Mutagenetix > Incidental Mutation

Incidental Mutation 'R2140:Madd'

236107

Institutional Source

Beutler Lab

Gene Symbol

Madd

Ensembl Gene

ENSMUSG00000040687

Gene Name

MAP-kinase activating death domain

Synonyms

Rab3 GEP, 9630059K23Rik

MMRRC Submission

040143-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R2140 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

91137360-91183837 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 91152509 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Threonine at position 1363 (I1363T)

Ref Sequence

ENSEMBL: ENSMUSP00000107012 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000066473] [ENSMUST00000075269] [ENSMUST00000077941] [ENSMUST00000099723] [ENSMUST00000099725] [ENSMUST00000111369] [ENSMUST00000111370] [ENSMUST00000111371] [ENSMUST00000111372] [ENSMUST00000111373] [ENSMUST00000111375] [ENSMUST00000111376] [ENSMUST00000111381]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000066473
AA Change: I1382T

PolyPhen 2 Score 0.798 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000069350
Gene: ENSMUSG00000040687
AA Change: I1382T

Domain	Start	End	E-Value	Type
uDENN	7	97	7.11e-26	SMART
low complexity region	124	139	N/A	INTRINSIC
DENN	171	401	2.19e-67	SMART
low complexity region	412	428	N/A	INTRINSIC
dDENN	484	554	6.71e-13	SMART
low complexity region	619	639	N/A	INTRINSIC
low complexity region	699	718	N/A	INTRINSIC
low complexity region	781	789	N/A	INTRINSIC
low complexity region	816	839	N/A	INTRINSIC
low complexity region	908	918	N/A	INTRINSIC
low complexity region	1334	1348	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000075269
AA Change: I1324T

PolyPhen 2 Score 0.798 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000074746
Gene: ENSMUSG00000040687
AA Change: I1324T

Domain	Start	End	E-Value	Type
uDENN	7	97	7.11e-26	SMART
low complexity region	124	139	N/A	INTRINSIC
DENN	171	401	2.19e-67	SMART
low complexity region	412	428	N/A	INTRINSIC
dDENN	484	554	6.71e-13	SMART
low complexity region	619	639	N/A	INTRINSIC
low complexity region	699	719	N/A	INTRINSIC
low complexity region	762	770	N/A	INTRINSIC
low complexity region	797	820	N/A	INTRINSIC
low complexity region	889	899	N/A	INTRINSIC
low complexity region	1276	1290	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000077941
AA Change: I1402T

PolyPhen 2 Score 0.798 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000077094
Gene: ENSMUSG00000040687
AA Change: I1402T

Domain	Start	End	E-Value	Type
uDENN	7	97	7.11e-26	SMART
low complexity region	124	139	N/A	INTRINSIC
DENN	171	401	2.19e-67	SMART
low complexity region	412	428	N/A	INTRINSIC
dDENN	484	554	6.71e-13	SMART
low complexity region	619	639	N/A	INTRINSIC
low complexity region	699	718	N/A	INTRINSIC
low complexity region	781	789	N/A	INTRINSIC
low complexity region	816	839	N/A	INTRINSIC
low complexity region	928	938	N/A	INTRINSIC
low complexity region	1354	1368	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000099723
AA Change: I1401T

PolyPhen 2 Score 0.798 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000097311
Gene: ENSMUSG00000040687
AA Change: I1401T

Domain	Start	End	E-Value	Type
uDENN	7	97	7.11e-26	SMART
low complexity region	124	139	N/A	INTRINSIC
DENN	171	401	2.19e-67	SMART
low complexity region	412	428	N/A	INTRINSIC
dDENN	484	554	6.71e-13	SMART
low complexity region	619	639	N/A	INTRINSIC
low complexity region	699	718	N/A	INTRINSIC
low complexity region	781	789	N/A	INTRINSIC
low complexity region	816	839	N/A	INTRINSIC
low complexity region	928	938	N/A	INTRINSIC
low complexity region	1189	1203	N/A	INTRINSIC
low complexity region	1353	1367	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000099725
AA Change: I1382T

