Incidental Mutation 'R2140:Ptprt'
ID236113
Institutional Source Beutler Lab
Gene Symbol Ptprt
Ensembl Gene ENSMUSG00000053141
Gene Nameprotein tyrosine phosphatase, receptor type, T
SynonymsRPTPrho
MMRRC Submission 040143-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.110) question?
Stock #R2140 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location161521990-162661147 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 161811988 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 574 (T574I)
Ref Sequence ENSEMBL: ENSMUSP00000105071 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109441] [ENSMUST00000109442] [ENSMUST00000109443] [ENSMUST00000109445]
Predicted Effect probably damaging
Transcript: ENSMUST00000109441
AA Change: T574I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000105067
Gene: ENSMUSG00000053141
AA Change: T574I

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
MAM 31 195 2.21e-71 SMART
IG 202 290 3.94e-2 SMART
FN3 292 375 3.35e-3 SMART
FN3 388 477 4.06e-2 SMART
FN3 489 579 1.2e-4 SMART
transmembrane domain 753 772 N/A INTRINSIC
PTPc 882 1159 3.64e-129 SMART
PTPc 1188 1453 4.24e-98 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000109442
AA Change: T574I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000105068
Gene: ENSMUSG00000053141
AA Change: T574I

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
MAM 31 195 2.21e-71 SMART
IG 202 290 3.94e-2 SMART
FN3 292 375 3.35e-3 SMART
FN3 388 477 4.06e-2 SMART
FN3 489 579 1.2e-4 SMART
low complexity region 738 749 N/A INTRINSIC
transmembrane domain 772 791 N/A INTRINSIC
PTPc 901 1158 5.56e-134 SMART
PTPc 1187 1452 4.24e-98 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000109443
AA Change: T574I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000105069
Gene: ENSMUSG00000053141
AA Change: T574I

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
MAM 31 195 2.21e-71 SMART
IG 202 290 3.94e-2 SMART
FN3 292 375 3.35e-3 SMART
FN3 388 477 4.06e-2 SMART
FN3 489 579 1.2e-4 SMART
low complexity region 778 792 N/A INTRINSIC
PTPc 892 1149 5.56e-134 SMART
PTPc 1178 1443 4.24e-98 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000109445
AA Change: T574I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000105071
Gene: ENSMUSG00000053141
AA Change: T574I

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
MAM 31 195 2.21e-71 SMART
IG 202 290 3.94e-2 SMART
FN3 292 375 3.35e-3 SMART
FN3 388 477 4.06e-2 SMART
FN3 489 579 1.2e-4 SMART
transmembrane domain 753 772 N/A INTRINSIC
PTPc 882 1139 5.56e-134 SMART
PTPc 1168 1433 4.24e-98 SMART
Meta Mutation Damage Score 0.7095 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency 100% (96/96)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP possesses an extracellular region, a single transmembrane region, and two tandem intracellular catalytic domains, and thus represents a receptor-type PTP. The extracellular region contains a meprin-A5 antigen-PTP (MAM) domain, Ig-like and fibronectin type III-like repeats. The protein domain structure and the expression pattern of the mouse counterpart of this PTP suggest its roles in both signal transduction and cellular adhesion in the central nervous system. Two alternatively spliced transcript variants of this gene, which encode distinct proteins, have been reported. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele are highly susceptible to carcinogen azoxymethane-induced colon tumors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 96 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610042L04Rik T C 14: 4,348,902 I21T probably damaging Het
