Incidental Mutation 'R2140:Fbn1'
ID 236110
Institutional Source Beutler Lab
Gene Symbol Fbn1
Ensembl Gene ENSMUSG00000027204
Gene Name fibrillin 1
Synonyms Fib-1
MMRRC Submission 040143-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.916) question?
Stock # R2140 (G1)
Quality Score 225
Status Validated
Chromosome 2
Chromosomal Location 125142514-125348417 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 125185730 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Cysteine to Phenylalanine at position 1648 (C1648F)
Ref Sequence ENSEMBL: ENSMUSP00000099524 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028633] [ENSMUST00000103234]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000028633
AA Change: C1648F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000028633
Gene: ENSMUSG00000027204
AA Change: C1648F

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
low complexity region 38 49 N/A INTRINSIC
EGF 118 146 8.52e0 SMART
EGF 149 178 5.4e-2 SMART
Pfam:TB 193 235 6.9e-17 PFAM
EGF_CA 246 287 3.56e-11 SMART
EGF_CA 288 329 9.39e-11 SMART
Pfam:TB 343 388 2.3e-17 PFAM
low complexity region 394 445 N/A INTRINSIC
EGF 454 491 8.57e-5 SMART
EGF_CA 492 531 9.39e-11 SMART
EGF_CA 532 573 2.38e-12 SMART
EGF_CA 574 614 5.48e-12 SMART
EGF_CA 615 655 5.39e-11 SMART
Pfam:TB 670 712 1.4e-17 PFAM
EGF_CA 725 766 1.53e-10 SMART
EGF_CA 767 808 2.42e-13 SMART
EGF_CA 809 848 2.44e-9 SMART
Pfam:TB 862 902 2.1e-14 PFAM
EGF_CA 912 953 3.32e-11 SMART
Pfam:TB 967 1009 3.9e-17 PFAM
EGF_CA 1030 1071 5.11e-12 SMART
EGF_CA 1072 1114 5.39e-11 SMART
EGF_CA 1115 1156 1.55e-11 SMART
EGF_CA 1157 1198 5.48e-12 SMART
EGF_CA 1199 1239 5.61e-9 SMART
EGF_CA 1240 1281 1.22e-9 SMART
EGF_CA 1282 1323 2.62e-9 SMART
EGF_CA 1324 1364 3.27e-10 SMART
EGF_CA 1365 1405 4.7e-11 SMART
EGF_CA 1406 1447 1.91e-11 SMART
EGF_CA 1448 1488 1.98e-9 SMART
EGF_CA 1489 1529 2.13e-9 SMART
Pfam:TB 1549 1590 3.5e-18 PFAM
EGF_CA 1608 1649 2.19e-11 SMART
EGF_CA 1650 1690 3.97e-9 SMART
Pfam:TB 1706 1749 9.7e-18 PFAM
EGF_CA 1768 1809 5.11e-12 SMART
EGF_CA 1810 1850 1.1e-11 SMART
EGF_CA 1851 1892 5.69e-10 SMART
EGF_CA 1893 1931 6.1e-10 SMART
EGF_CA 1932 1974 2.11e-13 SMART
EGF_CA 1975 2014 7.23e-12 SMART
EGF_CA 2015 2056 3.15e-12 SMART
Pfam:TB 2070 2112 3.7e-17 PFAM
EGF_CA 2129 2167 1.24e-10 SMART
EGF_CA 2168 2207 3.81e-11 SMART
EGF_CA 2208 2248 3.81e-11 SMART
EGF 2252 2292 5.24e0 SMART
EGF_CA 2293 2334 9.91e-10 SMART
Pfam:TB 2348 2391 8.5e-18 PFAM
EGF_CA 2404 2445 1.26e-11 SMART
EGF_CA 2446 2486 1.06e-9 SMART
EGF_CA 2487 2525 3.1e-11 SMART
EGF_CA 2526 2568 1.48e-8 SMART
EGF_CA 2569 2608 1.14e-9 SMART
EGF_CA 2609 2649 3.97e-9 SMART
EGF_CA 2650 2689 1.98e-9 SMART
low complexity region 2691 2698 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000103234
AA Change: C1648F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099524
Gene: ENSMUSG00000027204
AA Change: C1648F

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
low complexity region 38 49 N/A INTRINSIC
EGF 118 146 8.52e0 SMART
EGF 149 178 5.4e-2 SMART
Pfam:TB 194 232 3.5e-10 PFAM
EGF_CA 246 287 3.56e-11 SMART
EGF_CA 288 329 9.39e-11 SMART
Pfam:TB 344 388 6.8e-15 PFAM
low complexity region 394 445 N/A INTRINSIC
EGF 454 491 8.57e-5 SMART
EGF_CA 492 531 9.39e-11 SMART
EGF_CA 532 573 2.38e-12 SMART
EGF_CA 574 614 5.48e-12 SMART
EGF_CA 615 655 5.39e-11 SMART
Pfam:TB 671 712 8.3e-16 PFAM
EGF_CA 725 766 1.53e-10 SMART
