Incidental Mutation 'R2140:Gucy1a1'
ID 236117
Institutional Source Beutler Lab
Gene Symbol Gucy1a1
Ensembl Gene ENSMUSG00000033910
Gene Name guanylate cyclase 1, soluble, alpha 1
Synonyms sGC-alpha1, alpha 1 sGC, 1200016O07Rik
MMRRC Submission 040143-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.148) question?
Stock # R2140 (G1)
Quality Score 225
Status Validated
Chromosome 3
Chromosomal Location 82092427-82145789 bp(-) (GRCm38)
Type of Mutation splice site (5 bp from exon)
DNA Base Change (assembly) C to T at 82118886 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000142138 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048976] [ENSMUST00000193924]
AlphaFold Q9ERL9
Predicted Effect probably null
Transcript: ENSMUST00000048976
SMART Domains Protein: ENSMUSP00000048918
Gene: ENSMUSG00000033910

DomainStartEndE-ValueType
Pfam:HNOB 85 235 2.5e-8 PFAM
PDB:4GJ4|D 277 403 1e-18 PDB
CYCc 445 636 4.71e-103 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191942
Predicted Effect probably null
Transcript: ENSMUST00000193924
SMART Domains Protein: ENSMUSP00000142138
Gene: ENSMUSG00000033910

DomainStartEndE-ValueType
Pfam:HNOB 73 237 1.6e-7 PFAM
PDB:4GJ4|D 277 403 1e-18 PDB
CYCc 445 636 4.71e-103 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194788
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency 100% (96/96)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Soluble guanylate cyclases are heterodimeric proteins that catalyze the conversion of GTP to 3',5'-cyclic GMP and pyrophosphate. The protein encoded by this gene is an alpha subunit of this complex and it interacts with a beta subunit to form the guanylate cyclase enzyme, which is activated by nitric oxide. Several transcript variants encoding a few different isoforms have been found for this gene. [provided by RefSeq, Jan 2012]
PHENOTYPE: Mice homozygous for a null mutation display mild elevation of systolic blood pressure, and abnormal blood vessel and platelet responses to NO. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 96 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610042L04Rik T C 14: 4,348,902 (GRCm38) I21T probably damaging Het
Adgrf1 A C 17: 43,300,802 (GRCm38) E186D probably damaging Het
Adgrf4 C T 17: 42,666,898 (GRCm38) R518Q possibly damaging Het
Afdn A G 17: 13,810,433 (GRCm38) E202G probably damaging Het
Agfg2 T A 5: 137,667,116 (GRCm38) R126W probably damaging Het
Alkbh2 C T 5: 114,125,716 (GRCm38) V77I probably benign Het
Alppl2 A G 1: 87,087,697 (GRCm38) S381P probably benign Het
Aqp2 A G 15: 99,579,366 (GRCm38) T72A probably damaging Het
Atp9b A G 18: 80,736,087 (GRCm38) C1123R probably damaging Het
AU016765 T A 17: 64,520,000 (GRCm38) noncoding transcript Het
Bscl2 T C 19: 8,845,320 (GRCm38) probably null Het
Ccdc80 A T 16: 45,127,446 (GRCm38) Y929F probably damaging Het
Cenpj T C 14: 56,526,932 (GRCm38) D1341G probably damaging Het
Cfap300 T C 9: 8,022,477 (GRCm38) D248G probably damaging Het
Cir1 A T 2: 73,312,437 (GRCm38) S18T probably damaging Het
Clcn6 A G 4: 148,024,137 (GRCm38) F145S possibly damaging Het
Cnksr1 A G 4: 134,229,628 (GRCm38) Y488H probably damaging Het
Cntrl CAGAG CAG 2: 35,122,806 (GRCm38) probably null Het
