Incidental Mutation 'R2140:Ptprt'
ID 236113
Institutional Source Beutler Lab
Gene Symbol Ptprt
Ensembl Gene ENSMUSG00000053141
Gene Name protein tyrosine phosphatase receptor type T
Synonyms RPTPrho
MMRRC Submission 040143-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.080) question?
Stock # R2140 (G1)
Quality Score 225
Status Validated
Chromosome 2
Chromosomal Location 161363910-162503067 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 161653908 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Isoleucine at position 574 (T574I)
Ref Sequence ENSEMBL: ENSMUSP00000105071 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109441] [ENSMUST00000109442] [ENSMUST00000109443] [ENSMUST00000109445]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000109441
AA Change: T574I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000105067
Gene: ENSMUSG00000053141
AA Change: T574I

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
MAM 31 195 2.21e-71 SMART
IG 202 290 3.94e-2 SMART
FN3 292 375 3.35e-3 SMART
FN3 388 477 4.06e-2 SMART
FN3 489 579 1.2e-4 SMART
transmembrane domain 753 772 N/A INTRINSIC
PTPc 882 1159 3.64e-129 SMART
PTPc 1188 1453 4.24e-98 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000109442
AA Change: T574I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000105068
Gene: ENSMUSG00000053141
AA Change: T574I

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
MAM 31 195 2.21e-71 SMART
IG 202 290 3.94e-2 SMART
FN3 292 375 3.35e-3 SMART
FN3 388 477 4.06e-2 SMART
FN3 489 579 1.2e-4 SMART
low complexity region 738 749 N/A INTRINSIC
transmembrane domain 772 791 N/A INTRINSIC
PTPc 901 1158 5.56e-134 SMART
PTPc 1187 1452 4.24e-98 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000109443
AA Change: T574I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000105069
Gene: ENSMUSG00000053141
AA Change: T574I

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
MAM 31 195 2.21e-71 SMART
IG 202 290 3.94e-2 SMART
FN3 292 375 3.35e-3 SMART
FN3 388 477 4.06e-2 SMART
FN3 489 579 1.2e-4 SMART
low complexity region 778 792 N/A INTRINSIC
PTPc 892 1149 5.56e-134 SMART
PTPc 1178 1443 4.24e-98 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000109445
AA Change: T574I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000105071
Gene: ENSMUSG00000053141
AA Change: T574I

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
MAM 31 195 2.21e-71 SMART
IG 202 290 3.94e-2 SMART
FN3 292 375 3.35e-3 SMART
FN3 388 477 4.06e-2 SMART
FN3 489 579 1.2e-4 SMART
transmembrane domain 753 772 N/A INTRINSIC
PTPc 882 1139 5.56e-134 SMART
PTPc 1168 1433 4.24e-98 SMART
Meta Mutation Damage Score 0.7095 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency 100% (96/96)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP possesses an extracellular region, a single transmembrane region, and two tandem intracellular catalytic domains, and thus represents a receptor-type PTP. The extracellular region contains a meprin-A5 antigen-PTP (MAM) domain, Ig-like and fibronectin type III-like repeats. The protein domain structure and the expression pattern of the mouse counterpart of this PTP suggest its roles in both signal transduction and cellular adhesion in the central nervous system. Two alternatively spliced transcript variants of this gene, which encode distinct proteins, have been reported. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele are highly susceptible to carcinogen azoxymethane-induced colon tumors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 96 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610042L04Rik T C 14: 4,348,902 (GRCm38) I21T probably damaging Het