EGF_CA 767 808 2.42e-13 SMART
EGF_CA 809 848 2.44e-9 SMART
Pfam:TB 863 898 3.1e-8 PFAM
EGF_CA 912 953 3.32e-11 SMART
Pfam:TB 968 1009 1.5e-15 PFAM
EGF_CA 1030 1071 5.11e-12 SMART
EGF_CA 1072 1114 5.39e-11 SMART
EGF_CA 1115 1156 1.55e-11 SMART
EGF_CA 1157 1198 5.48e-12 SMART
EGF_CA 1199 1239 5.61e-9 SMART
EGF_CA 1240 1281 1.22e-9 SMART
EGF_CA 1282 1323 2.62e-9 SMART
EGF_CA 1324 1364 3.27e-10 SMART
EGF_CA 1365 1405 4.7e-11 SMART
EGF_CA 1406 1447 1.91e-11 SMART
EGF_CA 1448 1488 1.98e-9 SMART
EGF_CA 1489 1529 2.13e-9 SMART
Pfam:TB 1550 1590 5.3e-17 PFAM
EGF_CA 1608 1649 2.19e-11 SMART
EGF_CA 1650 1690 3.97e-9 SMART
Pfam:TB 1707 1749 1.6e-16 PFAM
EGF_CA 1768 1809 5.11e-12 SMART
EGF_CA 1810 1850 1.1e-11 SMART
EGF_CA 1851 1892 5.69e-10 SMART
EGF_CA 1893 1931 6.1e-10 SMART
EGF_CA 1932 1974 2.11e-13 SMART
EGF_CA 1975 2014 7.23e-12 SMART
EGF_CA 2015 2056 3.15e-12 SMART
Pfam:TB 2071 2112 1.9e-15 PFAM
EGF_CA 2129 2167 1.24e-10 SMART
EGF_CA 2168 2207 3.81e-11 SMART
EGF_CA 2208 2248 3.81e-11 SMART
EGF 2252 2292 5.24e0 SMART
EGF_CA 2293 2334 9.91e-10 SMART
Pfam:TB 2349 2391 5.8e-15 PFAM
EGF_CA 2404 2445 1.26e-11 SMART
EGF_CA 2446 2486 1.06e-9 SMART
EGF_CA 2487 2525 3.1e-11 SMART
EGF_CA 2526 2568 1.48e-8 SMART
EGF_CA 2569 2608 1.14e-9 SMART
EGF_CA 2609 2649 3.97e-9 SMART
EGF_CA 2650 2689 1.98e-9 SMART
low complexity region 2691 2698 N/A INTRINSIC
Meta Mutation Damage Score 0.9601 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency 100% (96/96)
MGI Phenotype FUNCTION: This gene encodes a member of the fibrillin family of proteins. The encoded preproprotein is proteolytically processed to generate two proteins including the extracellular matrix component fibrillin-1 and the protein hormone asprosin. Fibrillin-1 is an extracellular matrix glycoprotein that serves as a structural component of calcium-binding microfibrils. Asprosin, secreted by white adipose tissue, has been shown to regulate glucose homeostasis. Homozygous knockout mice for this gene exhibit impaired aortic development and early postnatal death, which was attributed to a deficiency in the fibrillin-1 protein. Mice with a hypomorphic allele of this gene exhibit impaired glucose homeostasis, likely due to a reduction in serum asprosin levels. [provided by RefSeq, Apr 2016]
PHENOTYPE: Lethality among homozygotes for spontaneous and targeted mutations ranges from embryonic death to death around 4 months. Abnormalities include vascular defects, excess bone growth, connective tissue hyperplasia, and lung emphysema. Mice heterozygous for a knock-in allele exhibit scleroderma. [provided by MGI curators]
Allele List at MGI

All alleles(10) : Targeted(9) Spontaneous(1)

Other mutations in this stock
Total: 96 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610042L04Rik T C 14: 4,348,902 (GRCm38) I21T probably damaging Het
Adgrf1 A C 17: 43,611,693 (GRCm39) E186D probably damaging Het
Adgrf4 C T 17: 42,977,789 (GRCm39) R518Q possibly damaging Het
Afdn A G 17: 14,030,695 (GRCm39) E202G probably damaging Het
Agfg2 T A 5: 137,665,378 (GRCm39) R126W probably damaging Het
Alkbh2 C T 5: 114,263,777 (GRCm39) V77I probably benign Het
Alppl2 A G 1: 87,015,419 (GRCm39) S381P probably benign Het
Aqp2 A G 15: 99,477,247 (GRCm39) T72A probably damaging Het
Atp9b A G 18: 80,779,302 (GRCm39) C1123R probably damaging Het
AU016765 T A 17: 64,826,995 (GRCm39) noncoding transcript Het
