Mutagenetix > Incidental Mutation

Incidental Mutation 'R2139:Greb1l'

236084

Institutional Source

Beutler Lab

Gene Symbol

Greb1l

Ensembl Gene

ENSMUSG00000042942

Gene Name

growth regulation by estrogen in breast cancer-like

Synonyms

AK220484, mKIAA4095

MMRRC Submission

040142-MU

Accession Numbers

Genbank: NM_001083628; MGI: 3576497

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R2139 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

10325177-10562934 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to C at 10555011 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Histidine at position 1686 (N1686H)

Ref Sequence

ENSEMBL: ENSMUSP00000049003 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000048977]

AlphaFold

B9EJV3

Predicted Effect

probably damaging
Transcript: ENSMUST00000048977
AA Change: N1686H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000049003
Gene: ENSMUSG00000042942
AA Change: N1686H

Domain	Start	End	E-Value	Type
Pfam:GREB1	1	1172	N/A	PFAM
Pfam:GREB1	1154	1913	N/A	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000122744

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000173261

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 95.0%

Validation Efficiency

Allele List at MGI

All alleles(5) : Targeted, other(2) Gene trapped(3)

Other mutations in this stock

Total: 68 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4931429L15Rik	A	T	9: 46,304,295	F318I	probably damaging	Het
Bfsp2	T	C	9: 103,449,875	K221R	probably benign	Het
Cacna1b	A	C	2: 24,679,473	M813R	probably benign	Het
Chaf1a	T	C	17: 56,065,226	L798P	probably damaging	Het
Chd8	G	A	14: 52,236,971	T201I	probably benign	Het
Col23a1	T	C	11: 51,574,034	S436P	probably benign	Het
Cubn	T	C	2: 13,336,167	I2248V	probably benign	Het
Cyp4f39	A	G	17: 32,491,189	I440M	probably benign	Het
Dhcr24	G	T	4: 106,572,302	E191*	probably null	Het
Dlg5	T	C	14: 24,170,544	D522G	probably damaging	Het
Dnaja4	A	T	9: 54,709,222	M170L	probably benign	Het
Dopey2	T	C	16: 93,771,007	S1441P	possibly damaging	Het
Egr2	T	A	10: 67,540,872	S383T	probably damaging	Het
Elovl1	A	G	4: 118,431,106	D94G	probably damaging	Het
Erbb4	A	G	1: 68,346,629	V267A	probably damaging	Het
Esp38	T	A	17: 39,953,384	I11N	probably damaging	Het
Esrrb	T	C	12: 86,421,966		probably null	Het
Fbxo24	A	T	5: 137,613,065	S488T	probably damaging	Het
Fgfr1	T	G	8: 25,570,866	V618G	probably damaging	Het
Gak	C	T	5: 108,606,877		probably null	Het