PolyPhen 2 Score 0.798 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000097313
Gene: ENSMUSG00000040687
AA Change: I1382T

Domain	Start	End	E-Value	Type
uDENN	7	97	7.11e-26	SMART
low complexity region	124	139	N/A	INTRINSIC
DENN	171	401	2.19e-67	SMART
low complexity region	412	428	N/A	INTRINSIC
dDENN	484	554	6.71e-13	SMART
low complexity region	619	639	N/A	INTRINSIC
low complexity region	699	718	N/A	INTRINSIC
low complexity region	781	789	N/A	INTRINSIC
low complexity region	816	839	N/A	INTRINSIC
low complexity region	908	918	N/A	INTRINSIC
low complexity region	1334	1348	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000111369
AA Change: I1299T

PolyPhen 2 Score 0.795 (Sensitivity: 0.85; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000107000
Gene: ENSMUSG00000040687
AA Change: I1299T

Domain	Start	End	E-Value	Type
uDENN	7	97	7.11e-26	SMART
low complexity region	124	139	N/A	INTRINSIC
DENN	171	401	2.19e-67	SMART
low complexity region	412	428	N/A	INTRINSIC
dDENN	484	554	6.71e-13	SMART
low complexity region	619	639	N/A	INTRINSIC
low complexity region	699	721	N/A	INTRINSIC
low complexity region	773	796	N/A	INTRINSIC
low complexity region	865	875	N/A	INTRINSIC
low complexity region	1108	1122	N/A	INTRINSIC
low complexity region	1251	1265	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000111370
AA Change: I1382T

PolyPhen 2 Score 0.798 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000107001
Gene: ENSMUSG00000040687
AA Change: I1382T

Domain	Start	End	E-Value	Type
uDENN	7	97	7.11e-26	SMART
low complexity region	124	139	N/A	INTRINSIC
DENN	171	401	2.19e-67	SMART
low complexity region	412	428	N/A	INTRINSIC
dDENN	484	554	6.71e-13	SMART
low complexity region	619	639	N/A	INTRINSIC
low complexity region	699	718	N/A	INTRINSIC
low complexity region	781	789	N/A	INTRINSIC
low complexity region	816	839	N/A	INTRINSIC
low complexity region	908	918	N/A	INTRINSIC
low complexity region	1334	1348	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000111371
AA Change: I1344T

PolyPhen 2 Score 0.798 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000107002
Gene: ENSMUSG00000040687
AA Change: I1344T

Domain	Start	End	E-Value	Type
uDENN	7	97	7.11e-26	SMART
low complexity region	124	139	N/A	INTRINSIC
DENN	171	401	2.19e-67	SMART
low complexity region	412	428	N/A	INTRINSIC
dDENN	484	554	6.71e-13	SMART
low complexity region	619	639	N/A	INTRINSIC
low complexity region	699	719	N/A	INTRINSIC
low complexity region	762	770	N/A	INTRINSIC
low complexity region	797	820	N/A	INTRINSIC
low complexity region	909	919	N/A	INTRINSIC
low complexity region	1296	1310	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000111372
AA Change: I1343T

PolyPhen 2 Score 0.798 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000107003
Gene: ENSMUSG00000040687
AA Change: I1343T

Domain	Start	End	E-Value	Type
uDENN	7	97	7.11e-26	SMART
low complexity region	124	139	N/A	INTRINSIC
DENN	171	401	2.19e-67	SMART
low complexity region	412	428	N/A	INTRINSIC
dDENN	484	554	6.71e-13	SMART
low complexity region	619	639	N/A	INTRINSIC
low complexity region	699	718	N/A	INTRINSIC
low complexity region	781	789	N/A	INTRINSIC
low complexity region	816	839	N/A	INTRINSIC
low complexity region	908	918	N/A	INTRINSIC
low complexity region	1295	1309	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000111373
AA Change: I1299T