Bscl2 T C 19: 8,822,684 (GRCm39) probably null Het
Ccdc80 A T 16: 44,947,809 (GRCm39) Y929F probably damaging Het
Cenpj T C 14: 56,764,389 (GRCm39) D1341G probably damaging Het
Cfap300 T C 9: 8,022,478 (GRCm39) D248G probably damaging Het
Cir1 A T 2: 73,142,781 (GRCm39) S18T probably damaging Het
Clcn6 A G 4: 148,108,594 (GRCm39) F145S possibly damaging Het
Cnksr1 A G 4: 133,956,939 (GRCm39) Y488H probably damaging Het
Cntrl CAGAG CAG 2: 35,012,818 (GRCm39) probably null Het
Crb1 T C 1: 139,164,750 (GRCm39) I1125V probably benign Het
Cyp3a13 A T 5: 137,919,716 (GRCm39) V20D possibly damaging Het
Dars1 T A 1: 128,299,899 (GRCm39) M362L probably benign Het
Dck T C 5: 88,920,582 (GRCm39) C101R probably damaging Het
Dnah11 T C 12: 117,972,545 (GRCm39) T2880A probably benign Het
Dnah7b T A 1: 46,307,830 (GRCm39) M3048K probably damaging Het
Eef1a2 C T 2: 180,790,535 (GRCm39) E374K probably benign Het
Eif3a A T 19: 60,763,832 (GRCm39) probably benign Het
Esco1 A G 18: 10,574,873 (GRCm39) probably null Het
Exoc8 C T 8: 125,624,154 (GRCm39) R71Q possibly damaging Het
Far1 G A 7: 113,165,667 (GRCm39) V445M possibly damaging Het
Fmn1 A G 2: 113,425,393 (GRCm39) K1189R probably benign Het
Foxl2 C A 9: 98,838,540 (GRCm39) P276H unknown Het
Fpr3 T A 17: 18,190,879 (GRCm39) V50E probably damaging Het
Garem1 T A 18: 21,262,431 (GRCm39) R794S probably damaging Het
Gemin4 G C 11: 76,101,876 (GRCm39) P962A probably damaging Het
Glyatl3 T C 17: 41,221,975 (GRCm39) D93G probably benign Het
Gm4787 A G 12: 81,425,336 (GRCm39) I274T probably benign Het
Gucy1a1 C T 3: 82,026,193 (GRCm39) probably null Het
Hook1 GATGAATGA GATGA 4: 95,901,549 (GRCm39) 503 probably null Het
Ift20 G A 11: 78,430,860 (GRCm39) E68K probably damaging Het
Ints13 A G 6: 146,477,929 (GRCm39) S7P probably damaging Het
Kat5 T A 19: 5,655,713 (GRCm39) probably null Het
Kcnma1 A C 14: 23,364,288 (GRCm39) L988R probably damaging Het
Kcnq3 C A 15: 65,877,827 (GRCm39) probably benign Het
Kctd16 A G 18: 40,392,231 (GRCm39) E273G possibly damaging Het
Krt82 T A 15: 101,453,591 (GRCm39) Q265L probably damaging Het
Lama2 A T 10: 26,930,690 (GRCm39) probably null Het
Laptm4b G T 15: 34,238,478 (GRCm39) M3I probably benign Het
Lmtk2 A G 5: 144,084,433 (GRCm39) Y156C probably damaging Het
Lrrc58 G A 16: 37,701,771 (GRCm39) E350K probably damaging Het
Lrrk1 A T 7: 65,980,498 (GRCm39) D227E probably damaging Het
Macf1 C T 4: 123,248,895 (GRCm39) C7210Y probably damaging Het
Madd A G 2: 90,982,854 (GRCm39) I1363T possibly damaging Het
Mcm3 A G 1: 20,883,334 (GRCm39) V295A probably benign Het
Mki67 A G 7: 135,297,321 (GRCm39) I2571T possibly damaging Het
Mtrr C T 13: 68,717,059 (GRCm39) A385T possibly damaging Het
Myh7b A G 2: 155,462,043 (GRCm39) Y313C probably damaging Het
Myot A T 18: 44,487,192 (GRCm39) H343L possibly damaging Het
Myt1 C A 2: 181,467,772 (GRCm39) Q1069K probably damaging Het
Nid1 T A 13: 13,674,253 (GRCm39) D877E probably damaging Het
Nle1 A G 11: 82,796,394 (GRCm39) V159A probably damaging Het
Nmbr C A 10: 14,646,186 (GRCm39) Y353* probably null Het
Nos1ap T A 1: 170,156,735 (GRCm39) D241V probably damaging Het
Nostrin A C 2: 68,996,347 (GRCm39) Y209S probably damaging Het
Or14j4 T G 17: 37,921,362 (GRCm39) E93D probably benign Het
Or1e19 A T 11: 73,316,707 (GRCm39) M34K probably damaging Het
Or4a68 C T 2: 89,269,927 (GRCm39) R232H probably benign Het
