Mutagenetix > Incidental Mutations

Incidental Mutation 'R2139:Dlg5'

236063

Institutional Source

Beutler Lab

Gene Symbol

Dlg5

Ensembl Gene

ENSMUSG00000021782

Gene Name

discs large MAGUK scaffold protein 5

Synonyms

4933429D20Rik

MMRRC Submission

040142-MU

Accession Numbers

Genbank: NM_001163513; MGI: 1918478

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R2139 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

24133953-24245920 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 24170544 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 522 (D522G)

Ref Sequence

ENSEMBL: ENSMUSP00000073367 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000042009] [ENSMUST00000073687] [ENSMUST00000090398]

Predicted Effect

probably damaging
Transcript: ENSMUST00000042009
AA Change: D191G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000044852
Gene: ENSMUSG00000021782
AA Change: D191G

Domain	Start	End	E-Value	Type
coiled coil region	20	247	N/A	INTRINSIC
low complexity region	261	274	N/A	INTRINSIC
PDZ	279	356	2.02e-10	SMART
PDZ	364	447	9.5e-16	SMART
low complexity region	510	517	N/A	INTRINSIC
low complexity region	692	711	N/A	INTRINSIC
low complexity region	903	918	N/A	INTRINSIC
PDZ	1009	1080	2.1e-17	SMART
PDZ	1164	1236	2.97e-8	SMART
SH3	1250	1314	3.73e-7	SMART
low complexity region	1338	1358	N/A	INTRINSIC
GuKc	1375	1561	5.43e-53	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000073687
AA Change: D522G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000073367
Gene: ENSMUSG00000021782
AA Change: D522G

Domain	Start	End	E-Value	Type
low complexity region	8	19	N/A	INTRINSIC
low complexity region	22	36	N/A	INTRINSIC
low complexity region	44	66	N/A	INTRINSIC
Pfam:Takusan	104	191	1.4e-27	PFAM
coiled coil region	308	578	N/A	INTRINSIC
low complexity region	592	605	N/A	INTRINSIC
PDZ	610	687	2.02e-10	SMART
PDZ	695	773	1.25e-15	SMART
low complexity region	836	843	N/A	INTRINSIC
low complexity region	1018	1037	N/A	INTRINSIC
low complexity region	1229	1244	N/A	INTRINSIC
PDZ	1335	1406	2.1e-17	SMART
PDZ	1490	1562	2.97e-8	SMART
SH3	1576	1640	3.73e-7	SMART
low complexity region	1664	1684	N/A	INTRINSIC
GuKc	1701	1887	5.43e-53	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000090398
AA Change: D545G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000087879
Gene: ENSMUSG00000021782
AA Change: D545G

Domain	Start	End	E-Value	Type
low complexity region	8	19	N/A	INTRINSIC
low complexity region	22	36	N/A	INTRINSIC
low complexity region	44	66	N/A	INTRINSIC
low complexity region	109	123	N/A	INTRINSIC
Pfam:Takusan	128	213	6e-33	PFAM
coiled coil region	331	601	N/A	INTRINSIC
low complexity region	615	628	N/A	INTRINSIC
PDZ	633	710	2.02e-10	SMART
PDZ	718	796	1.25e-15	SMART
low complexity region	859	866	N/A	INTRINSIC
low complexity region	1041	1060	N/A	INTRINSIC
low complexity region	1252	1267	N/A	INTRINSIC
PDZ	1358	1429	2.1e-17	SMART
PDZ	1513	1585	2.97e-8	SMART
SH3	1599	1663	3.73e-7	SMART
low complexity region	1687	1707	N/A	INTRINSIC
GuKc	1724	1910	5.43e-53	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000224920

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 95.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the family of discs large (DLG) homologs, a subset of the membrane-associated guanylate kinase (MAGUK) superfamily. The MAGUK proteins are composed of a catalytically inactive guanylate kinase domain, in addition to PDZ and SH3 domains, and are thought to function as scaffolding molecules at sites of cell-cell contact. The protein encoded by this gene localizes to the plasma membrane and cytoplasm, and interacts with components of adherens junctions and the cytoskeleton. It is proposed to function in the transmission of extracellular signals to the cytoskeleton and in the maintenance of epithelial cell structure. Alternative splice variants have been described but their biological nature has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit growth retardation, hydroencephaly, abnormal brain morphology, abnormal neurogenesis, kidney cysts, ureter defects, and abnormal kidney morphology. [provided by MGI curators]

Allele List at MGI

All alleles(19) : Targeted, other(1) Gene trapped(18)