PolyPhen 2 Score 0.795 (Sensitivity: 0.85; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000107004
Gene: ENSMUSG00000040687
AA Change: I1299T

Domain	Start	End	E-Value	Type
uDENN	7	97	2.9e-29	SMART
low complexity region	124	139	N/A	INTRINSIC
DENN	171	401	8.7e-71	SMART
low complexity region	412	428	N/A	INTRINSIC
dDENN	484	554	2.8e-16	SMART
low complexity region	619	639	N/A	INTRINSIC
low complexity region	699	721	N/A	INTRINSIC
low complexity region	773	796	N/A	INTRINSIC
low complexity region	865	875	N/A	INTRINSIC
low complexity region	1108	1122	N/A	INTRINSIC
low complexity region	1251	1265	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000111375
AA Change: I1320T

PolyPhen 2 Score 0.795 (Sensitivity: 0.85; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000107006
Gene: ENSMUSG00000040687
AA Change: I1320T

Domain	Start	End	E-Value	Type
uDENN	7	97	7.11e-26	SMART
low complexity region	124	139	N/A	INTRINSIC
DENN	171	401	2.19e-67	SMART
low complexity region	412	428	N/A	INTRINSIC
dDENN	484	554	6.71e-13	SMART
low complexity region	619	639	N/A	INTRINSIC
low complexity region	699	721	N/A	INTRINSIC
low complexity region	773	796	N/A	INTRINSIC
low complexity region	885	895	N/A	INTRINSIC
low complexity region	1272	1286	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000111376
AA Change: I1360T

PolyPhen 2 Score 0.798 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000107007
Gene: ENSMUSG00000040687
AA Change: I1360T

Domain	Start	End	E-Value	Type
uDENN	7	97	7.11e-26	SMART
low complexity region	124	139	N/A	INTRINSIC
DENN	171	401	2.19e-67	SMART
low complexity region	412	428	N/A	INTRINSIC
dDENN	484	554	6.71e-13	SMART
low complexity region	619	639	N/A	INTRINSIC
low complexity region	699	721	N/A	INTRINSIC
low complexity region	781	789	N/A	INTRINSIC
low complexity region	816	839	N/A	INTRINSIC
low complexity region	908	918	N/A	INTRINSIC
low complexity region	1151	1162	N/A	INTRINSIC
low complexity region	1312	1326	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000111381
AA Change: I1363T

PolyPhen 2 Score 0.798 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000107012
Gene: ENSMUSG00000040687
AA Change: I1363T

Domain	Start	End	E-Value	Type
uDENN	7	97	7.11e-26	SMART
low complexity region	124	139	N/A	INTRINSIC
DENN	171	401	2.19e-67	SMART
low complexity region	412	428	N/A	INTRINSIC
dDENN	484	554	6.71e-13	SMART
low complexity region	619	639	N/A	INTRINSIC
low complexity region	699	718	N/A	INTRINSIC
low complexity region	781	789	N/A	INTRINSIC
low complexity region	816	839	N/A	INTRINSIC
low complexity region	928	938	N/A	INTRINSIC
low complexity region	1315	1329	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000150461