Or5d40 A T 2: 88,015,439 (GRCm39) S73C probably benign Het
Or8h9 A T 2: 86,789,625 (GRCm39) M59K probably damaging Het
Or8s2 G A 15: 98,276,277 (GRCm39) T238I possibly damaging Het
Pcdh7 T A 5: 58,286,338 (GRCm39) V1138E probably damaging Het
Pglyrp3 T G 3: 91,933,874 (GRCm39) V173G probably benign Het
Plec T C 15: 76,067,374 (GRCm39) T1331A probably benign Het
Plxnb2 T C 15: 89,040,765 (GRCm39) D1787G probably benign Het
Pms1 T A 1: 53,321,147 (GRCm39) I29F probably damaging Het
Ptprt G A 2: 161,653,908 (GRCm39) T574I probably damaging Het
R3hdm1 A G 1: 128,118,430 (GRCm39) Y561C probably damaging Het
Rab17 A G 1: 90,887,800 (GRCm39) F120S probably benign Het
Rab7b T A 1: 131,626,157 (GRCm39) W62R probably damaging Het
Ryr2 C T 13: 11,575,493 (GRCm39) G4835E probably damaging Het
Ryr3 A G 2: 112,705,493 (GRCm39) V807A probably benign Het
Septin4 A T 11: 87,474,262 (GRCm39) Q60L probably benign Het
Slc23a1 C T 18: 35,759,487 (GRCm39) R26Q unknown Het
Slc7a4 C A 16: 17,392,408 (GRCm39) R342L possibly damaging Het
Slfn9 C T 11: 82,875,481 (GRCm39) C367Y possibly damaging Het
Slitrk6 T G 14: 110,988,226 (GRCm39) T494P probably benign Het
Tasor C T 14: 27,201,992 (GRCm39) T1462I probably damaging Het
Tiam1 A G 16: 89,646,533 (GRCm39) probably benign Het
Tiparp C A 3: 65,436,673 (GRCm39) probably benign Het
Tmem39b T C 4: 129,572,481 (GRCm39) T374A probably benign Het
Trim5 G A 7: 103,925,998 (GRCm39) R188* probably null Het
Ttn C T 2: 76,643,683 (GRCm39) G11436R probably damaging Het
Ubr4 C T 4: 139,204,518 (GRCm39) T4810M probably damaging Het
Vmn2r26 A T 6: 124,038,196 (GRCm39) E590D probably benign Het
Wwc1 A G 11: 35,761,355 (GRCm39) F650S probably benign Het
Xrcc6 T A 15: 81,907,178 (GRCm39) F167I probably damaging Het
Zfp1005 A T 2: 150,111,281 (GRCm39) H657L probably benign Het
Other mutations in Fbn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Fbn1 APN 2 125,166,867 (GRCm39) missense probably damaging 1.00
IGL00159:Fbn1 APN 2 125,239,793 (GRCm39) missense probably benign 0.14
IGL00500:Fbn1 APN 2 125,159,436 (GRCm39) missense probably damaging 0.99
IGL00558:Fbn1 APN 2 125,171,048 (GRCm39) splice site probably benign
IGL00645:Fbn1 APN 2 125,159,023 (GRCm39) splice site probably benign
IGL00863:Fbn1 APN 2 125,245,139 (GRCm39) missense possibly damaging 0.84
IGL00926:Fbn1 APN 2 125,160,962 (GRCm39) missense possibly damaging 0.84
IGL00935:Fbn1 APN 2 125,219,830 (GRCm39) nonsense probably null
IGL00950:Fbn1 APN 2 125,200,743 (GRCm39) missense probably damaging 1.00
IGL01090:Fbn1 APN 2 125,236,696 (GRCm39) splice site probably benign
IGL01106:Fbn1 APN 2 125,193,626 (GRCm39) missense possibly damaging 0.55
IGL01486:Fbn1 APN 2 125,231,898 (GRCm39) missense probably benign 0.03
IGL01519:Fbn1 APN 2 125,158,939 (GRCm39) missense probably benign 0.07
IGL01585:Fbn1 APN 2 125,202,030 (GRCm39) missense probably damaging 0.98
IGL01730:Fbn1 APN 2 125,154,894 (GRCm39) splice site probably benign
IGL01793:Fbn1 APN 2 125,229,213 (GRCm39) missense possibly damaging 0.67
IGL01803:Fbn1 APN 2 125,192,207 (GRCm39) missense probably damaging 1.00
IGL01803:Fbn1 APN 2 125,143,645 (GRCm39) missense probably benign
IGL01916:Fbn1 APN 2 125,157,366 (GRCm39) missense possibly damaging 0.55
IGL02035:Fbn1 APN 2 125,177,282 (GRCm39) splice site probably null
IGL02097:Fbn1 APN 2 125,205,889 (GRCm39) missense probably damaging 1.00