Adgrf1 A C 17: 43,611,693 (GRCm39) E186D probably damaging Het
Adgrf4 C T 17: 42,977,789 (GRCm39) R518Q possibly damaging Het
Afdn A G 17: 14,030,695 (GRCm39) E202G probably damaging Het
Agfg2 T A 5: 137,665,378 (GRCm39) R126W probably damaging Het
Alkbh2 C T 5: 114,263,777 (GRCm39) V77I probably benign Het
Alppl2 A G 1: 87,015,419 (GRCm39) S381P probably benign Het
Aqp2 A G 15: 99,477,247 (GRCm39) T72A probably damaging Het
Atp9b A G 18: 80,779,302 (GRCm39) C1123R probably damaging Het
AU016765 T A 17: 64,826,995 (GRCm39) noncoding transcript Het
Bscl2 T C 19: 8,822,684 (GRCm39) probably null Het
Ccdc80 A T 16: 44,947,809 (GRCm39) Y929F probably damaging Het
Cenpj T C 14: 56,764,389 (GRCm39) D1341G probably damaging Het
Cfap300 T C 9: 8,022,478 (GRCm39) D248G probably damaging Het
Cir1 A T 2: 73,142,781 (GRCm39) S18T probably damaging Het
Clcn6 A G 4: 148,108,594 (GRCm39) F145S possibly damaging Het
Cnksr1 A G 4: 133,956,939 (GRCm39) Y488H probably damaging Het
Cntrl CAGAG CAG 2: 35,012,818 (GRCm39) probably null Het
Crb1 T C 1: 139,164,750 (GRCm39) I1125V probably benign Het
Cyp3a13 A T 5: 137,919,716 (GRCm39) V20D possibly damaging Het
Dars1 T A 1: 128,299,899 (GRCm39) M362L probably benign Het
Dck T C 5: 88,920,582 (GRCm39) C101R probably damaging Het
Dnah11 T C 12: 117,972,545 (GRCm39) T2880A probably benign Het
Dnah7b T A 1: 46,307,830 (GRCm39) M3048K probably damaging Het
Eef1a2 C T 2: 180,790,535 (GRCm39) E374K probably benign Het
Eif3a A T 19: 60,763,832 (GRCm39) probably benign Het
Esco1 A G 18: 10,574,873 (GRCm39) probably null Het
Exoc8 C T 8: 125,624,154 (GRCm39) R71Q possibly damaging Het
Far1 G A 7: 113,165,667 (GRCm39) V445M possibly damaging Het
Fbn1 C A 2: 125,185,730 (GRCm39) C1648F probably damaging Het
Fmn1 A G 2: 113,425,393 (GRCm39) K1189R probably benign Het
Foxl2 C A 9: 98,838,540 (GRCm39) P276H unknown Het
Fpr3 T A 17: 18,190,879 (GRCm39) V50E probably damaging Het
Garem1 T A 18: 21,262,431 (GRCm39) R794S probably damaging Het
Gemin4 G C 11: 76,101,876 (GRCm39) P962A probably damaging Het
Glyatl3 T C 17: 41,221,975 (GRCm39) D93G probably benign Het
Gm4787 A G 12: 81,425,336 (GRCm39) I274T probably benign Het
Gucy1a1 C T 3: 82,026,193 (GRCm39) probably null Het
Hook1 GATGAATGA GATGA 4: 95,901,549 (GRCm39) 503 probably null Het
Ift20 G A 11: 78,430,860 (GRCm39) E68K probably damaging Het
Ints13 A G 6: 146,477,929 (GRCm39) S7P probably damaging Het
Kat5 T A 19: 5,655,713 (GRCm39) probably null Het
Kcnma1 A C 14: 23,364,288 (GRCm39) L988R probably damaging Het
Kcnq3 C A 15: 65,877,827 (GRCm39) probably benign Het
Kctd16 A G 18: 40,392,231 (GRCm39) E273G possibly damaging Het
Krt82 T A 15: 101,453,591 (GRCm39) Q265L probably damaging Het
Lama2 A T 10: 26,930,690 (GRCm39) probably null Het
Laptm4b G T 15: 34,238,478 (GRCm39) M3I probably benign Het
Lmtk2 A G 5: 144,084,433 (GRCm39) Y156C probably damaging Het
Lrrc58 G A 16: 37,701,771 (GRCm39) E350K probably damaging Het
Lrrk1 A T 7: 65,980,498 (GRCm39) D227E probably damaging Het
Macf1 C T 4: 123,248,895 (GRCm39) C7210Y probably damaging Het