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000153688

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000146097

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000125321

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000154028

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000130591

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000135910

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000132791

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000125227

Meta Mutation Damage Score

0.7056

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.1%
20x: 94.5%

Validation Efficiency

100% (96/96)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Tumor necrosis factor alpha (TNF-alpha) is a signaling molecule that interacts with one of two receptors on cells targeted for apoptosis. The apoptotic signal is transduced inside these cells by cytoplasmic adaptor proteins. The protein encoded by this gene is a death domain-containing adaptor protein that interacts with the death domain of TNF-alpha receptor 1 to activate mitogen-activated protein kinase (MAPK) and propagate the apoptotic signal. It is membrane-bound and expressed at a higher level in neoplastic cells than in normal cells. Several transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele die shortly after birth due to respiratory failure, are hyporesponsive to tactile stimuli, and exhibit defects in neurotransmitter release with impaired synaptic vesicle trafficking and depletion of synaptic vesicles at the neuromuscular junction. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 96 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2610042L04Rik	T	C	14: 4,348,902	I21T	probably damaging	Het
9230110C19Rik	T	C	9: 8,022,477	D248G	probably damaging	Het
Adgrf1	A	C	17: 43,300,802	E186D	probably damaging	Het
Adgrf4	C	T	17: 42,666,898	R518Q	possibly damaging	Het
Afdn	A	G	17: 13,810,433	E202G	probably damaging	Het
Agfg2	T	A	5: 137,667,116	R126W	probably damaging	Het
Alkbh2	C	T	5: 114,125,716	V77I	probably benign	Het
Alppl2	A	G	1: 87,087,697	S381P	probably benign	Het
Aqp2	A	G	15: 99,579,366	T72A	probably damaging	Het
Atp9b	A	G	18: 80,736,087	C1123R	probably damaging	Het
AU016765	T	A	17: 64,520,000		noncoding transcript	Het
Bscl2	T	C	19: 8,845,320		probably null	Het
Ccdc80	A	T	16: 45,127,446	Y929F	probably damaging	Het
Cenpj	T	C	14: 56,526,932	D1341G	probably damaging	Het
Cir1	A	T	2: 73,312,437	S18T	probably damaging	Het
Clcn6	A	G	4: 148,024,137	F145S	possibly damaging	Het
Cnksr1	A	G	4: 134,229,628	Y488H	probably damaging	Het
Cntrl	CAGAG	CAG	2: 35,122,806		probably null	Het
Crb1	T	C	1: 139,237,012	I1125V	probably benign	Het
Cyp3a13	A	T	5: 137,921,454	V20D	possibly damaging	Het
Dars	T	A	1: 128,372,162	M362L	probably benign	Het
Dck	T	C	5: 88,772,723	C101R	probably damaging	Het
Dnah11	T	C	12: 118,008,810	T2880A	probably benign	Het
Dnah7b	T	A	1: 46,268,670	M3048K	probably damaging	Het
Eef1a2	C	T	2: 181,148,742	E374K	probably benign	Het
Eif3a	A	T	19: 60,775,394		probably benign	Het
Esco1	A	G	18: 10,574,873		probably null	Het
Exoc8	C	T	8: 124,897,415	R71Q	possibly damaging	Het
Fam208a	C	T	14: 27,480,035	T1462I	probably damaging	Het
Far1	G	A	7: 113,566,460	V445M	possibly damaging	Het
Fbn1	C	A	2: 125,343,810	C1648F	probably damaging	Het
Fmn1	A	G	2: 113,595,048	K1189R	probably benign	Het