Gm11639	C	T	11: 104,751,911	T1120I	possibly damaging	Het
Gpr61	A	T	3: 108,150,761	C195S	probably damaging	Het
Hapln4	T	C	8: 70,088,138	F274L	probably benign	Het
Hoxc10	A	T	15: 102,967,477	Q207L	probably benign	Het
Hspa12a	A	G	19: 58,799,482	V636A	probably benign	Het
Il1f8	A	G	2: 24,154,660	N24S	probably benign	Het
Il22ra2	T	A	10: 19,632,870	F215L	probably benign	Het
Kank1	G	A	19: 25,411,753	G930D	probably benign	Het
Kif13a	T	C	13: 46,752,469	D666G	possibly damaging	Het
Krt86	A	T	15: 101,473,758	I70F	probably benign	Het
Lgi4	A	T	7: 31,063,123	I112F	probably damaging	Het
Lrrc8c	T	G	5: 105,606,692	I111S	probably damaging	Het
Ltbp2	T	C	12: 84,815,979	N600S	probably damaging	Het
Marc1	G	A	1: 184,795,435	T276I	probably benign	Het
Mbd3l2	A	T	9: 18,444,958	D193V	probably damaging	Het
Mroh5	T	A	15: 73,790,091	D417V	probably damaging	Het
Ms4a18	A	T	19: 10,997,331	V332D	possibly damaging	Het
Muc4	T	A	16: 32,761,225	I2488N	unknown	Het
Myrf	C	G	19: 10,216,467	A532P	probably damaging	Het
Nav3	T	C	10: 109,853,135	N427S	probably benign	Het
Neb	T	C	2: 52,212,588	S4315G	probably damaging	Het
Nyap2	A	G	1: 81,241,268	D335G	probably damaging	Het
Olfm4	T	C	14: 80,014,315	L225P	probably benign	Het
Olfr1199	T	A	2: 88,756,093	N194I	probably damaging	Het
Olfr283	T	C	15: 98,378,264	N282S	probably damaging	Het
Olfr419	A	T	1: 174,250,736		probably null	Het
Olfr616	A	T	7: 103,564,754	I175K	possibly damaging	Het
Pcdhac2	T	G	18: 37,146,086	Y706*	probably null	Het
Pgbd1	A	G	13: 21,423,020	S335P	probably damaging	Het
Pkhd1l1	A	C	15: 44,529,818	I1850L	possibly damaging	Het
Pogz	T	C	3: 94,871,007	V304A	possibly damaging	Het
Rap1a	T	C	3: 105,739,540	I100V	probably damaging	Het
Slc4a4	A	T	5: 89,046,264	K201M	probably damaging	Het
Slc6a1	T	C	6: 114,304,061	F8S	possibly damaging	Het
St18	T	G	1: 6,810,615	M444R	possibly damaging	Het
Syna	G	T	5: 134,559,252	S281*	probably null	Het
Tgm1	A	G	14: 55,709,543	V336A	probably damaging	Het
Tle6	G	T	10: 81,594,034	T400K	probably damaging	Het
Tmem181a	T	C	17: 6,298,206	W328R	probably damaging	Het
Trim7	T	C	11: 48,838,894	F193L	probably benign	Het
Txndc16	A	T	14: 45,172,589	M178K	probably damaging	Het
Unc80	C	T	1: 66,521,581	H823Y	possibly damaging	Het
Vmn1r74	A	G	7: 11,847,316	Y181C	probably damaging	Het
Vmn2r56	T	A	7: 12,712,963	K421*	probably null	Het
Vwa7	T	G	17: 35,023,430	S503R	probably benign	Het
Washc5	G	A	15: 59,350,142	T135M	probably damaging	Het
Wdr6	T	C	9: 108,574,123	I854V	probably benign	Het
Zfp507	A	G	7: 35,793,723	C632R	probably damaging	Het