Madd A G 2: 90,982,854 (GRCm39) I1363T possibly damaging Het
Mcm3 A G 1: 20,883,334 (GRCm39) V295A probably benign Het
Mki67 A G 7: 135,297,321 (GRCm39) I2571T possibly damaging Het
Mtrr C T 13: 68,717,059 (GRCm39) A385T possibly damaging Het
Myh7b A G 2: 155,462,043 (GRCm39) Y313C probably damaging Het
Myot A T 18: 44,487,192 (GRCm39) H343L possibly damaging Het
Myt1 C A 2: 181,467,772 (GRCm39) Q1069K probably damaging Het
Nid1 T A 13: 13,674,253 (GRCm39) D877E probably damaging Het
Nle1 A G 11: 82,796,394 (GRCm39) V159A probably damaging Het
Nmbr C A 10: 14,646,186 (GRCm39) Y353* probably null Het
Nos1ap T A 1: 170,156,735 (GRCm39) D241V probably damaging Het
Nostrin A C 2: 68,996,347 (GRCm39) Y209S probably damaging Het
Or14j4 T G 17: 37,921,362 (GRCm39) E93D probably benign Het
Or1e19 A T 11: 73,316,707 (GRCm39) M34K probably damaging Het
Or4a68 C T 2: 89,269,927 (GRCm39) R232H probably benign Het
Or5d40 A T 2: 88,015,439 (GRCm39) S73C probably benign Het
Or8h9 A T 2: 86,789,625 (GRCm39) M59K probably damaging Het
Or8s2 G A 15: 98,276,277 (GRCm39) T238I possibly damaging Het
Pcdh7 T A 5: 58,286,338 (GRCm39) V1138E probably damaging Het
Pglyrp3 T G 3: 91,933,874 (GRCm39) V173G probably benign Het
Plec T C 15: 76,067,374 (GRCm39) T1331A probably benign Het
Plxnb2 T C 15: 89,040,765 (GRCm39) D1787G probably benign Het
Pms1 T A 1: 53,321,147 (GRCm39) I29F probably damaging Het
R3hdm1 A G 1: 128,118,430 (GRCm39) Y561C probably damaging Het
Rab17 A G 1: 90,887,800 (GRCm39) F120S probably benign Het
Rab7b T A 1: 131,626,157 (GRCm39) W62R probably damaging Het
Ryr2 C T 13: 11,575,493 (GRCm39) G4835E probably damaging Het
Ryr3 A G 2: 112,705,493 (GRCm39) V807A probably benign Het
Septin4 A T 11: 87,474,262 (GRCm39) Q60L probably benign Het
Slc23a1 C T 18: 35,759,487 (GRCm39) R26Q unknown Het
Slc7a4 C A 16: 17,392,408 (GRCm39) R342L possibly damaging Het
Slfn9 C T 11: 82,875,481 (GRCm39) C367Y possibly damaging Het
Slitrk6 T G 14: 110,988,226 (GRCm39) T494P probably benign Het
Tasor C T 14: 27,201,992 (GRCm39) T1462I probably damaging Het
Tiam1 A G 16: 89,646,533 (GRCm39) probably benign Het
Tiparp C A 3: 65,436,673 (GRCm39) probably benign Het
Tmem39b T C 4: 129,572,481 (GRCm39) T374A probably benign Het
Trim5 G A 7: 103,925,998 (GRCm39) R188* probably null Het
Ttn C T 2: 76,643,683 (GRCm39) G11436R probably damaging Het
Ubr4 C T 4: 139,204,518 (GRCm39) T4810M probably damaging Het
Vmn2r26 A T 6: 124,038,196 (GRCm39) E590D probably benign Het
Wwc1 A G 11: 35,761,355 (GRCm39) F650S probably benign Het
Xrcc6 T A 15: 81,907,178 (GRCm39) F167I probably damaging Het
Zfp1005 A T 2: 150,111,281 (GRCm39) H657L probably benign Het
Other mutations in Ptprt
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00231:Ptprt APN 2 161,652,544 (GRCm39) missense probably benign 0.00
IGL00565:Ptprt APN 2 161,402,111 (GRCm39) missense probably damaging 1.00
IGL00925:Ptprt APN 2 161,498,083 (GRCm39) missense possibly damaging 0.52
IGL01344:Ptprt APN 2 161,393,737 (GRCm39) missense probably damaging 1.00
IGL01432:Ptprt APN 2 162,109,999 (GRCm39) splice site probably benign
IGL02008:Ptprt APN 2 161,769,593 (GRCm39) missense probably benign 0.02
IGL02040:Ptprt APN 2 162,079,992 (GRCm39) missense probably damaging 1.00
IGL02172:Ptprt APN 2 161,397,422 (GRCm39) missense probably damaging 1.00
IGL02231:Ptprt APN 2 162,119,966 (GRCm39) critical splice donor site probably null