Foxl2	C	A	9: 98,956,487	P276H	unknown	Het
Fpr3	T	A	17: 17,970,617	V50E	probably damaging	Het
Garem1	T	A	18: 21,129,374	R794S	probably damaging	Het
Gemin4	G	C	11: 76,211,050	P962A	probably damaging	Het
Glyatl3	T	C	17: 40,911,084	D93G	probably benign	Het
Gm14124	A	T	2: 150,269,361	H657L	probably benign	Het
Gm4787	A	G	12: 81,378,562	I274T	probably benign	Het
Gucy1a1	C	T	3: 82,118,886		probably null	Het
Hook1	GATGAATGA	GATGA	4: 96,013,312	503	probably null	Het
Ift20	G	A	11: 78,540,034	E68K	probably damaging	Het
Ints13	A	G	6: 146,576,431	S7P	probably damaging	Het
Kat5	T	A	19: 5,605,685		probably null	Het
Kcnma1	A	C	14: 23,314,220	L988R	probably damaging	Het
Kcnq3	C	A	15: 66,005,978		probably benign	Het
Kctd16	A	G	18: 40,259,178	E273G	possibly damaging	Het
Krt82	T	A	15: 101,545,156	Q265L	probably damaging	Het
Lama2	A	T	10: 27,054,694		probably null	Het
Laptm4b	G	T	15: 34,238,332	M3I	probably benign	Het
Lmtk2	A	G	5: 144,147,615	Y156C	probably damaging	Het
Lrrc58	G	A	16: 37,881,409	E350K	probably damaging	Het
Lrrk1	A	T	7: 66,330,750	D227E	probably damaging	Het
Macf1	C	T	4: 123,355,102	C7210Y	probably damaging	Het
Mcm3	A	G	1: 20,813,110	V295A	probably benign	Het
Mki67	A	G	7: 135,695,592	I2571T	possibly damaging	Het
Mtrr	C	T	13: 68,568,940	A385T	possibly damaging	Het
Myh7b	A	G	2: 155,620,123	Y313C	probably damaging	Het
Myot	A	T	18: 44,354,125	H343L	possibly damaging	Het
Myt1	C	A	2: 181,825,979	Q1069K	probably damaging	Het
Nid1	T	A	13: 13,499,668	D877E	probably damaging	Het
Nle1	A	G	11: 82,905,568	V159A	probably damaging	Het
Nmbr	C	A	10: 14,770,442	Y353*	probably null	Het
Nos1ap	T	A	1: 170,329,166	D241V	probably damaging	Het
Nostrin	A	C	2: 69,166,003	Y209S	probably damaging	Het
Olfr1099	A	T	2: 86,959,281	M59K	probably damaging	Het
Olfr115	T	G	17: 37,610,471	E93D	probably benign	Het
Olfr1168	A	T	2: 88,185,095	S73C	probably benign	Het
Olfr1240	C	T	2: 89,439,583	R232H	probably benign	Het
Olfr283	G	A	15: 98,378,396	T238I	possibly damaging	Het
Olfr378	A	T	11: 73,425,881	M34K	probably damaging	Het
Pcdh7	T	A	5: 58,128,996	V1138E	probably damaging	Het
Pglyrp3	T	G	3: 92,026,567	V173G	probably benign	Het
Plec	T	C	15: 76,183,174	T1331A	probably benign	Het
Plxnb2	T	C	15: 89,156,562	D1787G	probably benign	Het
Pms1	T	A	1: 53,281,988	I29F	probably damaging	Het
Ptprt	G	A	2: 161,811,988	T574I	probably damaging	Het
R3hdm1	A	G	1: 128,190,693	Y561C	probably damaging	Het
Rab17	A	G	1: 90,960,078	F120S	probably benign	Het
Rab7b	T	A	1: 131,698,419	W62R	probably damaging	Het
Ryr2	C	T	13: 11,560,607	G4835E	probably damaging	Het
Ryr3	A	G	2: 112,875,148	V807A	probably benign	Het
Sept4	A	T	11: 87,583,436	Q60L	probably benign	Het
Slc23a1	C	T	18: 35,626,434	R26Q	unknown	Het
Slc7a4	C	A	16: 17,574,544	R342L	possibly damaging	Het
Slfn9	C	T	11: 82,984,655	C367Y	possibly damaging	Het
Slitrk6	T	G	14: 110,750,794	T494P	probably benign	Het
Tiam1	A	G	16: 89,849,645		probably benign	Het
Tiparp	C	A	3: 65,529,252		probably benign	Het
Tmem39b	T	C	4: 129,678,688	T374A	probably benign	Het
Trim5	G	A	7: 104,276,791	R188*	probably null	Het
Ttn	C	T	2: 76,813,339	G11436R	probably damaging	Het
Ubr4	C	T	4: 139,477,207	T4810M	probably damaging	Het
Vmn2r26	A	T	6: 124,061,237	E590D	probably benign	Het
Wwc1	A	G	11: 35,870,528	F650S	probably benign	Het
Xrcc6	T	A	15: 82,022,977	F167I	probably damaging	Het