Other mutations in this stock

Total: 68 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4931429L15Rik	A	T	9: 46,304,295	F318I	probably damaging	Het
Bfsp2	T	C	9: 103,449,875	K221R	probably benign	Het
Cacna1b	A	C	2: 24,679,473	M813R	probably benign	Het
Chaf1a	T	C	17: 56,065,226	L798P	probably damaging	Het
Chd8	G	A	14: 52,236,971	T201I	probably benign	Het
Col23a1	T	C	11: 51,574,034	S436P	probably benign	Het
Cubn	T	C	2: 13,336,167	I2248V	probably benign	Het
Cyp4f39	A	G	17: 32,491,189	I440M	probably benign	Het
Dhcr24	G	T	4: 106,572,302	E191*	probably null	Het
Dnaja4	A	T	9: 54,709,222	M170L	probably benign	Het
Dopey2	T	C	16: 93,771,007	S1441P	possibly damaging	Het
Egr2	T	A	10: 67,540,872	S383T	probably damaging	Het
Elovl1	A	G	4: 118,431,106	D94G	probably damaging	Het
Erbb4	A	G	1: 68,346,629	V267A	probably damaging	Het
Esp38	T	A	17: 39,953,384	I11N	probably damaging	Het
Esrrb	T	C	12: 86,421,966		probably null	Het
Fbxo24	A	T	5: 137,613,065	S488T	probably damaging	Het
Fgfr1	T	G	8: 25,570,866	V618G	probably damaging	Het
Gak	C	T	5: 108,606,877		probably null	Het
Gm11639	C	T	11: 104,751,911	T1120I	possibly damaging	Het
Gpr61	A	T	3: 108,150,761	C195S	probably damaging	Het
Greb1l	A	C	18: 10,555,011	N1686H	probably damaging	Het
Hapln4	T	C	8: 70,088,138	F274L	probably benign	Het
Hoxc10	A	T	15: 102,967,477	Q207L	probably benign	Het
Hspa12a	A	G	19: 58,799,482	V636A	probably benign	Het
Il1f8	A	G	2: 24,154,660	N24S	probably benign	Het
Il22ra2	T	A	10: 19,632,870	F215L	probably benign	Het
Kank1	G	A	19: 25,411,753	G930D	probably benign	Het
Kif13a	T	C	13: 46,752,469	D666G	possibly damaging	Het
Krt86	A	T	15: 101,473,758	I70F	probably benign	Het
Lgi4	A	T	7: 31,063,123	I112F	probably damaging	Het
Lrrc8c	T	G	5: 105,606,692	I111S	probably damaging	Het
Ltbp2	T	C	12: 84,815,979	N600S	probably damaging	Het
Marc1	G	A	1: 184,795,435	T276I	probably benign	Het
Mbd3l2	A	T	9: 18,444,958	D193V	probably damaging	Het
Mroh5	T	A	15: 73,790,091	D417V	probably damaging	Het
Ms4a18	A	T	19: 10,997,331	V332D	possibly damaging	Het
Muc4	T	A	16: 32,761,225	I2488N	unknown	Het
Myrf	C	G	19: 10,216,467	A532P	probably damaging	Het
Nav3	T	C	10: 109,853,135	N427S	probably benign	Het
Neb	T	C	2: 52,212,588	S4315G	probably damaging	Het
Nyap2	A	G	1: 81,241,268	D335G	probably damaging	Het
Olfm4	T	C	14: 80,014,315	L225P	probably benign	Het
Olfr1199	T	A	2: 88,756,093	N194I	probably damaging	Het
Olfr283	T	C	15: 98,378,264	N282S	probably damaging	Het
Olfr419	A	T	1: 174,250,736		probably null	Het
Olfr616	A	T	7: 103,564,754	I175K	possibly damaging	Het
Pcdhac2	T	G	18: 37,146,086	Y706*	probably null	Het
Pgbd1	A	G	13: 21,423,020	S335P	probably damaging	Het
Pkhd1l1	A	C	15: 44,529,818	I1850L	possibly damaging	Het
Pogz	T	C	3: 94,871,007	V304A	possibly damaging	Het
Rap1a	T	C	3: 105,739,540	I100V	probably damaging	Het
Slc4a4	A	T	5: 89,046,264	K201M	probably damaging	Het
Slc6a1	T	C	6: 114,304,061	F8S	possibly damaging	Het
St18	T	G	1: 6,810,615	M444R	possibly damaging	Het
Syna	G	T	5: 134,559,252	S281*	probably null	Het
Tgm1	A	G	14: 55,709,543	V336A	probably damaging	Het
Tle6	G	T	10: 81,594,034	T400K	probably damaging	Het
Tmem181a	T	C	17: 6,298,206	W328R	probably damaging	Het
Trim7	T	C	11: 48,838,894	F193L	probably benign	Het
Txndc16	A	T	14: 45,172,589	M178K	probably damaging	Het
Unc80	C	T	1: 66,521,581	H823Y	possibly damaging	Het
Vmn1r74	A	G	7: 11,847,316	Y181C	probably damaging	Het
Vmn2r56	T	A	7: 12,712,963	K421*	probably null	Het
Vwa7	T	G	17: 35,023,430	S503R	probably benign	Het
Washc5	G	A	15: 59,350,142	T135M	probably damaging	Het
Wdr6	T	C	9: 108,574,123	I854V	probably benign	Het
Zfp507	A	G	7: 35,793,723	C632R	probably damaging	Het

