Incidental Mutation 'R2139:Nav3'
ID236054
Institutional Source Beutler Lab
Gene Symbol Nav3
Ensembl Gene ENSMUSG00000020181
Gene Nameneuron navigator 3
SynonymsPOMFIL1, 9630020C08Rik, 4732483H20Rik, unc53H3, steerin 3, Pomfil1p
MMRRC Submission 040142-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2139 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location109681259-110456204 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 109853135 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 427 (N427S)
Ref Sequence ENSEMBL: ENSMUSP00000032719 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032719]
Predicted Effect probably benign
Transcript: ENSMUST00000032719
AA Change: N427S

PolyPhen 2 Score 0.225 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000032719
Gene: ENSMUSG00000020181
AA Change: N427S

DomainStartEndE-ValueType
CH 79 182 4.41e-12 SMART
low complexity region 184 194 N/A INTRINSIC
low complexity region 318 329 N/A INTRINSIC
low complexity region 353 363 N/A INTRINSIC
low complexity region 427 439 N/A INTRINSIC
low complexity region 522 536 N/A INTRINSIC
low complexity region 713 724 N/A INTRINSIC
low complexity region 807 818 N/A INTRINSIC
low complexity region 873 896 N/A INTRINSIC
low complexity region 904 916 N/A INTRINSIC
low complexity region 1077 1095 N/A INTRINSIC
low complexity region 1160 1173 N/A INTRINSIC
low complexity region 1207 1229 N/A INTRINSIC
low complexity region 1256 1266 N/A INTRINSIC
low complexity region 1274 1285 N/A INTRINSIC
low complexity region 1293 1312 N/A INTRINSIC
low complexity region 1327 1341 N/A INTRINSIC
low complexity region 1383 1397 N/A INTRINSIC
low complexity region 1462 1474 N/A INTRINSIC
low complexity region 1550 1563 N/A INTRINSIC
coiled coil region 1565 1656 N/A INTRINSIC
low complexity region 1675 1692 N/A INTRINSIC
low complexity region 1722 1733 N/A INTRINSIC
low complexity region 1756 1781 N/A INTRINSIC
low complexity region 1782 1795 N/A INTRINSIC
coiled coil region 1801 1842 N/A INTRINSIC
low complexity region 1848 1871 N/A INTRINSIC
AAA 2029 2184 4.94e-7 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the neuron navigator family and is expressed predominantly in the nervous system. The encoded protein contains coiled-coil domains and a conserved AAA domain characteristic for ATPases associated with a variety of cellular activities. This gene is similar to unc-53, a Caenorhabditis elegans gene involved in axon guidance. Multiple alternatively spliced transcript variants for this gene have been described but only one has had its full-length nature determined. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931429L15Rik A T 9: 46,304,295 F318I probably damaging Het
Bfsp2 T C 9: 103,449,875 K221R probably benign Het
Cacna1b A C 2: 24,679,473 M813R probably benign Het
Chaf1a T C 17: 56,065,226 L798P probably damaging Het
Chd8 G A 14: 52,236,971 T201I probably benign Het
Col23a1 T C 11: 51,574,034 S436P probably benign Het
Cubn T C 2: 13,336,167 I2248V probably benign Het
Cyp4f39 A G 17: 32,491,189 I440M probably benign Het
Dhcr24 G T 4: 106,572,302 E191* probably null Het
Dlg5 T C 14: 24,170,544 D522G probably damaging Het
Dnaja4 A T 9: 54,709,222 M170L probably benign Het
Dopey2 T C 16: 93,771,007 S1441P possibly damaging Het
Egr2 T A 10: 67,540,872 S383T probably damaging Het
Elovl1 A G 4: 118,431,106 D94G probably damaging Het
Erbb4 A G 1: 68,346,629 V267A probably damaging Het
Esp38 T A 17: 39,953,384 I11N probably damaging Het
Esrrb T C 12: 86,421,966 probably null Het
Fbxo24 A T 5: 137,613,065 S488T probably damaging Het
Fgfr1 T G 8: 25,570,866 V618G probably damaging Het