IGL02231:Ptprt APN 2 162,079,980 (GRCm39) missense probably damaging 1.00
IGL02232:Ptprt APN 2 161,372,437 (GRCm39) missense probably damaging 0.96
IGL02277:Ptprt APN 2 161,389,301 (GRCm39) missense probably damaging 1.00
IGL02447:Ptprt APN 2 162,120,027 (GRCm39) missense probably benign 0.01
IGL02601:Ptprt APN 2 161,608,227 (GRCm39) missense probably benign 0.10
IGL02623:Ptprt APN 2 161,449,372 (GRCm39) splice site probably benign
IGL03379:Ptprt APN 2 161,397,379 (GRCm39) nonsense probably null
Poverina UTSW 2 161,743,417 (GRCm39) missense possibly damaging 0.70
IGL03055:Ptprt UTSW 2 161,375,533 (GRCm39) missense probably damaging 0.96
R0064:Ptprt UTSW 2 161,769,711 (GRCm39) splice site probably benign
R0129:Ptprt UTSW 2 162,119,990 (GRCm39) missense probably benign 0.35
R0131:Ptprt UTSW 2 162,120,030 (GRCm39) missense probably benign 0.00
R0131:Ptprt UTSW 2 162,120,030 (GRCm39) missense probably benign 0.00
R0132:Ptprt UTSW 2 162,120,030 (GRCm39) missense probably benign 0.00
R0316:Ptprt UTSW 2 161,449,239 (GRCm39) missense probably damaging 1.00
R0454:Ptprt UTSW 2 161,395,742 (GRCm39) missense probably damaging 0.96
R0488:Ptprt UTSW 2 161,395,745 (GRCm39) missense probably damaging 0.99
R0573:Ptprt UTSW 2 161,393,668 (GRCm39) missense probably damaging 1.00
R0614:Ptprt UTSW 2 161,654,040 (GRCm39) missense possibly damaging 0.59
R0834:Ptprt UTSW 2 161,654,059 (GRCm39) splice site probably null
R1023:Ptprt UTSW 2 161,400,863 (GRCm39) missense probably damaging 1.00
R1184:Ptprt UTSW 2 161,769,692 (GRCm39) missense possibly damaging 0.82
R1253:Ptprt UTSW 2 162,120,146 (GRCm39) missense probably damaging 1.00
R1476:Ptprt UTSW 2 161,769,404 (GRCm39) missense probably damaging 1.00
R1515:Ptprt UTSW 2 162,079,954 (GRCm39) missense probably damaging 1.00
R1595:Ptprt UTSW 2 161,652,469 (GRCm39) critical splice donor site probably null
R1939:Ptprt UTSW 2 161,769,560 (GRCm39) missense probably benign 0.45
R1987:Ptprt UTSW 2 161,608,241 (GRCm39) missense possibly damaging 0.48
R1987:Ptprt UTSW 2 161,400,818 (GRCm39) missense probably damaging 1.00
R2049:Ptprt UTSW 2 161,376,465 (GRCm39) missense probably damaging 1.00
R2421:Ptprt UTSW 2 162,119,960 (GRCm39) splice site probably benign
R3432:Ptprt UTSW 2 161,769,449 (GRCm39) missense probably damaging 1.00
R3619:Ptprt UTSW 2 161,408,077 (GRCm39) missense probably damaging 1.00
R3757:Ptprt UTSW 2 161,653,950 (GRCm39) missense probably damaging 1.00
R3758:Ptprt UTSW 2 161,653,950 (GRCm39) missense probably damaging 1.00
R3834:Ptprt UTSW 2 161,389,307 (GRCm39) missense probably damaging 1.00
R3835:Ptprt UTSW 2 161,389,307 (GRCm39) missense probably damaging 1.00
R3915:Ptprt UTSW 2 161,397,475 (GRCm39) splice site probably benign
R4003:Ptprt UTSW 2 161,408,037 (GRCm39) splice site probably benign
R4387:Ptprt UTSW 2 161,769,570 (GRCm39) missense probably damaging 1.00
R4519:Ptprt UTSW 2 161,406,609 (GRCm39) missense probably damaging 1.00
R4618:Ptprt UTSW 2 161,395,765 (GRCm39) missense probably damaging 1.00
R4677:Ptprt UTSW 2 161,743,366 (GRCm39) critical splice donor site probably null
R4866:Ptprt UTSW 2 161,402,159 (GRCm39) missense probably damaging 1.00
R5088:Ptprt UTSW 2 162,080,095 (GRCm39) missense probably benign 0.01
R5173:Ptprt UTSW 2 161,769,676 (GRCm39) missense probably benign 0.01
