Incidental Mutation 'R2139:Dlg5'
ID236063
Institutional Source Beutler Lab
Gene Symbol Dlg5
Ensembl Gene ENSMUSG00000021782
Gene Namediscs large MAGUK scaffold protein 5
Synonyms4933429D20Rik
MMRRC Submission 040142-MU
Accession Numbers

Genbank: NM_001163513; MGI: 1918478

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2139 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location24133953-24245920 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 24170544 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 522 (D522G)
Ref Sequence ENSEMBL: ENSMUSP00000073367 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042009] [ENSMUST00000073687] [ENSMUST00000090398]
Predicted Effect probably damaging
Transcript: ENSMUST00000042009
AA Change: D191G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000044852
Gene: ENSMUSG00000021782
AA Change: D191G

DomainStartEndE-ValueType
coiled coil region 20 247 N/A INTRINSIC
low complexity region 261 274 N/A INTRINSIC
PDZ 279 356 2.02e-10 SMART
PDZ 364 447 9.5e-16 SMART
low complexity region 510 517 N/A INTRINSIC
low complexity region 692 711 N/A INTRINSIC
low complexity region 903 918 N/A INTRINSIC
PDZ 1009 1080 2.1e-17 SMART
PDZ 1164 1236 2.97e-8 SMART
SH3 1250 1314 3.73e-7 SMART
low complexity region 1338 1358 N/A INTRINSIC
GuKc 1375 1561 5.43e-53 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000073687
AA Change: D522G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000073367
Gene: ENSMUSG00000021782
AA Change: D522G

DomainStartEndE-ValueType
low complexity region 8 19 N/A INTRINSIC
low complexity region 22 36 N/A INTRINSIC
low complexity region 44 66 N/A INTRINSIC
Pfam:Takusan 104 191 1.4e-27 PFAM
coiled coil region 308 578 N/A INTRINSIC
low complexity region 592 605 N/A INTRINSIC
PDZ 610 687 2.02e-10 SMART
PDZ 695 773 1.25e-15 SMART
low complexity region 836 843 N/A INTRINSIC
low complexity region 1018 1037 N/A INTRINSIC
low complexity region 1229 1244 N/A INTRINSIC
PDZ 1335 1406 2.1e-17 SMART
PDZ 1490 1562 2.97e-8 SMART
SH3 1576 1640 3.73e-7 SMART
low complexity region 1664 1684 N/A INTRINSIC
GuKc 1701 1887 5.43e-53 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000090398
AA Change: D545G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000087879
Gene: ENSMUSG00000021782
AA Change: D545G

DomainStartEndE-ValueType
low complexity region 8 19 N/A INTRINSIC
low complexity region 22 36 N/A INTRINSIC
low complexity region 44 66 N/A INTRINSIC
low complexity region 109 123 N/A INTRINSIC
Pfam:Takusan 128 213 6e-33 PFAM
coiled coil region 331 601 N/A INTRINSIC
low complexity region 615 628 N/A INTRINSIC
PDZ 633 710 2.02e-10 SMART
PDZ 718 796 1.25e-15 SMART
low complexity region 859 866 N/A INTRINSIC
low complexity region 1041 1060 N/A INTRINSIC
low complexity region 1252 1267 N/A INTRINSIC
PDZ 1358 1429 2.1e-17 SMART
PDZ 1513 1585 2.97e-8 SMART
SH3 1599 1663 3.73e-7 SMART
low complexity region 1687 1707 N/A INTRINSIC
GuKc 1724 1910 5.43e-53 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224920
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the family of discs large (DLG) homologs, a subset of the membrane-associated guanylate kinase (MAGUK) superfamily. The MAGUK proteins are composed of a catalytically inactive guanylate kinase domain, in addition to PDZ and SH3 domains, and are thought to function as scaffolding molecules at sites of cell-cell contact. The protein encoded by this gene localizes to the plasma membrane and cytoplasm, and interacts with components of adherens junctions and the cytoskeleton. It is proposed to function in the transmission of extracellular signals to the cytoskeleton and in the maintenance of epithelial cell structure. Alternative splice variants have been described but their biological nature has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit growth retardation, hydroencephaly, abnormal brain morphology, abnormal neurogenesis, kidney cysts, ureter defects, and abnormal kidney morphology. [provided by MGI curators]
Allele List at MGI

All alleles(19) : Targeted, other(1) Gene trapped(18)

Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931429L15Rik A T 9: 46,304,295 F318I probably damaging Het
Bfsp2 T C 9: 103,449,875 K221R probably benign Het
Cacna1b A C 2: 24,679,473 M813R probably benign Het
Chaf1a T C 17: 56,065,226 L798P probably damaging Het
Chd8 G A 14: 52,236,971 T201I probably benign Het
Col23a1 T C 11: 51,574,034 S436P probably benign Het
Cubn T C 2: 13,336,167 I2248V probably benign Het
Cyp4f39 A G 17: 32,491,189 I440M probably benign Het
Dhcr24 G T 4: 106,572,302 E191* probably null Het
Dnaja4 A T 9: 54,709,222 M170L probably benign Het
Dopey2 T C 16: 93,771,007 S1441P possibly damaging Het
Egr2 T A 10: 67,540,872 S383T probably damaging Het
Elovl1 A G 4: 118,431,106 D94G probably damaging Het
Erbb4 A G 1: 68,346,629 V267A probably damaging Het
Esp38 T A 17: 39,953,384 I11N probably damaging Het
Esrrb T C 12: 86,421,966 probably null Het
Fbxo24 A T 5: 137,613,065 S488T probably damaging Het
Fgfr1 T G 8: 25,570,866 V618G probably damaging Het
Gak C T 5: 108,606,877 probably null Het
Gm11639 C T 11: 104,751,911 T1120I possibly damaging Het
Gpr61 A T 3: 108,150,761 C195S probably damaging Het
Greb1l A C 18: 10,555,011 N1686H probably damaging Het
Hapln4 T C 8: 70,088,138 F274L probably benign Het
Hoxc10 A T 15: 102,967,477 Q207L probably benign Het
Hspa12a A G 19: 58,799,482 V636A probably benign Het
Il1f8 A G 2: 24,154,660 N24S probably benign Het
Il22ra2 T A 10: 19,632,870 F215L probably benign Het
Kank1 G A 19: 25,411,753 G930D probably benign Het
Kif13a T C 13: 46,752,469 D666G possibly damaging Het
Krt86 A T 15: 101,473,758 I70F probably benign Het
Lgi4 A T 7: 31,063,123 I112F probably damaging Het
Lrrc8c T G 5: 105,606,692 I111S probably damaging Het
Ltbp2 T C 12: 84,815,979 N600S probably damaging Het
Marc1 G A 1: 184,795,435 T276I probably benign Het
Mbd3l2 A T 9: 18,444,958 D193V probably damaging Het
Mroh5 T A 15: 73,790,091 D417V probably damaging Het
Ms4a18 A T 19: 10,997,331 V332D possibly damaging Het
Muc4 T A 16: 32,761,225 I2488N unknown Het
Myrf C G 19: 10,216,467 A532P probably damaging Het
Nav3 T C 10: 109,853,135 N427S probably benign Het
Neb T C 2: 52,212,588 S4315G probably damaging Het
Nyap2 A G 1: 81,241,268 D335G probably damaging Het
Olfm4 T C 14: 80,014,315 L225P probably benign Het
Olfr1199 T A 2: 88,756,093 N194I probably damaging Het
Olfr283 T C 15: 98,378,264 N282S probably damaging Het
Olfr419 A T 1: 174,250,736 probably null Het
Olfr616 A T 7: 103,564,754 I175K possibly damaging Het
Pcdhac2 T G 18: 37,146,086 Y706* probably null Het
Pgbd1 A G 13: 21,423,020 S335P probably damaging Het
Pkhd1l1 A C 15: 44,529,818 I1850L possibly damaging Het
Pogz T C 3: 94,871,007 V304A possibly damaging Het
Rap1a T C 3: 105,739,540 I100V probably damaging Het
Slc4a4 A T 5: 89,046,264 K201M probably damaging Het
Slc6a1 T C 6: 114,304,061 F8S possibly damaging Het
St18 T G 1: 6,810,615 M444R possibly damaging Het
Syna G T 5: 134,559,252 S281* probably null Het
Tgm1 A G 14: 55,709,543 V336A probably damaging Het
Tle6 G T 10: 81,594,034 T400K probably damaging Het
Tmem181a T C 17: 6,298,206 W328R probably damaging Het
Trim7 T C 11: 48,838,894 F193L probably benign Het
Txndc16 A T 14: 45,172,589 M178K probably damaging Het
Unc80 C T 1: 66,521,581 H823Y possibly damaging Het