IGL02233:Fbn1 APN 2 125,163,530 (GRCm39) splice site probably benign
IGL02512:Fbn1 APN 2 125,180,380 (GRCm39) missense probably damaging 1.00
IGL02552:Fbn1 APN 2 125,254,633 (GRCm39) missense possibly damaging 0.86
IGL02657:Fbn1 APN 2 125,193,945 (GRCm39) missense possibly damaging 0.86
IGL02718:Fbn1 APN 2 125,211,806 (GRCm39) missense probably damaging 1.00
IGL02863:Fbn1 APN 2 125,145,176 (GRCm39) missense possibly damaging 0.80
IGL02974:Fbn1 APN 2 125,188,250 (GRCm39) missense probably null 0.99
IGL03058:Fbn1 APN 2 125,245,120 (GRCm39) missense probably benign 0.03
IGL03172:Fbn1 APN 2 125,162,888 (GRCm39) missense possibly damaging 0.92
IGL03288:Fbn1 APN 2 125,145,103 (GRCm39) missense probably benign 0.13
Carinatum UTSW 2 125,184,750 (GRCm39) missense possibly damaging 0.70
Elasticity UTSW 2 125,245,052 (GRCm39) missense possibly damaging 0.63
Excavatum UTSW 2 125,177,407 (GRCm39) missense probably damaging 1.00
Exceedingly UTSW 2 125,186,015 (GRCm39) critical splice acceptor site probably benign
Extensor UTSW 2 125,170,078 (GRCm39) missense probably damaging 1.00
lincoln UTSW 2 125,245,090 (GRCm39) missense possibly damaging 0.50
Long UTSW 2 125,158,958 (GRCm39) missense probably damaging 1.00
Pectus UTSW 2 125,163,611 (GRCm39) missense possibly damaging 0.82
Reach UTSW 2 125,223,954 (GRCm39) nonsense probably null
reaper UTSW 2 125,157,324 (GRCm39) missense probably damaging 0.98
Scythe UTSW 2 125,245,148 (GRCm39) missense possibly damaging 0.84
String_bean UTSW 2 125,221,054 (GRCm39) splice site probably null
wirey UTSW 2 125,151,415 (GRCm39) missense probably benign
3-1:Fbn1 UTSW 2 125,236,525 (GRCm39) splice site probably benign
BB004:Fbn1 UTSW 2 125,225,656 (GRCm39) missense possibly damaging 0.82
BB014:Fbn1 UTSW 2 125,225,656 (GRCm39) missense possibly damaging 0.82
P0012:Fbn1 UTSW 2 125,211,241 (GRCm39) splice site probably benign
PIT4403001:Fbn1 UTSW 2 125,184,831 (GRCm39) missense probably damaging 1.00
PIT4466001:Fbn1 UTSW 2 125,148,421 (GRCm39) missense possibly damaging 0.90
PIT4472001:Fbn1 UTSW 2 125,148,421 (GRCm39) missense possibly damaging 0.90
PIT4651001:Fbn1 UTSW 2 125,205,909 (GRCm39) critical splice acceptor site probably null
R0226:Fbn1 UTSW 2 125,162,830 (GRCm39) missense possibly damaging 0.86
R0310:Fbn1 UTSW 2 125,205,564 (GRCm39) missense probably damaging 1.00
R0362:Fbn1 UTSW 2 125,151,697 (GRCm39) missense probably damaging 0.99
R0374:Fbn1 UTSW 2 125,163,596 (GRCm39) missense possibly damaging 0.86
R0433:Fbn1 UTSW 2 125,190,135 (GRCm39) missense possibly damaging 0.95
R0441:Fbn1 UTSW 2 125,151,675 (GRCm39) critical splice donor site probably null
R0501:Fbn1 UTSW 2 125,143,669 (GRCm39) missense probably benign 0.23
R0510:Fbn1 UTSW 2 125,184,845 (GRCm39) splice site probably benign
R0573:Fbn1 UTSW 2 125,231,169 (GRCm39) missense probably damaging 0.99
R0622:Fbn1 UTSW 2 125,220,944 (GRCm39) missense possibly damaging 0.88
R0630:Fbn1 UTSW 2 125,236,690 (GRCm39) missense possibly damaging 0.48
R0724:Fbn1 UTSW 2 125,193,984 (GRCm39) missense probably benign 0.14
R0739:Fbn1 UTSW 2 125,209,550 (GRCm39) missense probably benign 0.18
R0744:Fbn1 UTSW 2 125,156,734 (GRCm39) splice site probably benign
R0811:Fbn1 UTSW 2 125,245,090 (GRCm39) missense possibly damaging 0.50
R0812:Fbn1 UTSW 2 125,245,090 (GRCm39) missense possibly damaging 0.50
R0862:Fbn1 UTSW 2 125,184,811 (GRCm39) nonsense probably null