Other mutations in Madd

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00095:Madd	APN	2	91175766	unclassified	probably benign
IGL00781:Madd	APN	2	91146928	missense	probably benign	0.00
IGL00844:Madd	APN	2	91167868	missense	probably damaging	1.00
IGL00942:Madd	APN	2	91170578	missense	probably damaging	1.00
IGL01100:Madd	APN	2	91158040	missense	probably damaging	1.00
IGL01116:Madd	APN	2	91154543	splice site	probably benign
IGL01694:Madd	APN	2	91157975	splice site	probably benign
IGL01982:Madd	APN	2	91175707	missense	probably damaging	1.00
IGL02346:Madd	APN	2	91162491	missense	probably damaging	0.97
IGL02354:Madd	APN	2	91162198	missense	probably benign	0.17
IGL02361:Madd	APN	2	91162198	missense	probably benign	0.17
IGL02481:Madd	APN	2	91178036	missense	probably damaging	1.00
IGL02483:Madd	APN	2	91178036	missense	probably damaging	1.00
IGL02948:Madd	APN	2	91142827	missense	probably benign
IGL03338:Madd	APN	2	91162162	missense	possibly damaging	0.48
BB005:Madd	UTSW	2	91176888	missense	probably damaging	1.00
BB015:Madd	UTSW	2	91176888	missense	probably damaging	1.00
R0026:Madd	UTSW	2	91175708	missense	possibly damaging	0.88
R0026:Madd	UTSW	2	91175708	missense	possibly damaging	0.88
R0027:Madd	UTSW	2	91152549	missense	probably damaging	0.97
R0085:Madd	UTSW	2	91162738	missense	probably benign	0.00
R0577:Madd	UTSW	2	91138395	missense	possibly damaging	0.88
R0587:Madd	UTSW	2	91146885	missense	probably damaging	1.00
R1112:Madd	UTSW	2	91143599	missense	probably damaging	1.00
R1722:Madd	UTSW	2	91167637	missense	probably benign
R1750:Madd	UTSW	2	91167891	missense	probably damaging	0.98
R2061:Madd	UTSW	2	91161486	intron	probably benign
R2112:Madd	UTSW	2	91176976	missense	possibly damaging	0.89
R2114:Madd	UTSW	2	91164022	missense	probably damaging	1.00
R2276:Madd	UTSW	2	91143683	missense	possibly damaging	0.67
R2277:Madd	UTSW	2	91143683	missense	possibly damaging	0.67
R2279:Madd	UTSW	2	91143683	missense	possibly damaging	0.67
R2424:Madd	UTSW	2	91166622	missense	probably damaging	1.00
R2904:Madd	UTSW	2	91175672	missense	probably damaging	1.00
R3122:Madd	UTSW	2	91176209	missense	probably damaging	1.00
R3836:Madd	UTSW	2	91154643	critical splice donor site	probably null
R3979:Madd	UTSW	2	91176828	missense	possibly damaging	0.81
R4151:Madd	UTSW	2	91143083	missense	probably benign	0.11
R4233:Madd	UTSW	2	91178236	missense	probably benign	0.26
R4236:Madd	UTSW	2	91167028	missense	probably benign	0.00
R4299:Madd	UTSW	2	91169803	missense	probably damaging	1.00
R4334:Madd	UTSW	2	91140572	missense	probably benign	0.08
R4413:Madd	UTSW	2	91167587	missense	probably damaging	1.00
R4595:Madd	UTSW	2	91167664	missense	possibly damaging	0.80
R4694:Madd	UTSW	2	91160328	missense	probably damaging	0.99
R5410:Madd	UTSW	2	91154514	missense	probably damaging	1.00
R5490:Madd	UTSW	2	91170635	missense	possibly damaging	0.80
R5560:Madd	UTSW	2	91163545	missense	probably damaging	1.00
R5661:Madd	UTSW	2	91154433	critical splice donor site	probably null