Gak C T 5: 108,606,877 probably null Het
Gm11639 C T 11: 104,751,911 T1120I possibly damaging Het
Gpr61 A T 3: 108,150,761 C195S probably damaging Het
Greb1l A C 18: 10,555,011 N1686H probably damaging Het
Hapln4 T C 8: 70,088,138 F274L probably benign Het
Hoxc10 A T 15: 102,967,477 Q207L probably benign Het
Hspa12a A G 19: 58,799,482 V636A probably benign Het
Il1f8 A G 2: 24,154,660 N24S probably benign Het
Il22ra2 T A 10: 19,632,870 F215L probably benign Het
Kank1 G A 19: 25,411,753 G930D probably benign Het
Kif13a T C 13: 46,752,469 D666G possibly damaging Het
Krt86 A T 15: 101,473,758 I70F probably benign Het
Lgi4 A T 7: 31,063,123 I112F probably damaging Het
Lrrc8c T G 5: 105,606,692 I111S probably damaging Het
Ltbp2 T C 12: 84,815,979 N600S probably damaging Het
Marc1 G A 1: 184,795,435 T276I probably benign Het
Mbd3l2 A T 9: 18,444,958 D193V probably damaging Het
Mroh5 T A 15: 73,790,091 D417V probably damaging Het
Ms4a18 A T 19: 10,997,331 V332D possibly damaging Het
Muc4 T A 16: 32,761,225 I2488N unknown Het
Myrf C G 19: 10,216,467 A532P probably damaging Het
Neb T C 2: 52,212,588 S4315G probably damaging Het
Nyap2 A G 1: 81,241,268 D335G probably damaging Het
Olfm4 T C 14: 80,014,315 L225P probably benign Het
Olfr1199 T A 2: 88,756,093 N194I probably damaging Het
Olfr283 T C 15: 98,378,264 N282S probably damaging Het
Olfr419 A T 1: 174,250,736 probably null Het
Olfr616 A T 7: 103,564,754 I175K possibly damaging Het
Pcdhac2 T G 18: 37,146,086 Y706* probably null Het
Pgbd1 A G 13: 21,423,020 S335P probably damaging Het
Pkhd1l1 A C 15: 44,529,818 I1850L possibly damaging Het
Pogz T C 3: 94,871,007 V304A possibly damaging Het
Rap1a T C 3: 105,739,540 I100V probably damaging Het
Slc4a4 A T 5: 89,046,264 K201M probably damaging Het
Slc6a1 T C 6: 114,304,061 F8S possibly damaging Het
St18 T G 1: 6,810,615 M444R possibly damaging Het
Syna G T 5: 134,559,252 S281* probably null Het
Tgm1 A G 14: 55,709,543 V336A probably damaging Het
Tle6 G T 10: 81,594,034 T400K probably damaging Het
Tmem181a T C 17: 6,298,206 W328R probably damaging Het
Trim7 T C 11: 48,838,894 F193L probably benign Het
Txndc16 A T 14: 45,172,589 M178K probably damaging Het
Unc80 C T 1: 66,521,581 H823Y possibly damaging Het
Vmn1r74 A G 7: 11,847,316 Y181C probably damaging Het
Vmn2r56 T A 7: 12,712,963 K421* probably null Het
Vwa7 T G 17: 35,023,430 S503R probably benign Het
Washc5 G A 15: 59,350,142 T135M probably damaging Het
Wdr6 T C 9: 108,574,123 I854V probably benign Het
Zfp507 A G 7: 35,793,723 C632R probably damaging Het
Other mutations in Nav3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00095:Nav3 APN 10 109841733 missense probably damaging 0.99
IGL00425:Nav3 APN 10 109703507 missense probably benign 0.13
IGL00465:Nav3 APN 10 109852746 missense probably damaging 0.99
IGL00531:Nav3 APN 10 109703310 missense probably null 0.99
IGL00575:Nav3 APN 10 109764765 missense probably damaging 0.98
IGL00770:Nav3 APN 10 109816263 missense probably damaging 1.00
IGL00774:Nav3 APN 10 109816263 missense probably damaging 1.00
IGL00858:Nav3 APN 10 109742632 missense probably damaging 0.98
IGL00935:Nav3 APN 10 109705666 missense probably benign
IGL01638:Nav3 APN 10 109852863 missense probably damaging 1.00
IGL01662:Nav3 APN 10 109769258 missense possibly damaging 0.56
IGL01670:Nav3 APN 10 109714241 missense possibly damaging 0.92
IGL01885:Nav3 APN 10 109742660 nonsense probably null
IGL01979:Nav3 APN 10 109704929 missense probably benign 0.01
IGL02121:Nav3 APN 10 109759036 missense probably damaging 0.99
IGL02210:Nav3 APN 10 109766990 missense probably benign
