadh A G 16: 21,773,493 probably null Het
Enpp1 T A 10: 24,653,917 T608S probably benign Het
Fancm T C 12: 65,101,632 Y674H probably damaging Het
Fat4 T A 3: 38,891,596 V1546D probably damaging Het
Fsd1 G A 17: 55,990,522 A158T probably benign Het
Fzd2 T A 11: 102,606,122 M464K probably damaging Het
Gjc2 A G 11: 59,177,590 F22S possibly damaging Het
Gm13101 T C 4: 143,964,890 E421G probably damaging Het
Gria2 T C 3: 80,707,838 Y445C probably damaging Het
Hsdl1 T A 8: 119,566,256 I147F possibly damaging Het
Ifi44 T C 3: 151,745,636 Y226C probably damaging Het
Il16 A G 7: 83,722,308 C97R probably damaging Het
Impg1 A T 9: 80,345,561 S369T probably damaging Het
Jmjd1c A G 10: 67,219,109 T390A unknown Het
Lgi1 A G 19: 38,301,293 E269G possibly damaging Het
Lrp6 G T 6: 134,450,897 Y1577* probably null Het
Lrrc74a G T 12: 86,761,773 probably benign Het
Man1c1 A T 4: 134,640,398 probably null Het
Map1lc3b A C 8: 121,590,550 Q9P possibly damaging Het
Mboat1 G A 13: 30,202,375 R124H probably benign Het
Mcu A G 10: 59,456,677 L60P probably damaging Het
Mrs2 G T 13: 25,018,534 Q75K probably benign Het
Muc2 CGTG CGTGTG 7: 141,699,185 probably null Het
Neb G A 2: 52,206,878 probably benign Het
Nlrp2 C T 7: 5,328,329 G356D probably benign Het
Notch3 A G 17: 32,156,148 probably benign Het
Npr2 A C 4: 43,641,617 S474R probably damaging Het
Nupl1 A G 14: 60,244,616 F100L probably benign Het
Pabpc2 A T 18: 39,775,307 M542L probably benign Het
Papln A G 12: 83,783,027 probably benign Het
Parpbp T C 10: 88,092,896 I561V possibly damaging Het
Pcdhb13 C T 18: 37,442,581 A4V probably benign Het
Pelp1 T C 11: 70,395,704 T533A possibly damaging Het
Poldip3 T A 15: 83,135,296 M182L probably benign Het
Por T C 5: 135,731,178 S240P possibly damaging Het
Pramef20 A T 4: 144,377,273 probably benign Het
Prss22 A T 17: 23,996,301 V167D probably damaging Het
Prss37 A C 6: 40,516,349 L61R probably damaging Het
Psmd1 C T 1: 86,118,616 T702M probably benign Het
Pxdn G T 12: 30,002,431 G869V possibly damaging Het
Rabgap1l A G 1: 160,453,745 probably benign Het
Rapgef6 T C 11: 54,619,941 V228A probably damaging Het
Rnf169 T C 7: 99,926,003 R462G possibly damaging Het
Rnft2 A G 5: 118,194,680 probably benign Het
Sgo2b T C 8: 63,926,636 D1054G probably benign Het
Sh3bgr T C 16: 96,228,517 probably benign Het
Slc12a4 A G 8: 105,945,350 V910A possibly damaging Het
Slc6a12 A T 6: 121,355,372 I222F probably benign Het
Spty2d1 G A 7: 46,997,901 R427* probably null Het
Ssc5d A G 7: 4,944,663 T1339A probably benign Het
Sspo A C 6: 48,455,752 E854A possibly damaging Het
Stx7 A G 10: 24,185,079 probably benign Het
Styk1 A T 6: 131,301,730 probably benign Het
Tex33 T A 15: 78,378,828 M209L probably damaging Het
Tmem163 T G 1: 127,668,637 probably benign Het
Tmppe C CT 9: 114,404,639 probably null Het
Tmx2 A G 2: 84,673,082 V229A probably benign Het
Top2b T C 14: 16,383,174 L54P probably damaging Het
Trim62 A T 4: 128,902,550 Y280F probably benign Het
Tssk4 A T 14: 55,651,559 K181* probably null Het
Tssk4 A T 14: 55,651,560 K181M probably damaging Het
Ubn1 A G 16: 5,064,614 D313G probably damaging Het
Ugt1a10 C T 1: 88,215,123 P113L probably damaging Het
Ugt1a10 C T 1: 88,218,249 P473L probably damaging Het