Other mutations in Dlg5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00160:Dlg5	APN	14	24191161	missense	probably damaging	0.99
IGL00164:Dlg5	APN	14	24158464	missense	possibly damaging	0.89
IGL00767:Dlg5	APN	14	24165285	missense	probably damaging	1.00
IGL01284:Dlg5	APN	14	24146197	missense	probably damaging	1.00
IGL01328:Dlg5	APN	14	24202351	missense	probably damaging	0.98
IGL01532:Dlg5	APN	14	24158592	missense	probably benign
IGL01621:Dlg5	APN	14	24148221	missense	probably damaging	1.00
IGL01649:Dlg5	APN	14	24138691	missense	probably damaging	1.00
IGL01733:Dlg5	APN	14	24170449	missense	probably damaging	1.00
IGL02048:Dlg5	APN	14	24172203	missense	possibly damaging	0.87
IGL02103:Dlg5	APN	14	24144346	missense	probably damaging	1.00
IGL02138:Dlg5	APN	14	24158351	missense	probably benign
IGL02146:Dlg5	APN	14	24202361	missense	probably damaging	0.99
IGL02392:Dlg5	APN	14	24150209	missense	probably damaging	1.00
IGL02427:Dlg5	APN	14	24166207	missense	probably damaging	1.00
IGL02643:Dlg5	APN	14	24191182	missense	probably damaging	1.00
IGL02649:Dlg5	APN	14	24146251	missense	probably damaging	0.96
IGL02933:Dlg5	APN	14	24158499	missense	probably benign	0.06
IGL02965:Dlg5	APN	14	24172023	missense	probably damaging	1.00
IGL02988:Dlg5	APN	14	24166255	missense	probably damaging	1.00
IGL03351:Dlg5	APN	14	24170454	missense	probably benign	0.03
R0123:Dlg5	UTSW	14	24147206	missense	probably benign
R0131:Dlg5	UTSW	14	24138649	missense	probably damaging	1.00
R0709:Dlg5	UTSW	14	24146255	missense	probably damaging	1.00
R0920:Dlg5	UTSW	14	24176397	missense	probably damaging	1.00
R0924:Dlg5	UTSW	14	24135577	missense	probably damaging	1.00
R0930:Dlg5	UTSW	14	24135577	missense	probably damaging	1.00
R0981:Dlg5	UTSW	14	24154631	missense	probably damaging	1.00
R1402:Dlg5	UTSW	14	24176608	missense	probably benign	0.06
R1402:Dlg5	UTSW	14	24176608	missense	probably benign	0.06
R1438:Dlg5	UTSW	14	24154605	missense	possibly damaging	0.94
R1449:Dlg5	UTSW	14	24135643	missense	possibly damaging	0.82
R1465:Dlg5	UTSW	14	24154696	splice site	probably null
R1465:Dlg5	UTSW	14	24154696	splice site	probably null
R1543:Dlg5	UTSW	14	24144448	missense	probably damaging	1.00
R1824:Dlg5	UTSW	14	24149444	missense	probably benign	0.28
R1899:Dlg5	UTSW	14	24148300	missense	probably damaging	1.00
R1920:Dlg5	UTSW	14	24176571	missense	probably damaging	1.00
R1921:Dlg5	UTSW	14	24176571	missense	probably damaging	1.00
R1951:Dlg5	UTSW	14	24156469	splice site	probably benign
R1968:Dlg5	UTSW	14	24164119	nonsense	probably null
R2049:Dlg5	UTSW	14	24154647	missense	probably damaging	1.00
R2070:Dlg5	UTSW	14	24136635	missense	probably damaging	1.00
R2117:Dlg5	UTSW	14	24177758	nonsense	probably null
R2153:Dlg5	UTSW	14	24137157	missense	probably damaging	1.00
R2283:Dlg5	UTSW	14	24158663	missense	probably benign	0.00
R2293:Dlg5	UTSW	14	24158112	missense	probably benign
R2356:Dlg5	UTSW	14	24170428	critical splice donor site	probably null
R2362:Dlg5	UTSW	14	24158687	missense	probably benign	0.04
R2513:Dlg5	UTSW	14	24164525	missense	probably damaging	1.00
R3084:Dlg5	UTSW	14	24166190	missense	probably damaging	1.00
R3086:Dlg5	UTSW	14	24166190	missense	probably damaging	1.00