9230110C19Rik T C 9: 8,022,477 D248G probably damaging Het
Adgrf1 A C 17: 43,300,802 E186D probably damaging Het
Adgrf4 C T 17: 42,666,898 R518Q possibly damaging Het
Afdn A G 17: 13,810,433 E202G probably damaging Het
Agfg2 T A 5: 137,667,116 R126W probably damaging Het
Alkbh2 C T 5: 114,125,716 V77I probably benign Het
Alppl2 A G 1: 87,087,697 S381P probably benign Het
Aqp2 A G 15: 99,579,366 T72A probably damaging Het
Atp9b A G 18: 80,736,087 C1123R probably damaging Het
AU016765 T A 17: 64,520,000 noncoding transcript Het
Bscl2 T C 19: 8,845,320 probably null Het
Ccdc80 A T 16: 45,127,446 Y929F probably damaging Het
Cenpj T C 14: 56,526,932 D1341G probably damaging Het
Cir1 A T 2: 73,312,437 S18T probably damaging Het
Clcn6 A G 4: 148,024,137 F145S possibly damaging Het
Cnksr1 A G 4: 134,229,628 Y488H probably damaging Het
Cntrl CAGAG CAG 2: 35,122,806 probably null Het
Crb1 T C 1: 139,237,012 I1125V probably benign Het
Cyp3a13 A T 5: 137,921,454 V20D possibly damaging Het
Dars T A 1: 128,372,162 M362L probably benign Het
Dck T C 5: 88,772,723 C101R probably damaging Het
Dnah11 T C 12: 118,008,810 T2880A probably benign Het
Dnah7b T A 1: 46,268,670 M3048K probably damaging Het
Eef1a2 C T 2: 181,148,742 E374K probably benign Het
Eif3a A T 19: 60,775,394 probably benign Het
Esco1 A G 18: 10,574,873 probably null Het
Exoc8 C T 8: 124,897,415 R71Q possibly damaging Het
Fam208a C T 14: 27,480,035 T1462I probably damaging Het
Far1 G A 7: 113,566,460 V445M possibly damaging Het
Fbn1 C A 2: 125,343,810 C1648F probably damaging Het
Fmn1 A G 2: 113,595,048 K1189R probably benign Het
Foxl2 C A 9: 98,956,487 P276H unknown Het
Fpr3 T A 17: 17,970,617 V50E probably damaging Het
Garem1 T A 18: 21,129,374 R794S probably damaging Het
Gemin4 G C 11: 76,211,050 P962A probably damaging Het
Glyatl3 T C 17: 40,911,084 D93G probably benign Het
Gm14124 A T 2: 150,269,361 H657L probably benign Het
Gm4787 A G 12: 81,378,562 I274T probably benign Het
Gucy1a1 C T 3: 82,118,886 probably null Het
Hook1 GATGAATGA GATGA 4: 96,013,312 probably null Het
Ift20 G A 11: 78,540,034 E68K probably damaging Het
Ints13 A G 6: 146,576,431 S7P probably damaging Het
Kat5 T A 19: 5,605,685 probably null Het
Kcnma1 A C 14: 23,314,220 L988R probably damaging Het
Kcnq3 C A 15: 66,005,978 probably benign Het
Kctd16 A G 18: 40,259,178 E273G possibly damaging Het
Krt82 T A 15: 101,545,156 Q265L probably damaging Het
Lama2 A T 10: 27,054,694 probably null Het
Laptm4b G T 15: 34,238,332 M3I probably benign Het
Lmtk2 A G 5: 144,147,615 Y156C probably damaging Het
Lrrc58 G A 16: 37,881,409 E350K probably damaging Het
Lrrk1 A T 7: 66,330,750 D227E probably damaging Het
Macf1 C T 4: 123,355,102 C7210Y probably damaging Het
Madd A G 2: 91,152,509 I1363T possibly damaging Het
Mcm3 A G 1: 20,813,110 V295A probably benign Het
Mki67 A G 7: 135,695,592 I2571T possibly damaging Het
Mtrr C T 13: 68,568,940 A385T possibly damaging Het
Myh7b A G 2: 155,620,123 Y313C probably damaging Het
Myot A T 18: 44,354,125 H343L possibly damaging Het
Myt1 C A 2: 181,825,979 Q1069K probably damaging Het
Nid1 T A 13: 13,499,668 D877E probably damaging Het
Nle1 A G 11: 82,905,568 V159A probably damaging Het
Nmbr C A 10: 14,770,442 Y353* probably null Het
Nos1ap T A 1: 170,329,166 D241V probably damaging Het