Vmn1r74 A G 7: 11,847,316 Y181C probably damaging Het
Vmn2r56 T A 7: 12,712,963 K421* probably null Het
Vwa7 T G 17: 35,023,430 S503R probably benign Het
Washc5 G A 15: 59,350,142 T135M probably damaging Het
Wdr6 T C 9: 108,574,123 I854V probably benign Het
Zfp507 A G 7: 35,793,723 C632R probably damaging Het
Other mutations in Dlg5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00160:Dlg5 APN 14 24191161 missense probably damaging 0.99
IGL00164:Dlg5 APN 14 24158464 missense possibly damaging 0.89
IGL00767:Dlg5 APN 14 24165285 missense probably damaging 1.00
IGL01284:Dlg5 APN 14 24146197 missense probably damaging 1.00
IGL01328:Dlg5 APN 14 24202351 missense probably damaging 0.98
IGL01532:Dlg5 APN 14 24158592 missense probably benign
IGL01621:Dlg5 APN 14 24148221 missense probably damaging 1.00
IGL01649:Dlg5 APN 14 24138691 missense probably damaging 1.00
IGL01733:Dlg5 APN 14 24170449 missense probably damaging 1.00
IGL02048:Dlg5 APN 14 24172203 missense possibly damaging 0.87
IGL02103:Dlg5 APN 14 24144346 missense probably damaging 1.00
IGL02138:Dlg5 APN 14 24158351 missense probably benign
IGL02146:Dlg5 APN 14 24202361 missense probably damaging 0.99
IGL02392:Dlg5 APN 14 24150209 missense probably damaging 1.00
IGL02427:Dlg5 APN 14 24166207 missense probably damaging 1.00
IGL02643:Dlg5 APN 14 24191182 missense probably damaging 1.00
IGL02649:Dlg5 APN 14 24146251 missense probably damaging 0.96
IGL02933:Dlg5 APN 14 24158499 missense probably benign 0.06
IGL02965:Dlg5 APN 14 24172023 missense probably damaging 1.00
IGL02988:Dlg5 APN 14 24166255 missense probably damaging 1.00
IGL03351:Dlg5 APN 14 24170454 missense probably benign 0.03
R0123:Dlg5 UTSW 14 24147206 missense probably benign
R0131:Dlg5 UTSW 14 24138649 missense probably damaging 1.00
R0709:Dlg5 UTSW 14 24146255 missense probably damaging 1.00
R0920:Dlg5 UTSW 14 24176397 missense probably damaging 1.00
R0924:Dlg5 UTSW 14 24135577 missense probably damaging 1.00
R0930:Dlg5 UTSW 14 24135577 missense probably damaging 1.00
R0981:Dlg5 UTSW 14 24154631 missense probably damaging 1.00
R1402:Dlg5 UTSW 14 24176608 missense probably benign 0.06
R1402:Dlg5 UTSW 14 24176608 missense probably benign 0.06
R1438:Dlg5 UTSW 14 24154605 missense possibly damaging 0.94
R1449:Dlg5 UTSW 14 24135643 missense possibly damaging 0.82
R1465:Dlg5 UTSW 14 24154696 splice site probably null
R1465:Dlg5 UTSW 14 24154696 splice site probably null
R1543:Dlg5 UTSW 14 24144448 missense probably damaging 1.00
R1824:Dlg5 UTSW 14 24149444 missense probably benign 0.28
R1899:Dlg5 UTSW 14 24148300 missense probably damaging 1.00
R1920:Dlg5 UTSW 14 24176571 missense probably damaging 1.00
R1921:Dlg5 UTSW 14 24176571 missense probably damaging 1.00
R1951:Dlg5 UTSW 14 24156469 splice site probably benign
R1968:Dlg5 UTSW 14 24164119 nonsense probably null
R2049:Dlg5 UTSW 14 24154647 missense probably damaging 1.00
R2070:Dlg5 UTSW 14 24136635 missense probably damaging 1.00
R2117:Dlg5 UTSW 14 24177758 nonsense probably null
R2153:Dlg5 UTSW 14 24137157 missense probably damaging 1.00
R2283:Dlg5 UTSW 14 24158663 missense probably benign 0.00
R2293:Dlg5 UTSW 14 24158112 missense probably benign
R2356:Dlg5 UTSW 14 24170428 critical splice donor site probably null
R2362:Dlg5 UTSW 14 24158687 missense probably benign 0.04