R3750:Dlg5	UTSW	14	24165260	missense	probably damaging	1.00
R3780:Dlg5	UTSW	14	24190310	unclassified	probably benign
R3782:Dlg5	UTSW	14	24190310	unclassified	probably benign
R3828:Dlg5	UTSW	14	24146158	missense	probably damaging	0.99
R4079:Dlg5	UTSW	14	24148260	missense	possibly damaging	0.94
R4393:Dlg5	UTSW	14	24177989	critical splice acceptor site	probably null
R4615:Dlg5	UTSW	14	24158168	missense	probably damaging	1.00
R4664:Dlg5	UTSW	14	24137181	missense	possibly damaging	0.90
R4712:Dlg5	UTSW	14	24177983	missense	possibly damaging	0.94
R4796:Dlg5	UTSW	14	24144383	missense	probably damaging	1.00
R4801:Dlg5	UTSW	14	24154689	missense	probably damaging	1.00
R4802:Dlg5	UTSW	14	24154689	missense	probably damaging	1.00
R4946:Dlg5	UTSW	14	24154361	missense	probably damaging	0.99
R5022:Dlg5	UTSW	14	24136622	missense	probably damaging	1.00
R5023:Dlg5	UTSW	14	24136622	missense	probably damaging	1.00
R5057:Dlg5	UTSW	14	24136622	missense	probably damaging	1.00
R5234:Dlg5	UTSW	14	24192862	missense	probably damaging	0.98
R5561:Dlg5	UTSW	14	24177792	missense	probably benign	0.03
R5567:Dlg5	UTSW	14	24192913	nonsense	probably null
R5570:Dlg5	UTSW	14	24192913	nonsense	probably null
R5640:Dlg5	UTSW	14	24170461	missense	probably damaging	1.00
R5646:Dlg5	UTSW	14	24158699	missense	probably damaging	1.00
R5711:Dlg5	UTSW	14	24150648	missense	probably damaging	1.00
R5810:Dlg5	UTSW	14	24146254	missense	probably damaging	0.99
R5900:Dlg5	UTSW	14	24149447	missense	probably damaging	1.00
R5964:Dlg5	UTSW	14	24164089	missense	probably benign
R6190:Dlg5	UTSW	14	24190438	missense	probably damaging	0.99
R6240:Dlg5	UTSW	14	24149528	intron	probably null
R6276:Dlg5	UTSW	14	24164568	missense	probably damaging	1.00
R6339:Dlg5	UTSW	14	24158060	missense	probably damaging	1.00
R6508:Dlg5	UTSW	14	24138706	missense	probably benign	0.45
R6527:Dlg5	UTSW	14	24190448	missense	possibly damaging	0.73
R6593:Dlg5	UTSW	14	24150652	missense	probably benign	0.01
R6687:Dlg5	UTSW	14	24190373	missense	probably damaging	1.00
R6965:Dlg5	UTSW	14	24149430	missense	probably damaging	1.00
R7051:Dlg5	UTSW	14	24146195	missense	possibly damaging	0.93
R7075:Dlg5	UTSW	14	24177797	missense	possibly damaging	0.49
R7149:Dlg5	UTSW	14	24190424	missense	probably benign	0.00
R7182:Dlg5	UTSW	14	24244856	missense
R7203:Dlg5	UTSW	14	24138655	missense	probably damaging	1.00
R7216:Dlg5	UTSW	14	24136638	nonsense	probably null
R7359:Dlg5	UTSW	14	24164547	missense	probably damaging	1.00
R7466:Dlg5	UTSW	14	24245212	missense	probably damaging	1.00
R7485:Dlg5	UTSW	14	24148322	missense	probably benign
R7485:Dlg5	UTSW	14	24177839	missense	probably damaging	0.98
R7629:Dlg5	UTSW	14	24245212	missense	probably damaging	1.00
R7666:Dlg5	UTSW	14	24157799	missense	probably damaging	1.00
R7804:Dlg5	UTSW	14	24165320	missense	possibly damaging	0.46
RF005:Dlg5	UTSW	14	24158493	nonsense	probably null
YA93:Dlg5	UTSW	14	24155133	unclassified	probably benign
Z1088:Dlg5	UTSW	14	24158094	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGTCTAGACAGAAGCCCTGC -3'
(R):5'- ACTGAAGCTCACCAAGTGG -3'

Sequencing Primer
(F):5'- ACAGAAGCCCTGCCCAGG -3'
(R):5'- TCTCACTGAGGCCTGACTG -3'

Posted On

2014-10-01