R5710:Madd	UTSW	2	91154476	missense	probably damaging	1.00
R5730:Madd	UTSW	2	91158109	missense	probably damaging	1.00
R5759:Madd	UTSW	2	91162075	missense	possibly damaging	0.94
R5768:Madd	UTSW	2	91167829	missense	probably damaging	1.00
R5822:Madd	UTSW	2	91152533	missense	probably damaging	1.00
R6125:Madd	UTSW	2	91152452	critical splice donor site	probably null
R6151:Madd	UTSW	2	91165457	nonsense	probably null
R6229:Madd	UTSW	2	91143670	missense	probably damaging	0.96
R6230:Madd	UTSW	2	91143521	critical splice donor site	probably null
R6245:Madd	UTSW	2	91178104	missense	probably benign	0.27
R6323:Madd	UTSW	2	91161438	splice site	probably null
R6456:Madd	UTSW	2	91178191	missense	probably benign
R6473:Madd	UTSW	2	91167059	missense	probably benign
R6878:Madd	UTSW	2	91169857	missense	probably damaging	1.00
R7060:Madd	UTSW	2	91177107	missense	probably damaging	1.00
R7065:Madd	UTSW	2	91155057	missense	probably benign	0.26
R7073:Madd	UTSW	2	91162509	missense	probably damaging	1.00
R7124:Madd	UTSW	2	91162048	missense	possibly damaging	0.94
R7251:Madd	UTSW	2	91162176	missense	probably benign	0.01
R7510:Madd	UTSW	2	91177976	missense	possibly damaging	0.80
R7605:Madd	UTSW	2	91169710	missense	possibly damaging	0.90
R7911:Madd	UTSW	2	91167508	missense	probably null	0.01
R7928:Madd	UTSW	2	91176888	missense	probably damaging	1.00
R7952:Madd	UTSW	2	91162541	missense	probably damaging	1.00
R8039:Madd	UTSW	2	91167061	missense	probably benign	0.17
R8047:Madd	UTSW	2	91179201	missense	probably damaging	1.00
R8048:Madd	UTSW	2	91154448	missense	probably damaging	0.99
R8070:Madd	UTSW	2	91158014	nonsense	probably null
R8090:Madd	UTSW	2	91155623	missense	probably benign	0.01
R8335:Madd	UTSW	2	91170239	missense	probably damaging	1.00
R8459:Madd	UTSW	2	91162526	missense	probably benign
R8678:Madd	UTSW	2	91176265	missense	probably damaging	1.00
R8920:Madd	UTSW	2	91176823	missense	probably benign	0.04
R9003:Madd	UTSW	2	91158014	nonsense	probably null
R9102:Madd	UTSW	2	91158059	missense	probably benign	0.00
R9154:Madd	UTSW	2	91167817	missense	probably damaging	1.00
R9242:Madd	UTSW	2	91143604	missense	probably damaging	0.99
R9277:Madd	UTSW	2	91175710	missense	probably damaging	1.00
R9394:Madd	UTSW	2	91169854	missense	probably benign
R9490:Madd	UTSW	2	91178156	missense	probably benign
R9499:Madd	UTSW	2	91170089	missense	probably damaging	1.00
R9551:Madd	UTSW	2	91170089	missense	probably damaging	1.00
R9553:Madd	UTSW	2	91178455	missense	probably damaging	1.00
R9599:Madd	UTSW	2	91175681	missense	probably damaging	1.00
R9695:Madd	UTSW	2	91162584	missense	probably benign	0.17
R9729:Madd	UTSW	2	91170199	missense	possibly damaging	0.60
X0067:Madd	UTSW	2	91152473	missense	probably damaging	1.00
Z1176:Madd	UTSW	2	91159272	missense	probably damaging	0.96
Z1177:Madd	UTSW	2	91142831	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CCTCTAAACTAGGCATTAACTGGG -3'
(R):5'- GAGGCAATCCCCAGCATATG -3'

Sequencing Primer
(F):5'- CTAGGCATTAACTGGGCTGCATAG -3'
(R):5'- CACACAGTTGAAAGTGTTCTGCC -3'

Posted On

2014-10-01