Other mutations in Osbpl6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00391:Osbpl6 APN 2 76590439 missense probably damaging 1.00
IGL01109:Osbpl6 APN 2 76549527 missense probably damaging 1.00
IGL01288:Osbpl6 APN 2 76564823 missense probably damaging 0.98
IGL01717:Osbpl6 APN 2 76588594 missense probably damaging 1.00
IGL02146:Osbpl6 APN 2 76549750 missense possibly damaging 0.90
IGL02597:Osbpl6 APN 2 76555974 nonsense probably null
IGL02652:Osbpl6 APN 2 76593454 missense probably damaging 1.00
IGL02867:Osbpl6 APN 2 76595870 splice site probably benign
IGL03143:Osbpl6 APN 2 76548372 missense probably damaging 1.00
3-1:Osbpl6 UTSW 2 76586151 missense probably damaging 1.00
R0085:Osbpl6 UTSW 2 76593414 missense probably benign 0.30
R0573:Osbpl6 UTSW 2 76590391 missense probably damaging 1.00
R0644:Osbpl6 UTSW 2 76594840 missense probably damaging 1.00
R0855:Osbpl6 UTSW 2 76585133 missense probably damaging 1.00
R0855:Osbpl6 UTSW 2 76591839 missense probably damaging 1.00
R1017:Osbpl6 UTSW 2 76549719 missense probably damaging 1.00
R1459:Osbpl6 UTSW 2 76555065 missense probably benign 0.01
R1505:Osbpl6 UTSW 2 76579242 missense probably damaging 1.00
R1588:Osbpl6 UTSW 2 76579216 missense probably benign
R1786:Osbpl6 UTSW 2 76586214 missense probably damaging 1.00
R1863:Osbpl6 UTSW 2 76585058 missense probably damaging 1.00
R2131:Osbpl6 UTSW 2 76586214 missense probably damaging 1.00
R2132:Osbpl6 UTSW 2 76586214 missense probably damaging 1.00
R2133:Osbpl6 UTSW 2 76586214 missense probably damaging 1.00
R2233:Osbpl6 UTSW 2 76586769 missense probably damaging 0.99
R2235:Osbpl6 UTSW 2 76586769 missense probably damaging 0.99
R2256:Osbpl6 UTSW 2 76584474 missense probably damaging 1.00
R2294:Osbpl6 UTSW 2 76577079 missense possibly damaging 0.81
R3023:Osbpl6 UTSW 2 76586733 missense probably damaging 1.00
R4192:Osbpl6 UTSW 2 76585229 missense probably damaging 1.00
R4544:Osbpl6 UTSW 2 76584492 missense possibly damaging 0.84
R4546:Osbpl6 UTSW 2 76584492 missense possibly damaging 0.84
R4664:Osbpl6 UTSW 2 76568208 missense probably benign 0.02
R4764:Osbpl6 UTSW 2 76546000 missense probably damaging 1.00
R4884:Osbpl6 UTSW 2 76549539 missense probably damaging 1.00
R5080:Osbpl6 UTSW 2 76524085 missense probably benign 0.31
R5430:Osbpl6 UTSW 2 76586138 missense probably damaging 1.00
R5614:Osbpl6 UTSW 2 76568109 missense probably damaging 1.00
R5807:Osbpl6 UTSW 2 76584513 missense probably damaging 0.98
R5956:Osbpl6 UTSW 2 76549512 missense probably damaging 1.00
R6394:Osbpl6 UTSW 2 76555954 missense probably benign 0.00
R6430:Osbpl6 UTSW 2 76579276 missense probably damaging 1.00
R6450:Osbpl6 UTSW 2 76564830 missense possibly damaging 0.90
R7116:Osbpl6 UTSW 2 76595881 missense probably benign 0.06
R7385:Osbpl6 UTSW 2 76549450 missense probably damaging 1.00
R7422:Osbpl6 UTSW 2 76593386 missense probably damaging 1.00
R7561:Osbpl6 UTSW 2 76586154 missense probably damaging 1.00
R7829:Osbpl6 UTSW 2 76593387 missense probably damaging 1.00
Z1177:Osbpl6 UTSW 2 76540179 missense probably benign 0.01
Z31818:Osbpl6 UTSW 2 76555082 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGAGCGTGGCATCAAAGGTGAC -3'
(R):5'- ACAGCTTTCTCCTCAGAGCCACAG -3'

Sequencing Primer
(F):5'- AAGGTGACTTTCTGCCTAAGACC -3'
(R):5'- ctccctctctcttccccc -3'
Posted On2013-04-16