Other mutations in Greb1l

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00485:Greb1l	APN	18	10555962	missense	possibly damaging	0.90
IGL01554:Greb1l	APN	18	10522144	missense	probably benign	0.01
IGL01563:Greb1l	APN	18	10469399	missense	probably damaging	0.99
IGL01944:Greb1l	APN	18	10557280	missense	possibly damaging	0.91
IGL02110:Greb1l	APN	18	10515271	missense	probably damaging	1.00
IGL02249:Greb1l	APN	18	10532961	missense	probably damaging	1.00
IGL02318:Greb1l	APN	18	10469388	missense	possibly damaging	0.91
IGL02340:Greb1l	APN	18	10515200	missense	probably damaging	0.99
IGL02516:Greb1l	APN	18	10537064	missense	probably benign	0.31
IGL02566:Greb1l	APN	18	10503299	missense	probably damaging	0.99
IGL02583:Greb1l	APN	18	10542362	missense	probably damaging	1.00
IGL02838:Greb1l	APN	18	10560430	missense	probably damaging	1.00
A4554:Greb1l	UTSW	18	10532862	missense	possibly damaging	0.58
PIT4453001:Greb1l	UTSW	18	10533031	missense	probably damaging	0.98
PIT4453001:Greb1l	UTSW	18	10533032	missense	probably benign	0.08
R0099:Greb1l	UTSW	18	10509158	missense	probably damaging	1.00
R0226:Greb1l	UTSW	18	10522076	intron	probably benign
R0234:Greb1l	UTSW	18	10560331	missense	probably damaging	1.00
R0234:Greb1l	UTSW	18	10560331	missense	probably damaging	1.00
R0239:Greb1l	UTSW	18	10458567	splice site	probably benign
R0316:Greb1l	UTSW	18	10547420	missense	probably damaging	1.00
R0369:Greb1l	UTSW	18	10469375	missense	possibly damaging	0.80
R0394:Greb1l	UTSW	18	10523374	missense	probably damaging	0.99
R0478:Greb1l	UTSW	18	10509281	missense	probably damaging	1.00
R0555:Greb1l	UTSW	18	10458781	splice site	probably benign
R0671:Greb1l	UTSW	18	10474303	missense	probably damaging	1.00
R1282:Greb1l	UTSW	18	10547289	missense	probably benign	0.13
R1574:Greb1l	UTSW	18	10554997	missense	possibly damaging	0.95
R1574:Greb1l	UTSW	18	10554997	missense	possibly damaging	0.95
R1607:Greb1l	UTSW	18	10529703	missense	possibly damaging	0.85
R1666:Greb1l	UTSW	18	10501080	critical splice donor site	probably null
R1666:Greb1l	UTSW	18	10529708	critical splice donor site	probably null
R1720:Greb1l	UTSW	18	10553848	missense	probably benign	0.19
R1808:Greb1l	UTSW	18	10542143	missense	probably benign
R1829:Greb1l	UTSW	18	10509314	missense	probably damaging	1.00
R1897:Greb1l	UTSW	18	10498992	missense	probably benign	0.00
R1967:Greb1l	UTSW	18	10501049	missense	possibly damaging	0.91
R2025:Greb1l	UTSW	18	10515221	missense	possibly damaging	0.71
R2086:Greb1l	UTSW	18	10523281	missense	probably damaging	1.00
R2125:Greb1l	UTSW	18	10511422	missense	probably damaging	0.98
R2255:Greb1l	UTSW	18	10554857	missense	probably damaging	1.00
R2256:Greb1l	UTSW	18	10503307	missense	possibly damaging	0.91
R2257:Greb1l	UTSW	18	10503307	missense	possibly damaging	0.91
R2880:Greb1l	UTSW	18	10547288	missense	possibly damaging	0.93
R3623:Greb1l	UTSW	18	10542380	missense	probably damaging	0.99
R3778:Greb1l	UTSW	18	10469444	missense	possibly damaging	0.60
R3975:Greb1l	UTSW	18	10522247	missense	possibly damaging	0.71
R4038:Greb1l	UTSW	18	10515209	missense	possibly damaging	0.93
R4062:Greb1l	UTSW	18	10522150	missense	probably damaging	0.99
R4134:Greb1l	UTSW	18	10529708	critical splice donor site	probably null
R4342:Greb1l	UTSW	18	10544561	missense	probably benign	0.12
R4409:Greb1l	UTSW	18	10503182	missense	possibly damaging	0.70
R4600:Greb1l	UTSW	18	10553705	missense	probably damaging	1.00
R4618:Greb1l	UTSW	18	10498965	missense	probably benign	0.00
R4683:Greb1l	UTSW	18	10529563	splice site	probably null
R4686:Greb1l	UTSW	18	10522112	missense	probably damaging	0.98
R4707:Greb1l	UTSW	18	10532922	missense	probably benign	0.02
R4780:Greb1l	UTSW	18	10541792	missense	probably benign	0.00
R4819:Greb1l	UTSW	18	10458358	missense	probably damaging	1.00
R4925:Greb1l	UTSW	18	10547447	missense	possibly damaging	0.79
R4960:Greb1l	UTSW	18	10547306	missense	probably damaging	0.99
R5150:Greb1l	UTSW	18	10555950	frame shift	probably null
R5154:Greb1l	UTSW	18	10458312	missense	probably benign	0.02
