Incidental Mutation 'R2139:Myrf'
ID236086
Institutional Source Beutler Lab
Gene Symbol Myrf
Ensembl Gene ENSMUSG00000036098
Gene Namemyelin regulatory factor
SynonymsGm98, LOC386531, LOC225908
MMRRC Submission 040142-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.899) question?
Stock #R2139 (G1)
Quality Score215
Status Not validated
Chromosome19
Chromosomal Location10208272-10240748 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to G at 10216467 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Proline at position 532 (A532P)
Ref Sequence ENSEMBL: ENSMUSP00000140871 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088013] [ENSMUST00000186056] [ENSMUST00000189897]
Predicted Effect probably damaging
Transcript: ENSMUST00000088013
AA Change: A734P

PolyPhen 2 Score 0.961 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000085329
Gene: ENSMUSG00000036098
AA Change: A734P

DomainStartEndE-ValueType
low complexity region 67 99 N/A INTRINSIC
low complexity region 177 199 N/A INTRINSIC
low complexity region 228 244 N/A INTRINSIC
low complexity region 285 306 N/A INTRINSIC
low complexity region 320 346 N/A INTRINSIC
Pfam:NDT80_PhoG 393 540 7.6e-31 PFAM
Pfam:Peptidase_S74 587 647 5.3e-16 PFAM
Pfam:MRF_C1 667 702 8.3e-26 PFAM
low complexity region 773 784 N/A INTRINSIC
low complexity region 847 884 N/A INTRINSIC
Pfam:MRF_C2 977 1111 1.4e-43 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000186056
AA Change: A532P

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000140871
Gene: ENSMUSG00000036098
AA Change: A532P

DomainStartEndE-ValueType
low complexity region 83 104 N/A INTRINSIC
low complexity region 118 144 N/A INTRINSIC
Pfam:NDT80_PhoG 191 338 6.9e-28 PFAM
Pfam:Peptidase_S74 385 445 1.2e-12 PFAM
Pfam:MRF_C1 465 500 1.4e-23 PFAM
low complexity region 571 582 N/A INTRINSIC
low complexity region 672 709 N/A INTRINSIC
Pfam:MRF_C2 801 936 7e-52 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000186854
AA Change: A99P
Predicted Effect probably damaging
Transcript: ENSMUST00000189897
AA Change: A734P

PolyPhen 2 Score 0.961 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000139601
Gene: ENSMUSG00000036098
AA Change: A734P