R0864:Fbn1 UTSW 2 125,184,811 (GRCm39) nonsense probably null
R1061:Fbn1 UTSW 2 125,187,883 (GRCm39) missense probably benign 0.01
R1126:Fbn1 UTSW 2 125,163,112 (GRCm39) splice site probably null
R1172:Fbn1 UTSW 2 125,236,607 (GRCm39) missense probably benign 0.13
R1175:Fbn1 UTSW 2 125,236,607 (GRCm39) missense probably benign 0.13
R1183:Fbn1 UTSW 2 125,163,537 (GRCm39) missense probably benign 0.07
R1218:Fbn1 UTSW 2 125,254,669 (GRCm39) missense possibly damaging 0.71
R1241:Fbn1 UTSW 2 125,214,447 (GRCm39) splice site probably benign
R1248:Fbn1 UTSW 2 125,143,529 (GRCm39) missense probably benign 0.01
R1345:Fbn1 UTSW 2 125,156,591 (GRCm39) missense probably damaging 1.00
R1374:Fbn1 UTSW 2 125,188,354 (GRCm39) missense probably damaging 0.99
R1458:Fbn1 UTSW 2 125,143,849 (GRCm39) missense probably benign 0.01
R1474:Fbn1 UTSW 2 125,203,185 (GRCm39) missense possibly damaging 0.72
R1496:Fbn1 UTSW 2 125,151,415 (GRCm39) missense probably benign
R1502:Fbn1 UTSW 2 125,205,626 (GRCm39) nonsense probably null
R1511:Fbn1 UTSW 2 125,148,205 (GRCm39) missense probably benign 0.00
R1588:Fbn1 UTSW 2 125,161,034 (GRCm39) missense probably benign 0.19
R1626:Fbn1 UTSW 2 125,183,199 (GRCm39) missense probably damaging 1.00
R1676:Fbn1 UTSW 2 125,151,701 (GRCm39) missense probably damaging 1.00
R1712:Fbn1 UTSW 2 125,188,354 (GRCm39) missense probably damaging 0.99
R1772:Fbn1 UTSW 2 125,245,148 (GRCm39) missense possibly damaging 0.84
R1776:Fbn1 UTSW 2 125,163,654 (GRCm39) missense possibly damaging 0.71
R1869:Fbn1 UTSW 2 125,193,947 (GRCm39) missense probably benign 0.00
R1894:Fbn1 UTSW 2 125,236,541 (GRCm39) missense probably damaging 0.96
R1925:Fbn1 UTSW 2 125,205,549 (GRCm39) missense probably damaging 1.00
R1957:Fbn1 UTSW 2 125,209,574 (GRCm39) missense possibly damaging 0.93
R1995:Fbn1 UTSW 2 125,192,293 (GRCm39) critical splice acceptor site probably null
R2142:Fbn1 UTSW 2 125,254,628 (GRCm39) missense possibly damaging 0.93
R2268:Fbn1 UTSW 2 125,163,661 (GRCm39) missense possibly damaging 0.49
R3409:Fbn1 UTSW 2 125,254,585 (GRCm39) missense possibly damaging 0.92
R3418:Fbn1 UTSW 2 125,162,846 (GRCm39) missense possibly damaging 0.55
R3508:Fbn1 UTSW 2 125,148,247 (GRCm39) missense probably benign 0.19
R3778:Fbn1 UTSW 2 125,159,006 (GRCm39) missense probably damaging 1.00
R3800:Fbn1 UTSW 2 125,187,894 (GRCm39) missense possibly damaging 0.63
R4001:Fbn1 UTSW 2 125,319,415 (GRCm39) critical splice donor site probably null
R4169:Fbn1 UTSW 2 125,205,872 (GRCm39) missense possibly damaging 0.86
R4398:Fbn1 UTSW 2 125,239,701 (GRCm39) missense probably benign 0.32
R4482:Fbn1 UTSW 2 125,205,530 (GRCm39) critical splice donor site probably null
R4559:Fbn1 UTSW 2 125,193,634 (GRCm39) missense possibly damaging 0.65
R4608:Fbn1 UTSW 2 125,148,420 (GRCm39) missense probably benign 0.05
R4634:Fbn1 UTSW 2 125,185,981 (GRCm39) missense probably damaging 1.00
R4706:Fbn1 UTSW 2 125,212,069 (GRCm39) missense probably benign 0.21
R4712:Fbn1 UTSW 2 125,183,236 (GRCm39) missense probably benign 0.12
R4783:Fbn1 UTSW 2 125,166,839 (GRCm39) missense probably damaging 1.00
R4784:Fbn1 UTSW 2 125,166,839 (GRCm39) missense probably damaging 1.00
R4785:Fbn1 UTSW 2 125,166,839 (GRCm39) missense probably damaging 1.00
R4793:Fbn1 UTSW 2 125,163,155 (GRCm39) nonsense probably null
R4838:Fbn1 UTSW 2 125,214,319 (GRCm39) missense probably benign 0.01
R4864:Fbn1 UTSW 2 125,214,317 (GRCm39) missense possibly damaging 0.92