R2513:Dlg5 UTSW 14 24164525 missense probably damaging 1.00
R3084:Dlg5 UTSW 14 24166190 missense probably damaging 1.00
R3086:Dlg5 UTSW 14 24166190 missense probably damaging 1.00
R3750:Dlg5 UTSW 14 24165260 missense probably damaging 1.00
R3780:Dlg5 UTSW 14 24190310 unclassified probably benign
R3782:Dlg5 UTSW 14 24190310 unclassified probably benign
R3828:Dlg5 UTSW 14 24146158 missense probably damaging 0.99
R4079:Dlg5 UTSW 14 24148260 missense possibly damaging 0.94
R4393:Dlg5 UTSW 14 24177989 critical splice acceptor site probably null
R4615:Dlg5 UTSW 14 24158168 missense probably damaging 1.00
R4664:Dlg5 UTSW 14 24137181 missense possibly damaging 0.90
R4712:Dlg5 UTSW 14 24177983 missense possibly damaging 0.94
R4796:Dlg5 UTSW 14 24144383 missense probably damaging 1.00
R4801:Dlg5 UTSW 14 24154689 missense probably damaging 1.00
R4802:Dlg5 UTSW 14 24154689 missense probably damaging 1.00
R4946:Dlg5 UTSW 14 24154361 missense probably damaging 0.99
R5022:Dlg5 UTSW 14 24136622 missense probably damaging 1.00
R5023:Dlg5 UTSW 14 24136622 missense probably damaging 1.00
R5057:Dlg5 UTSW 14 24136622 missense probably damaging 1.00
R5234:Dlg5 UTSW 14 24192862 missense probably damaging 0.98
R5561:Dlg5 UTSW 14 24177792 missense probably benign 0.03
R5567:Dlg5 UTSW 14 24192913 nonsense probably null
R5570:Dlg5 UTSW 14 24192913 nonsense probably null
R5640:Dlg5 UTSW 14 24170461 missense probably damaging 1.00
R5646:Dlg5 UTSW 14 24158699 missense probably damaging 1.00
R5711:Dlg5 UTSW 14 24150648 missense probably damaging 1.00
R5810:Dlg5 UTSW 14 24146254 missense probably damaging 0.99
R5900:Dlg5 UTSW 14 24149447 missense probably damaging 1.00
R5964:Dlg5 UTSW 14 24164089 missense probably benign
R6190:Dlg5 UTSW 14 24190438 missense probably damaging 0.99
R6240:Dlg5 UTSW 14 24149528 intron probably null
R6276:Dlg5 UTSW 14 24164568 missense probably damaging 1.00
R6339:Dlg5 UTSW 14 24158060 missense probably damaging 1.00
R6508:Dlg5 UTSW 14 24138706 missense probably benign 0.45
R6527:Dlg5 UTSW 14 24190448 missense possibly damaging 0.73
R6593:Dlg5 UTSW 14 24150652 missense probably benign 0.01
R6687:Dlg5 UTSW 14 24190373 missense probably damaging 1.00
R6965:Dlg5 UTSW 14 24149430 missense probably damaging 1.00
R7051:Dlg5 UTSW 14 24146195 missense possibly damaging 0.93
R7075:Dlg5 UTSW 14 24177797 missense possibly damaging 0.49
R7149:Dlg5 UTSW 14 24190424 missense probably benign 0.00
R7182:Dlg5 UTSW 14 24244856 missense
R7203:Dlg5 UTSW 14 24138655 missense probably damaging 1.00
R7216:Dlg5 UTSW 14 24136638 nonsense probably null
R7359:Dlg5 UTSW 14 24164547 missense probably damaging 1.00
R7466:Dlg5 UTSW 14 24245212 missense probably damaging 1.00
R7485:Dlg5 UTSW 14 24148322 missense probably benign
R7485:Dlg5 UTSW 14 24177839 missense probably damaging 0.98
R7629:Dlg5 UTSW 14 24245212 missense probably damaging 1.00
R7666:Dlg5 UTSW 14 24157799 missense probably damaging 1.00
R7804:Dlg5 UTSW 14 24165320 missense possibly damaging 0.46
RF005:Dlg5 UTSW 14 24158493 nonsense probably null
YA93:Dlg5 UTSW 14 24155133 unclassified probably benign
Z1088:Dlg5 UTSW 14 24158094 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTCTAGACAGAAGCCCTGC -3'
(R):5'- ACTGAAGCTCACCAAGTGG -3'

Sequencing Primer
(F):5'- ACAGAAGCCCTGCCCAGG -3'
(R):5'- TCTCACTGAGGCCTGACTG -3'
Posted On2014-10-01