IGL02523:Nav3 APN 10 109769296 missense probably damaging 1.00
IGL02573:Nav3 APN 10 109866974 missense probably benign 0.23
IGL02633:Nav3 APN 10 109692136 missense probably benign 0.09
IGL02810:Nav3 APN 10 109816274 missense probably damaging 1.00
IGL02964:Nav3 APN 10 109736953 missense probably damaging 0.99
IGL03015:Nav3 APN 10 109718297 missense probably damaging 0.98
IGL03288:Nav3 APN 10 109759017 missense probably damaging 1.00
IGL03310:Nav3 APN 10 109824572 critical splice donor site probably null
PIT4377001:Nav3 UTSW 10 109716605 missense probably damaging 0.99
R0010:Nav3 UTSW 10 109823226 splice site probably benign
R0043:Nav3 UTSW 10 109767518 missense possibly damaging 0.95
R0053:Nav3 UTSW 10 109766917 splice site probably benign
R0053:Nav3 UTSW 10 109766917 splice site probably benign
R0077:Nav3 UTSW 10 109716642 missense possibly damaging 0.87
R0219:Nav3 UTSW 10 109866930 critical splice donor site probably null
R0310:Nav3 UTSW 10 109767128 missense possibly damaging 0.82
R0380:Nav3 UTSW 10 109758879 splice site probably benign
R0403:Nav3 UTSW 10 109767103 missense probably damaging 0.98
R0480:Nav3 UTSW 10 109853300 missense probably damaging 1.00
R0626:Nav3 UTSW 10 109823464 missense probably damaging 1.00
R0637:Nav3 UTSW 10 109770197 missense probably benign 0.25
R0847:Nav3 UTSW 10 109903857 missense possibly damaging 0.94
R0988:Nav3 UTSW 10 109716528 missense probably damaging 1.00
R1272:Nav3 UTSW 10 109736999 missense probably damaging 0.98
R1295:Nav3 UTSW 10 109692102 missense probably damaging 1.00
R1405:Nav3 UTSW 10 109770333 splice site probably benign
R1406:Nav3 UTSW 10 109883634 missense possibly damaging 0.64
R1406:Nav3 UTSW 10 109883634 missense possibly damaging 0.64
R1420:Nav3 UTSW 10 109823254 missense probably benign 0.02
R1449:Nav3 UTSW 10 109853511 missense probably benign 0.13
R1458:Nav3 UTSW 10 109720044 missense probably damaging 1.00
R1469:Nav3 UTSW 10 109760508 missense probably damaging 1.00
R1469:Nav3 UTSW 10 109760508 missense probably damaging 1.00
R1472:Nav3 UTSW 10 109727941 missense probably damaging 0.99
R1537:Nav3 UTSW 10 109866985 missense probably damaging 1.00
R1539:Nav3 UTSW 10 109767170 missense probably damaging 0.99
R1581:Nav3 UTSW 10 109823428 missense probably damaging 1.00
R1586:Nav3 UTSW 10 109853254 missense probably damaging 1.00
R1654:Nav3 UTSW 10 109853123 missense possibly damaging 0.85
R1725:Nav3 UTSW 10 109823590 missense probably damaging 1.00
R1742:Nav3 UTSW 10 109769213 missense probably benign
R1793:Nav3 UTSW 10 109703372 missense probably benign 0.00
R1830:Nav3 UTSW 10 109823323 missense probably damaging 1.00
R1834:Nav3 UTSW 10 109720022 missense probably damaging 0.99
R1881:Nav3 UTSW 10 109852559 missense probably damaging 0.96
R1922:Nav3 UTSW 10 109705606 missense probably benign 0.43
R1944:Nav3 UTSW 10 109716530 missense probably damaging 0.99
R1981:Nav3 UTSW 10 109719090 splice site probably benign
R1985:Nav3 UTSW 10 109770184 splice site probably benign
R1996:Nav3 UTSW 10 109853401 missense probably damaging 1.00
R2051:Nav3 UTSW 10 109824675 missense probably damaging 0.99
R2062:Nav3 UTSW 10 109720021 missense probably damaging 1.00
R2248:Nav3 UTSW 10 109696227 missense probably damaging 1.00
R2420:Nav3 UTSW 10 109863813 missense probably damaging 0.98
R2444:Nav3 UTSW 10 109764915 missense probably benign 0.09
R3026:Nav3 UTSW 10 109824604 missense probably damaging 0.99
R3052:Nav3 UTSW 10 109903752 missense probably damaging 0.99
R3441:Nav3 UTSW 10 109704928 missense probably benign 0.01
R3845:Nav3 UTSW 10 109853376 missense possibly damaging 0.82