R4887:Fbn1 UTSW 2 125,151,694 (GRCm39) missense probably damaging 1.00
R4942:Fbn1 UTSW 2 125,225,536 (GRCm39) missense possibly damaging 0.88
R4952:Fbn1 UTSW 2 125,159,454 (GRCm39) missense probably damaging 1.00
R5030:Fbn1 UTSW 2 125,254,624 (GRCm39) missense possibly damaging 0.51
R5044:Fbn1 UTSW 2 125,171,022 (GRCm39) missense probably damaging 0.97
R5057:Fbn1 UTSW 2 125,308,615 (GRCm39) missense probably benign 0.33
R5115:Fbn1 UTSW 2 125,174,303 (GRCm39) missense probably damaging 1.00
R5399:Fbn1 UTSW 2 125,174,253 (GRCm39) missense possibly damaging 0.69
R5498:Fbn1 UTSW 2 125,202,096 (GRCm39) missense probably damaging 1.00
R5526:Fbn1 UTSW 2 125,207,559 (GRCm39) missense possibly damaging 0.83
R5529:Fbn1 UTSW 2 125,215,870 (GRCm39) missense probably benign 0.01
R5602:Fbn1 UTSW 2 125,163,661 (GRCm39) missense possibly damaging 0.49
R5760:Fbn1 UTSW 2 125,203,167 (GRCm39) missense probably damaging 1.00
R5837:Fbn1 UTSW 2 125,221,054 (GRCm39) splice site probably null
R5955:Fbn1 UTSW 2 125,200,802 (GRCm39) missense probably damaging 1.00
R5980:Fbn1 UTSW 2 125,157,324 (GRCm39) missense probably damaging 0.98
R6039:Fbn1 UTSW 2 125,205,800 (GRCm39) missense probably damaging 1.00
R6039:Fbn1 UTSW 2 125,205,800 (GRCm39) missense probably damaging 1.00
R6058:Fbn1 UTSW 2 125,308,532 (GRCm39) missense possibly damaging 0.73
R6089:Fbn1 UTSW 2 125,163,145 (GRCm39) missense possibly damaging 0.55
R6136:Fbn1 UTSW 2 125,245,052 (GRCm39) missense possibly damaging 0.63
R6161:Fbn1 UTSW 2 125,211,721 (GRCm39) nonsense probably null
R6162:Fbn1 UTSW 2 125,202,147 (GRCm39) missense probably damaging 1.00
R6165:Fbn1 UTSW 2 125,174,283 (GRCm39) missense probably damaging 0.99
R6169:Fbn1 UTSW 2 125,177,409 (GRCm39) critical splice acceptor site probably null
R6221:Fbn1 UTSW 2 125,162,841 (GRCm39) missense probably benign 0.07
R6223:Fbn1 UTSW 2 125,254,591 (GRCm39) missense possibly damaging 0.86
R6225:Fbn1 UTSW 2 125,172,463 (GRCm39) missense probably damaging 1.00
R6238:Fbn1 UTSW 2 125,166,865 (GRCm39) missense probably damaging 0.98
R6329:Fbn1 UTSW 2 125,150,393 (GRCm39) missense possibly damaging 0.70
R6401:Fbn1 UTSW 2 125,188,370 (GRCm39) missense probably damaging 0.98
R6480:Fbn1 UTSW 2 125,177,338 (GRCm39) missense probably benign 0.05
R6513:Fbn1 UTSW 2 125,225,591 (GRCm39) missense probably damaging 1.00
R6530:Fbn1 UTSW 2 125,231,190 (GRCm39) missense probably damaging 0.99
R6595:Fbn1 UTSW 2 125,184,750 (GRCm39) missense possibly damaging 0.70
R6781:Fbn1 UTSW 2 125,158,958 (GRCm39) missense probably damaging 1.00
R6849:Fbn1 UTSW 2 125,163,611 (GRCm39) missense possibly damaging 0.82
R6860:Fbn1 UTSW 2 125,170,078 (GRCm39) missense probably damaging 1.00
R6960:Fbn1 UTSW 2 125,223,980 (GRCm39) missense probably benign 0.16
R7134:Fbn1 UTSW 2 125,223,969 (GRCm39) missense probably benign 0.03
R7241:Fbn1 UTSW 2 125,148,415 (GRCm39) missense possibly damaging 0.86
R7295:Fbn1 UTSW 2 125,177,407 (GRCm39) missense probably damaging 1.00
R7312:Fbn1 UTSW 2 125,308,594 (GRCm39) missense possibly damaging 0.53
R7322:Fbn1 UTSW 2 125,321,115 (GRCm39) missense possibly damaging 0.92
R7349:Fbn1 UTSW 2 125,157,321 (GRCm39) missense possibly damaging 0.84
R7365:Fbn1 UTSW 2 125,193,969 (GRCm39) missense probably damaging 0.97
R7392:Fbn1 UTSW 2 125,185,844 (GRCm39) missense probably damaging 1.00
R7442:Fbn1 UTSW 2 125,245,132 (GRCm39) missense possibly damaging 0.45