R5269:Greb1l	UTSW	18	10511409	missense	probably benign
R5290:Greb1l	UTSW	18	10542427	missense	probably damaging	1.00
R5310:Greb1l	UTSW	18	10542427	missense	probably damaging	1.00
R5328:Greb1l	UTSW	18	10553720	missense	probably damaging	1.00
R5337:Greb1l	UTSW	18	10509143	missense	probably damaging	1.00
R5393:Greb1l	UTSW	18	10458312	missense	probably benign	0.02
R5402:Greb1l	UTSW	18	10537169	missense	probably benign	0.26
R5718:Greb1l	UTSW	18	10542427	missense	probably damaging	1.00
R5719:Greb1l	UTSW	18	10542427	missense	probably damaging	1.00
R5720:Greb1l	UTSW	18	10542427	missense	probably damaging	1.00
R5721:Greb1l	UTSW	18	10542427	missense	probably damaging	1.00
R5902:Greb1l	UTSW	18	10538302	missense	probably benign	0.00
R5993:Greb1l	UTSW	18	10544455	missense	probably benign	0.10
R6035:Greb1l	UTSW	18	10501025	missense	possibly damaging	0.91
R6035:Greb1l	UTSW	18	10501025	missense	possibly damaging	0.91
R6045:Greb1l	UTSW	18	10547068	missense	probably damaging	1.00
R6063:Greb1l	UTSW	18	10557340	missense	probably damaging	1.00
R6297:Greb1l	UTSW	18	10469494	missense	probably damaging	1.00
R6405:Greb1l	UTSW	18	10501076	missense	probably benign	0.30
R6552:Greb1l	UTSW	18	10541814	missense	probably benign	0.00
R6572:Greb1l	UTSW	18	10522131	missense	probably benign	0.07
R6575:Greb1l	UTSW	18	10547347	missense	possibly damaging	0.88
R6922:Greb1l	UTSW	18	10547482	missense	possibly damaging	0.88
R6957:Greb1l	UTSW	18	10558786	missense	probably benign	0.23
R6962:Greb1l	UTSW	18	10547327	missense	probably damaging	1.00
R7012:Greb1l	UTSW	18	10529707	critical splice donor site	probably null
R7179:Greb1l	UTSW	18	10544576	missense	probably benign	0.00
R7251:Greb1l	UTSW	18	10515319	missense	probably damaging	1.00
R7275:Greb1l	UTSW	18	10544561	missense	probably benign	0.12
R7301:Greb1l	UTSW	18	10544970	missense	probably damaging	1.00
R7307:Greb1l	UTSW	18	10538142	missense	probably damaging	0.99
R7455:Greb1l	UTSW	18	10554915	missense	probably damaging	1.00
R7832:Greb1l	UTSW	18	10542056	missense	probably benign	0.38
R7934:Greb1l	UTSW	18	10474371	nonsense	probably null
R8137:Greb1l	UTSW	18	10474357	missense	possibly damaging	0.77
R8138:Greb1l	UTSW	18	10533060	missense	probably benign	0.13
R8208:Greb1l	UTSW	18	10510703	missense	probably damaging	1.00
R8227:Greb1l	UTSW	18	10515371	missense	probably damaging	1.00
R8312:Greb1l	UTSW	18	10511587	intron	probably benign
R8331:Greb1l	UTSW	18	10458706	missense	possibly damaging	0.96
R8364:Greb1l	UTSW	18	10529687	missense	possibly damaging	0.85
R8389:Greb1l	UTSW	18	10529613	missense	probably benign	0.00
R8695:Greb1l	UTSW	18	10544450	missense	probably benign	0.01
R8795:Greb1l	UTSW	18	10553739	missense	probably damaging	0.98
R8836:Greb1l	UTSW	18	10509257	missense	probably benign	0.30
R8862:Greb1l	UTSW	18	10555042	missense	possibly damaging	0.90
R8872:Greb1l	UTSW	18	10529684	missense	probably benign	0.18
R8874:Greb1l	UTSW	18	10544896	missense	probably benign	0.01
R8886:Greb1l	UTSW	18	10553843	missense	probably benign	0.21
R8921:Greb1l	UTSW	18	10541825	missense	probably benign	0.01
R8997:Greb1l	UTSW	18	10510747	missense	probably damaging	1.00
R9015:Greb1l	UTSW	18	10541675	missense	probably benign	0.00
R9018:Greb1l	UTSW	18	10542004	missense	possibly damaging	0.76
R9074:Greb1l	UTSW	18	10532797	missense	probably damaging	1.00
R9074:Greb1l	UTSW	18	10558795	missense	probably damaging	1.00
R9117:Greb1l	UTSW	18	10542422	missense	probably benign	0.31
R9189:Greb1l	UTSW	18	10499983	missense	probably benign
R9332:Greb1l	UTSW	18	10532796	missense	possibly damaging	0.92
R9367:Greb1l	UTSW	18	10522130	missense	probably benign	0.00
R9497:Greb1l	UTSW	18	10458600	missense	probably benign	0.00
R9796:Greb1l	UTSW	18	10538233	missense	possibly damaging	0.69
Z1176:Greb1l	UTSW	18	10515305	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GGAATTTCCAGTAAGAATGTGTCC -3'
(R):5'- CAGAACAATATCAAGGGTCTACGTC -3'

Sequencing Primer
(F):5'- AATGTGTCCCTGAAGAGCGTC -3'
(R):5'- ATCAAGGGTCTACGTCATGCTAG -3'

Posted On

2014-10-01