DomainStartEndE-ValueType
low complexity region 67 99 N/A INTRINSIC
low complexity region 177 199 N/A INTRINSIC
low complexity region 228 244 N/A INTRINSIC
low complexity region 285 306 N/A INTRINSIC
low complexity region 320 346 N/A INTRINSIC
Pfam:NDT80_PhoG 393 540 7.6e-31 PFAM
Pfam:Peptidase_S74 587 647 1.1e-15 PFAM
Pfam:MRF_C1 667 702 1.1e-26 PFAM
low complexity region 773 784 N/A INTRINSIC
low complexity region 847 884 N/A INTRINSIC
Pfam:MRF_C2 976 1111 5.5e-55 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190922
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transcription factor that is required for central nervous system myelination and may regulate oligodendrocyte differentiation. It is thought to act by increasing the expression of genes that effect myelin production but may also directly promote myelin gene expression. Loss of a similar gene in mouse models results in severe demyelination. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2014]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931429L15Rik A T 9: 46,304,295 F318I probably damaging Het
Bfsp2 T C 9: 103,449,875 K221R probably benign Het
Cacna1b A C 2: 24,679,473 M813R probably benign Het
Chaf1a T C 17: 56,065,226 L798P probably damaging Het
Chd8 G A 14: 52,236,971 T201I probably benign Het
Col23a1 T C 11: 51,574,034 S436P probably benign Het
Cubn T C 2: 13,336,167 I2248V probably benign Het
Cyp4f39 A G 17: 32,491,189 I440M probably benign Het
Dhcr24 G T 4: 106,572,302 E191* probably null Het
Dlg5 T C 14: 24,170,544 D522G probably damaging Het
Dnaja4 A T 9: 54,709,222 M170L probably benign Het
Dopey2 T C 16: 93,771,007 S1441P possibly damaging Het
Egr2 T A 10: 67,540,872 S383T probably damaging Het
Elovl1 A G 4: 118,431,106 D94G probably damaging Het
Erbb4 A G 1: 68,346,629 V267A probably damaging Het
Esp38 T A 17: 39,953,384 I11N probably damaging Het
Esrrb T C 12: 86,421,966 probably null Het
Fbxo24 A T 5: 137,613,065 S488T probably damaging Het
Fgfr1 T G 8: 25,570,866 V618G probably damaging Het
Gak C T 5: 108,606,877 probably null Het
Gm11639 C T 11: 104,751,911 T1120I possibly damaging Het
Gpr61 A T 3: 108,150,761 C195S probably damaging Het
Greb1l A C 18: 10,555,011 N1686H probably damaging Het
Hapln4 T C 8: 70,088,138 F274L probably benign Het
Hoxc10 A T 15: 102,967,477 Q207L probably benign Het
Hspa12a A G 19: 58,799,482 V636A probably benign Het
Il1f8 A G 2: 24,154,660 N24S probably benign Het
Il22ra2 T A 10: 19,632,870 F215L probably benign Het
Kank1 G A 19: 25,411,753 G930D probably benign Het
Kif13a T C 13: 46,752,469 D666G possibly damaging Het
Krt86 A T 15: 101,473,758 I70F probably benign Het
Lgi4 A T 7: 31,063,123 I112F probably damaging Het
Lrrc8c T G 5: 105,606,692 I111S probably damaging Het
Ltbp2 T C 12: 84,815,979 N600S probably damaging Het
Marc1 G A 1: 184,795,435 T276I probably benign Het
Mbd3l2 A T 9: 18,444,958 D193V probably damaging Het
Mroh5 T A 15: 73,790,091 D417V probably damaging Het
Ms4a18 A T 19: 10,997,331 V332D possibly damaging Het
Muc4 T A 16: 32,761,225 I2488N unknown Het
Nav3 T C 10: 109,853,135 N427S probably benign Het
Neb T C 2: 52,212,588 S4315G probably damaging Het
Nyap2 A G 1: 81,241,268 D335G probably damaging Het
Olfm4 T C 14: 80,014,315 L225P probably benign Het
Olfr1199 T A 2: 88,756,093 N194I probably damaging Het
Olfr283 T C 15: 98,378,264 N282S probably damaging Het
Olfr419 A T 1: 174,250,736 probably null Het
Olfr616 A T 7: 103,564,754 I175K possibly damaging Het
Pcdhac2 T G 18: 37,146,086 Y706* probably null Het
Pgbd1 A G 13: 21,423,020 S335P probably damaging Het
Pkhd1l1 A C 15: 44,529,818 I1850L possibly damaging Het
Pogz T C 3: 94,871,007 V304A possibly damaging Het
Rap1a T C 3: 105,739,540 I100V probably damaging Het
Slc4a4 A T 5: 89,046,264 K201M probably damaging Het
Slc6a1 T C 6: 114,304,061 F8S possibly damaging Het
St18 T G 1: 6,810,615 M444R possibly damaging Het
Syna G T 5: 134,559,252 S281* probably null Het
Tgm1 A G 14: 55,709,543 V336A probably damaging Het
Tle6 G T 10: 81,594,034 T400K probably damaging Het