R7452:Fbn1 UTSW 2 125,347,375 (GRCm39) missense possibly damaging 0.53
R7453:Fbn1 UTSW 2 125,162,879 (GRCm39) missense possibly damaging 0.93
R7457:Fbn1 UTSW 2 125,193,667 (GRCm39) missense possibly damaging 0.90
R7458:Fbn1 UTSW 2 125,161,036 (GRCm39) missense probably benign 0.14
R7549:Fbn1 UTSW 2 125,185,947 (GRCm39) missense probably damaging 0.99
R7570:Fbn1 UTSW 2 125,239,772 (GRCm39) missense probably benign 0.29
R7666:Fbn1 UTSW 2 125,148,391 (GRCm39) missense probably damaging 1.00
R7723:Fbn1 UTSW 2 125,223,954 (GRCm39) nonsense probably null
R7745:Fbn1 UTSW 2 125,145,115 (GRCm39) missense probably benign 0.06
R7754:Fbn1 UTSW 2 125,321,200 (GRCm39) splice site probably null
R7780:Fbn1 UTSW 2 125,143,678 (GRCm39) missense probably benign 0.15
R7849:Fbn1 UTSW 2 125,151,405 (GRCm39) missense probably damaging 0.98
R7927:Fbn1 UTSW 2 125,225,656 (GRCm39) missense possibly damaging 0.82
R7942:Fbn1 UTSW 2 125,254,706 (GRCm39) missense possibly damaging 0.53
R7948:Fbn1 UTSW 2 125,183,219 (GRCm39) missense probably damaging 1.00
R7985:Fbn1 UTSW 2 125,143,798 (GRCm39) missense probably benign 0.01
R8051:Fbn1 UTSW 2 125,148,383 (GRCm39) missense possibly damaging 0.86
R8054:Fbn1 UTSW 2 125,187,938 (GRCm39) missense possibly damaging 0.93
R8058:Fbn1 UTSW 2 125,193,889 (GRCm39) missense possibly damaging 0.46
R8113:Fbn1 UTSW 2 125,319,489 (GRCm39) missense probably damaging 1.00
R8307:Fbn1 UTSW 2 125,347,402 (GRCm39) missense possibly damaging 0.53
R8472:Fbn1 UTSW 2 125,151,722 (GRCm39) missense probably damaging 1.00
R8690:Fbn1 UTSW 2 125,186,015 (GRCm39) critical splice acceptor site probably benign
R8724:Fbn1 UTSW 2 125,202,066 (GRCm39) missense probably damaging 0.98
R8856:Fbn1 UTSW 2 125,156,637 (GRCm39) missense probably damaging 1.00
R8916:Fbn1 UTSW 2 125,245,149 (GRCm39) missense possibly damaging 0.63
R8931:Fbn1 UTSW 2 125,202,095 (GRCm39) missense probably damaging 1.00
R8988:Fbn1 UTSW 2 125,212,726 (GRCm39) missense possibly damaging 0.88
R9127:Fbn1 UTSW 2 125,223,985 (GRCm39) missense possibly damaging 0.86
R9161:Fbn1 UTSW 2 125,192,270 (GRCm39) missense probably damaging 1.00
R9495:Fbn1 UTSW 2 125,160,984 (GRCm39) missense probably damaging 0.96
R9515:Fbn1 UTSW 2 125,207,551 (GRCm39) missense probably benign 0.03
R9557:Fbn1 UTSW 2 125,180,458 (GRCm39) missense probably damaging 0.99
R9597:Fbn1 UTSW 2 125,187,906 (GRCm39) missense probably benign
R9680:Fbn1 UTSW 2 125,310,484 (GRCm39) missense probably benign 0.29
R9723:Fbn1 UTSW 2 125,202,119 (GRCm39) nonsense probably null
R9734:Fbn1 UTSW 2 125,231,898 (GRCm39) missense probably benign 0.03
R9796:Fbn1 UTSW 2 125,158,941 (GRCm39) missense probably benign 0.19
X0019:Fbn1 UTSW 2 125,225,563 (GRCm39) missense possibly damaging 0.82
X0020:Fbn1 UTSW 2 125,211,260 (GRCm39) missense probably damaging 1.00
X0028:Fbn1 UTSW 2 125,184,718 (GRCm39) critical splice donor site probably null
X0067:Fbn1 UTSW 2 125,211,834 (GRCm39) missense possibly damaging 0.95
Z1088:Fbn1 UTSW 2 125,192,208 (GRCm39) missense probably damaging 0.99
Z1176:Fbn1 UTSW 2 125,229,270 (GRCm39) missense possibly damaging 0.51
Z1177:Fbn1 UTSW 2 125,231,151 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTTGTACAGGTGACAAGCGG -3'
(R):5'- CACCTTTTGGATGCCCTCAG -3'

Sequencing Primer
(F):5'- GGAAACACCTAGAACTACCCTGG -3'
(R):5'- GGATGCCCTCAGTTTCATTCAAG -3'
Posted On 2014-10-01