R5215:Ptprt UTSW 2 162,120,084 (GRCm39) missense probably damaging 1.00
R5383:Ptprt UTSW 2 161,539,969 (GRCm39) missense probably damaging 1.00
R5398:Ptprt UTSW 2 161,769,512 (GRCm39) missense probably damaging 1.00
R5518:Ptprt UTSW 2 162,120,143 (GRCm39) missense probably damaging 0.99
R5711:Ptprt UTSW 2 161,652,524 (GRCm39) missense probably damaging 0.98
R5735:Ptprt UTSW 2 161,376,484 (GRCm39) missense probably damaging 0.98
R5834:Ptprt UTSW 2 161,402,189 (GRCm39) missense probably damaging 1.00
R5872:Ptprt UTSW 2 161,977,138 (GRCm39) missense probably damaging 1.00
R5926:Ptprt UTSW 2 161,406,606 (GRCm39) missense probably benign 0.00
R6210:Ptprt UTSW 2 162,109,949 (GRCm39) missense probably damaging 1.00
R6285:Ptprt UTSW 2 161,743,417 (GRCm39) missense possibly damaging 0.70
R6298:Ptprt UTSW 2 161,395,779 (GRCm39) missense probably damaging 1.00
R6406:Ptprt UTSW 2 161,395,703 (GRCm39) missense probably damaging 0.98
R6499:Ptprt UTSW 2 161,376,507 (GRCm39) missense probably benign 0.32
R6613:Ptprt UTSW 2 161,372,367 (GRCm39) missense probably damaging 1.00
R6622:Ptprt UTSW 2 161,395,760 (GRCm39) missense probably damaging 1.00
R7218:Ptprt UTSW 2 161,389,284 (GRCm39) missense probably damaging 1.00
R7247:Ptprt UTSW 2 161,375,443 (GRCm39) missense probably benign 0.15
R7576:Ptprt UTSW 2 161,449,225 (GRCm39) missense possibly damaging 0.88
R7733:Ptprt UTSW 2 161,417,707 (GRCm39) missense probably damaging 1.00
R7735:Ptprt UTSW 2 161,417,661 (GRCm39) missense probably damaging 1.00
R7813:Ptprt UTSW 2 161,372,413 (GRCm39) missense probably damaging 1.00
R8031:Ptprt UTSW 2 161,977,377 (GRCm39) missense probably damaging 1.00
R8074:Ptprt UTSW 2 161,769,581 (GRCm39) missense possibly damaging 0.77
R8151:Ptprt UTSW 2 162,120,005 (GRCm39) missense probably damaging 1.00
R8236:Ptprt UTSW 2 161,528,988 (GRCm39) critical splice donor site probably null
R8308:Ptprt UTSW 2 161,769,566 (GRCm39) missense probably benign 0.00
R8348:Ptprt UTSW 2 161,400,806 (GRCm39) missense probably damaging 1.00
R8362:Ptprt UTSW 2 161,393,667 (GRCm39) missense probably damaging 1.00
R8365:Ptprt UTSW 2 161,743,451 (GRCm39) missense probably benign 0.05
R8448:Ptprt UTSW 2 161,400,806 (GRCm39) missense probably damaging 1.00
R8512:Ptprt UTSW 2 161,400,783 (GRCm39) missense probably benign 0.00
R8715:Ptprt UTSW 2 161,372,463 (GRCm39) missense probably damaging 1.00
R9004:Ptprt UTSW 2 161,608,314 (GRCm39) missense probably benign 0.04
R9046:Ptprt UTSW 2 161,372,361 (GRCm39) missense possibly damaging 0.58
R9222:Ptprt UTSW 2 161,402,106 (GRCm39) missense probably damaging 1.00
R9297:Ptprt UTSW 2 161,417,698 (GRCm39) missense probably benign
R9318:Ptprt UTSW 2 161,417,698 (GRCm39) missense probably benign
R9476:Ptprt UTSW 2 161,397,381 (GRCm39) missense probably damaging 1.00
R9510:Ptprt UTSW 2 161,397,381 (GRCm39) missense probably damaging 1.00
R9571:Ptprt UTSW 2 161,395,732 (GRCm39) missense probably benign 0.10
X0064:Ptprt UTSW 2 161,769,403 (GRCm39) missense probably damaging 1.00
Z1088:Ptprt UTSW 2 162,080,041 (GRCm39) missense possibly damaging 0.86
Z1177:Ptprt UTSW 2 162,204,868 (GRCm39) missense possibly damaging 0.77
Z1177:Ptprt UTSW 2 161,574,807 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AATCGTTCCATTGCCATCAGTG -3'
(R):5'- ACATAGTGGCTTAGCTTACCTCTC -3'

Sequencing Primer
(F):5'- CCATTGCCATCAGTGATAGTTG -3'
(R):5'- GCTGCCCCTCTCTAGTGAG -3'
Posted On 2014-10-01