Tmem181a T C 17: 6,298,206 W328R probably damaging Het
Trim7 T C 11: 48,838,894 F193L probably benign Het
Txndc16 A T 14: 45,172,589 M178K probably damaging Het
Unc80 C T 1: 66,521,581 H823Y possibly damaging Het
Vmn1r74 A G 7: 11,847,316 Y181C probably damaging Het
Vmn2r56 T A 7: 12,712,963 K421* probably null Het
Vwa7 T G 17: 35,023,430 S503R probably benign Het
Washc5 G A 15: 59,350,142 T135M probably damaging Het
Wdr6 T C 9: 108,574,123 I854V probably benign Het
Zfp507 A G 7: 35,793,723 C632R probably damaging Het
Other mutations in Myrf
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00330:Myrf APN 19 10224513 missense probably benign 0.30
IGL01132:Myrf APN 19 10223205 missense probably damaging 1.00
IGL01958:Myrf APN 19 10210378 unclassified probably benign
IGL02154:Myrf APN 19 10216118 missense probably damaging 0.98
IGL02370:Myrf APN 19 10214140 missense probably benign
IGL02584:Myrf APN 19 10212223 splice site probably benign
IGL02817:Myrf APN 19 10225452 missense probably benign 0.45
R0312:Myrf UTSW 19 10218162 missense probably benign 0.00
R0367:Myrf UTSW 19 10218162 missense probably benign 0.00
R0389:Myrf UTSW 19 10218162 missense probably benign 0.00
R0416:Myrf UTSW 19 10215812 critical splice acceptor site probably null
R0446:Myrf UTSW 19 10218162 missense probably benign 0.00
R0464:Myrf UTSW 19 10218162 missense probably benign 0.00
R0465:Myrf UTSW 19 10218162 missense probably benign 0.00
R0487:Myrf UTSW 19 10218162 missense probably benign 0.00
R0533:Myrf UTSW 19 10218162 missense probably benign 0.00
R0534:Myrf UTSW 19 10218162 missense probably benign 0.00
R0570:Myrf UTSW 19 10211797 missense probably damaging 1.00
R0622:Myrf UTSW 19 10223452 missense probably damaging 0.99
R0631:Myrf UTSW 19 10228882 missense probably benign 0.00
R0721:Myrf UTSW 19 10216080 missense probably damaging 1.00
R0848:Myrf UTSW 19 10218162 missense probably benign 0.00
R1056:Myrf UTSW 19 10223486 missense probably benign 0.11
R1574:Myrf UTSW 19 10225487 missense probably damaging 1.00
R1574:Myrf UTSW 19 10225487 missense probably damaging 1.00
R1801:Myrf UTSW 19 10214191 missense probably benign 0.03
R1897:Myrf UTSW 19 10218232 missense probably benign 0.05
R1950:Myrf UTSW 19 10218190 missense possibly damaging 0.93
R1957:Myrf UTSW 19 10219796 missense probably benign 0.04
R2089:Myrf UTSW 19 10224600 missense possibly damaging 0.48
R2091:Myrf UTSW 19 10224600 missense possibly damaging 0.48
R2091:Myrf UTSW 19 10224600 missense possibly damaging 0.48
R2144:Myrf UTSW 19 10228674 missense probably benign 0.05
R3932:Myrf UTSW 19 10218151 missense probably damaging 1.00
R3964:Myrf UTSW 19 10219615 missense probably benign 0.03
R3966:Myrf UTSW 19 10219615 missense probably benign 0.03
R3970:Myrf UTSW 19 10223237 missense probably damaging 1.00
R4607:Myrf UTSW 19 10229067 missense probably damaging 1.00
R4746:Myrf UTSW 19 10218591 missense probably damaging 0.99
R5117:Myrf UTSW 19 10212493 missense probably damaging 1.00
R5598:Myrf UTSW 19 10215290 missense probably benign 0.00
R5719:Myrf UTSW 19 10216723 missense probably damaging 1.00
R5841:Myrf UTSW 19 10223547 missense probably null 1.00
R5994:Myrf UTSW 19 10219117 missense probably null 1.00
R6148:Myrf UTSW 19 10212475 missense probably damaging 0.99
R6229:Myrf UTSW 19 10219798 missense probably benign 0.19
R6477:Myrf UTSW 19 10228785 missense probably benign 0.41
R6623:Myrf UTSW 19 10223359 missense probably benign 0.13
R6878:Myrf UTSW 19 10216478 missense possibly damaging 0.80
R6932:Myrf UTSW 19 10219560 missense probably damaging 1.00
R7127:Myrf UTSW 19 10215341 missense probably benign 0.01
R7162:Myrf UTSW 19 10218646 missense possibly damaging 0.75
R7553:Myrf UTSW 19 10228876 missense probably benign
R7585:Myrf UTSW 19 10216727 missense probably damaging 1.00
X0028:Myrf UTSW 19 10212158 missense probably damaging 1.00
Z1088:Myrf UTSW 19 10221298 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATCCCCATGGTCTGAAGGAGAG -3'
(R):5'- GACAGCCTCAAGTCAACTGG -3'

Sequencing Primer
(F):5'- CATGGTCTGAAGGAGAGGGAGC -3'
(R):5'- TCAAGTCAACTGGCAGCTCAGG -3'
Posted On2014-10-01