Nostrin A C 2: 69,166,003 Y209S probably damaging Het
Olfr1099 A T 2: 86,959,281 M59K probably damaging Het
Olfr115 T G 17: 37,610,471 E93D probably benign Het
Olfr1168 A T 2: 88,185,095 S73C probably benign Het
Olfr1240 C T 2: 89,439,583 R232H probably benign Het
Olfr283 G A 15: 98,378,396 T238I possibly damaging Het
Olfr378 A T 11: 73,425,881 M34K probably damaging Het
Pcdh7 T A 5: 58,128,996 V1138E probably damaging Het
Pglyrp3 T G 3: 92,026,567 V173G probably benign Het
Plec T C 15: 76,183,174 T1331A probably benign Het
Plxnb2 T C 15: 89,156,562 D1787G probably benign Het
Pms1 T A 1: 53,281,988 I29F probably damaging Het
R3hdm1 A G 1: 128,190,693 Y561C probably damaging Het
Rab17 A G 1: 90,960,078 F120S probably benign Het
Rab7b T A 1: 131,698,419 W62R probably damaging Het
Ryr2 C T 13: 11,560,607 G4835E probably damaging Het
Ryr3 A G 2: 112,875,148 V807A probably benign Het
Sept4 A T 11: 87,583,436 Q60L probably benign Het
Slc23a1 C T 18: 35,626,434 R26Q unknown Het
Slc7a4 C A 16: 17,574,544 R342L possibly damaging Het
Slfn9 C T 11: 82,984,655 C367Y possibly damaging Het
Slitrk6 T G 14: 110,750,794 T494P probably benign Het
Tiam1 A G 16: 89,849,645 probably benign Het
Tiparp C A 3: 65,529,252 probably benign Het
Tmem39b T C 4: 129,678,688 T374A probably benign Het
Trim5 G A 7: 104,276,791 R188* probably null Het
Ttn C T 2: 76,813,339 G11436R probably damaging Het
Ubr4 C T 4: 139,477,207 T4810M probably damaging Het
Vmn2r26 A T 6: 124,061,237 E590D probably benign Het
Wwc1 A G 11: 35,870,528 F650S probably benign Het
Xrcc6 T A 15: 82,022,977 F167I probably damaging Het
Other mutations in Ptprt
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00231:Ptprt APN 2 161810624 missense probably benign 0.00
IGL00565:Ptprt APN 2 161560191 missense probably damaging 1.00
IGL00925:Ptprt APN 2 161656163 missense possibly damaging 0.52
IGL01344:Ptprt APN 2 161551817 missense probably damaging 1.00
IGL01432:Ptprt APN 2 162268079 splice site probably benign
IGL02008:Ptprt APN 2 161927673 missense probably benign 0.02
IGL02040:Ptprt APN 2 162238072 missense probably damaging 1.00
IGL02172:Ptprt APN 2 161555502 missense probably damaging 1.00
IGL02231:Ptprt APN 2 162238060 missense probably damaging 1.00
IGL02231:Ptprt APN 2 162278046 critical splice donor site probably null
IGL02232:Ptprt APN 2 161530517 missense probably damaging 0.96
IGL02277:Ptprt APN 2 161547381 missense probably damaging 1.00
IGL02447:Ptprt APN 2 162278107 missense probably benign 0.01
IGL02601:Ptprt APN 2 161766307 missense probably benign 0.10
IGL02623:Ptprt APN 2 161607452 splice site probably benign
IGL03379:Ptprt APN 2 161555459 nonsense probably null
Poverina UTSW 2 161901497 missense possibly damaging 0.70
IGL03055:Ptprt UTSW 2 161533613 missense probably damaging 0.96
R0064:Ptprt UTSW 2 161927791 splice site probably benign
R0129:Ptprt UTSW 2 162278070 missense probably benign 0.35
R0131:Ptprt UTSW 2 162278110 missense probably benign 0.00
R0131:Ptprt UTSW 2 162278110 missense probably benign 0.00
R0132:Ptprt UTSW 2 162278110 missense probably benign 0.00
R0316:Ptprt UTSW 2 161607319 missense probably damaging 1.00
R0454:Ptprt UTSW 2 161553822 missense probably damaging 0.96
R0488:Ptprt UTSW 2 161553825 missense probably damaging 0.99
R0573:Ptprt UTSW 2 161551748 missense probably damaging 1.00
R0614:Ptprt UTSW 2 161812120 missense possibly damaging 0.59
R0834:Ptprt UTSW 2 161812139 splice site probably null
R1023:Ptprt UTSW 2 161558943 missense probably damaging 1.00