R3929:Nav3 UTSW 10 109684203 missense probably damaging 1.00
R3932:Nav3 UTSW 10 109694035 missense probably damaging 0.99
R4056:Nav3 UTSW 10 109880533 critical splice donor site probably null
R4057:Nav3 UTSW 10 109880533 critical splice donor site probably null
R4120:Nav3 UTSW 10 109903744 critical splice donor site probably null
R4244:Nav3 UTSW 10 109769296 missense probably damaging 1.00
R4361:Nav3 UTSW 10 109852986 missense probably damaging 1.00
R4512:Nav3 UTSW 10 109694082 missense possibly damaging 0.89
R4514:Nav3 UTSW 10 109694082 missense possibly damaging 0.89
R4700:Nav3 UTSW 10 109764935 missense probably benign 0.10
R4815:Nav3 UTSW 10 109823552 missense probably benign
R4981:Nav3 UTSW 10 109880692 missense probably benign
R5042:Nav3 UTSW 10 109769268 missense probably benign 0.27
R5251:Nav3 UTSW 10 109853253 missense probably damaging 0.99
R5252:Nav3 UTSW 10 109714291 small deletion probably benign
R5273:Nav3 UTSW 10 109693038 critical splice donor site probably null
R5288:Nav3 UTSW 10 109853105 missense probably benign 0.10
R5407:Nav3 UTSW 10 109866935 missense probably benign 0.28
R5533:Nav3 UTSW 10 109883678 missense possibly damaging 0.61
R5561:Nav3 UTSW 10 109716552 missense probably damaging 1.00
R5577:Nav3 UTSW 10 109769403 missense probably damaging 1.00
R5656:Nav3 UTSW 10 109764633 missense probably damaging 0.96
R5872:Nav3 UTSW 10 109764787 missense probably damaging 1.00
R6023:Nav3 UTSW 10 109823515 missense possibly damaging 0.95
R6061:Nav3 UTSW 10 109866984 nonsense probably null
R6189:Nav3 UTSW 10 109720019 missense probably damaging 0.98
R6214:Nav3 UTSW 10 109852565 missense probably damaging 1.00
R6215:Nav3 UTSW 10 109852565 missense probably damaging 1.00
R6264:Nav3 UTSW 10 109688833 missense probably damaging 0.97
R6500:Nav3 UTSW 10 109764756 missense probably damaging 1.00
R6524:Nav3 UTSW 10 109720030 missense probably damaging 0.99
R6868:Nav3 UTSW 10 109693166 missense possibly damaging 0.49
R7079:Nav3 UTSW 10 109767292 missense probably benign 0.16
R7099:Nav3 UTSW 10 109703334 missense probably benign 0.11
R7139:Nav3 UTSW 10 109853477 missense probably benign 0.44
R7238:Nav3 UTSW 10 109853324 missense possibly damaging 0.75
R7338:Nav3 UTSW 10 109769212 missense probably benign 0.04
R7343:Nav3 UTSW 10 109903758 missense probably damaging 0.98
R7383:Nav3 UTSW 10 109716671 missense probably damaging 0.98
R7391:Nav3 UTSW 10 109703456 missense probably benign 0.07
R7399:Nav3 UTSW 10 109852934 missense possibly damaging 0.74
R7457:Nav3 UTSW 10 109696328 nonsense probably null
R7462:Nav3 UTSW 10 109823578 missense probably damaging 1.00
R7542:Nav3 UTSW 10 109823533 missense possibly damaging 0.89
R7659:Nav3 UTSW 10 109766990 missense probably benign 0.09
R7749:Nav3 UTSW 10 109703352 missense probably damaging 0.99
R7794:Nav3 UTSW 10 109688856 missense probably benign 0.08
R7876:Nav3 UTSW 10 109853498 missense probably benign 0.26
R8048:Nav3 UTSW 10 109764918 missense probably benign 0.13
R8104:Nav3 UTSW 10 109758967 missense probably damaging 0.99
R8125:Nav3 UTSW 10 109852659 missense probably damaging 0.99
R8275:Nav3 UTSW 10 109692123 missense noncoding transcript
R8325:Nav3 UTSW 10 109705603 missense probably benign 0.24
R8336:Nav3 UTSW 10 109767569 missense probably damaging 0.99
R8523:Nav3 UTSW 10 109823277 missense probably damaging 1.00
R8529:Nav3 UTSW 10 109853331 missense probably benign 0.09
X0012:Nav3 UTSW 10 109692097 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAGCCTGGCTTTGGAATTCC -3'
(R):5'- AAGGGGTCAAAAGCGCTCC -3'

Sequencing Primer
(F):5'- CCACTGGACGATGGAATTAAGCTTTC -3'
(R):5'- GCTCCTTCGGGACAGAAATCTATG -3'
Posted On2014-10-01