R1184:Ptprt UTSW 2 161927772 missense possibly damaging 0.82
R1253:Ptprt UTSW 2 162278226 missense probably damaging 1.00
R1476:Ptprt UTSW 2 161927484 missense probably damaging 1.00
R1515:Ptprt UTSW 2 162238034 missense probably damaging 1.00
R1595:Ptprt UTSW 2 161810549 critical splice donor site probably null
R1939:Ptprt UTSW 2 161927640 missense probably benign 0.45
R1987:Ptprt UTSW 2 161558898 missense probably damaging 1.00
R1987:Ptprt UTSW 2 161766321 missense possibly damaging 0.48
R2049:Ptprt UTSW 2 161534545 missense probably damaging 1.00
R2421:Ptprt UTSW 2 162278040 splice site probably benign
R3432:Ptprt UTSW 2 161927529 missense probably damaging 1.00
R3619:Ptprt UTSW 2 161566157 missense probably damaging 1.00
R3757:Ptprt UTSW 2 161812030 missense probably damaging 1.00
R3758:Ptprt UTSW 2 161812030 missense probably damaging 1.00
R3834:Ptprt UTSW 2 161547387 missense probably damaging 1.00
R3835:Ptprt UTSW 2 161547387 missense probably damaging 1.00
R3915:Ptprt UTSW 2 161555555 splice site probably benign
R4003:Ptprt UTSW 2 161566117 splice site probably benign
R4387:Ptprt UTSW 2 161927650 missense probably damaging 1.00
R4519:Ptprt UTSW 2 161564689 missense probably damaging 1.00
R4618:Ptprt UTSW 2 161553845 missense probably damaging 1.00
R4677:Ptprt UTSW 2 161901446 critical splice donor site probably null
R4866:Ptprt UTSW 2 161560239 missense probably damaging 1.00
R5088:Ptprt UTSW 2 162238175 missense probably benign 0.01
R5173:Ptprt UTSW 2 161927756 missense probably benign 0.01
R5215:Ptprt UTSW 2 162278164 missense probably damaging 1.00
R5383:Ptprt UTSW 2 161698049 missense probably damaging 1.00
R5398:Ptprt UTSW 2 161927592 missense probably damaging 1.00
R5518:Ptprt UTSW 2 162278223 missense probably damaging 0.99
R5711:Ptprt UTSW 2 161810604 missense probably damaging 0.98
R5735:Ptprt UTSW 2 161534564 missense probably damaging 0.98
R5834:Ptprt UTSW 2 161560269 missense probably damaging 1.00
R5872:Ptprt UTSW 2 162135218 missense probably damaging 1.00
R5926:Ptprt UTSW 2 161564686 missense probably benign 0.00
R6210:Ptprt UTSW 2 162268029 missense probably damaging 1.00
R6285:Ptprt UTSW 2 161901497 missense possibly damaging 0.70
R6298:Ptprt UTSW 2 161553859 missense probably damaging 1.00
R6406:Ptprt UTSW 2 161553783 missense probably damaging 0.98
R6499:Ptprt UTSW 2 161534587 missense probably benign 0.32
R6613:Ptprt UTSW 2 161530447 missense probably damaging 1.00
R6622:Ptprt UTSW 2 161553840 missense probably damaging 1.00
R7218:Ptprt UTSW 2 161547364 missense probably damaging 1.00
R7247:Ptprt UTSW 2 161533523 missense probably benign 0.15
R7576:Ptprt UTSW 2 161607305 missense possibly damaging 0.88
R7733:Ptprt UTSW 2 161575787 missense probably damaging 1.00
R7735:Ptprt UTSW 2 161575741 missense probably damaging 1.00
R7813:Ptprt UTSW 2 161530493 missense probably damaging 1.00
R8031:Ptprt UTSW 2 162135457 missense probably damaging 1.00
R8074:Ptprt UTSW 2 161927661 missense possibly damaging 0.77
X0064:Ptprt UTSW 2 161927483 missense probably damaging 1.00
Z1088:Ptprt UTSW 2 162238121 missense possibly damaging 0.86
Z1177:Ptprt UTSW 2 161732887 missense probably damaging 1.00
Z1177:Ptprt UTSW 2 162362948 missense possibly damaging 0.77
Predicted Primers PCR Primer
(F):5'- AATCGTTCCATTGCCATCAGTG -3'
(R):5'- ACATAGTGGCTTAGCTTACCTCTC -3'

Sequencing Primer
(F):5'- CCATTGCCATCAGTGATAGTTG -3'
(R):5'- GCTGCCCCTCTCTAGTGAG -3'
Posted On2014-10-01