Crb1 T C 1: 139,237,012 (GRCm38) I1125V probably benign Het
Cyp3a13 A T 5: 137,921,454 (GRCm38) V20D possibly damaging Het
Dars1 T A 1: 128,372,162 (GRCm38) M362L probably benign Het
Dck T C 5: 88,772,723 (GRCm38) C101R probably damaging Het
Dnah11 T C 12: 118,008,810 (GRCm38) T2880A probably benign Het
Dnah7b T A 1: 46,268,670 (GRCm38) M3048K probably damaging Het
Eef1a2 C T 2: 181,148,742 (GRCm38) E374K probably benign Het
Eif3a A T 19: 60,775,394 (GRCm38) probably benign Het
Esco1 A G 18: 10,574,873 (GRCm38) probably null Het
Exoc8 C T 8: 124,897,415 (GRCm38) R71Q possibly damaging Het
Far1 G A 7: 113,566,460 (GRCm38) V445M possibly damaging Het
Fbn1 C A 2: 125,343,810 (GRCm38) C1648F probably damaging Het
Fmn1 A G 2: 113,595,048 (GRCm38) K1189R probably benign Het
Foxl2 C A 9: 98,956,487 (GRCm38) P276H unknown Het
Fpr3 T A 17: 17,970,617 (GRCm38) V50E probably damaging Het
Garem1 T A 18: 21,129,374 (GRCm38) R794S probably damaging Het
Gemin4 G C 11: 76,211,050 (GRCm38) P962A probably damaging Het
Glyatl3 T C 17: 40,911,084 (GRCm38) D93G probably benign Het
Gm4787 A G 12: 81,378,562 (GRCm38) I274T probably benign Het
Hook1 GATGAATGA GATGA 4: 96,013,312 (GRCm38) 503 probably null Het
Ift20 G A 11: 78,540,034 (GRCm38) E68K probably damaging Het
Ints13 A G 6: 146,576,431 (GRCm38) S7P probably damaging Het
Kat5 T A 19: 5,605,685 (GRCm38) probably null Het
Kcnma1 A C 14: 23,314,220 (GRCm38) L988R probably damaging Het
Kcnq3 C A 15: 66,005,978 (GRCm38) probably benign Het
Kctd16 A G 18: 40,259,178 (GRCm38) E273G possibly damaging Het
Krt82 T A 15: 101,545,156 (GRCm38) Q265L probably damaging Het
Lama2 A T 10: 27,054,694 (GRCm38) probably null Het
Laptm4b G T 15: 34,238,332 (GRCm38) M3I probably benign Het
Lmtk2 A G 5: 144,147,615 (GRCm38) Y156C probably damaging Het
Lrrc58 G A 16: 37,881,409 (GRCm38) E350K probably damaging Het
Lrrk1 A T 7: 66,330,750 (GRCm38) D227E probably damaging Het
Macf1 C T 4: 123,355,102 (GRCm38) C7210Y probably damaging Het
Madd A G 2: 91,152,509 (GRCm38) I1363T possibly damaging Het
Mcm3 A G 1: 20,813,110 (GRCm38) V295A probably benign Het
Mki67 A G 7: 135,695,592 (GRCm38) I2571T possibly damaging Het
Mtrr C T 13: 68,568,940 (GRCm38) A385T possibly damaging Het
Myh7b A G 2: 155,620,123 (GRCm38) Y313C probably damaging Het
Myot A T 18: 44,354,125 (GRCm38) H343L possibly damaging Het
Myt1 C A 2: 181,825,979 (GRCm38) Q1069K probably damaging Het
Nid1 T A 13: 13,499,668 (GRCm38) D877E probably damaging Het
Nle1 A G 11: 82,905,568 (GRCm38) V159A probably damaging Het
Nmbr C A 10: 14,770,442 (GRCm38) Y353* probably null Het
Nos1ap T A 1: 170,329,166 (GRCm38) D241V probably damaging Het
Nostrin A C 2: 69,166,003 (GRCm38) Y209S probably damaging Het
Or14j4 T G 17: 37,610,471 (GRCm38) E93D probably benign Het
Or1e19 A T 11: 73,425,881 (GRCm38) M34K probably damaging Het
Or4a68 C T 2: 89,439,583 (GRCm38) R232H probably benign Het
Or5d40 A T 2: 88,185,095 (GRCm38) S73C probably benign Het
Or8h9 A T 2: 86,959,281 (GRCm38) M59K probably damaging Het
Or8s2 G A 15: 98,378,396 (GRCm38) T238I possibly damaging Het
Pcdh7 T A 5: 58,128,996 (GRCm38) V1138E probably damaging Het
Pglyrp3 T G 3: 92,026,567 (GRCm38) V173G probably benign Het
Plec T C 15: 76,183,174 (GRCm38) T1331A probably benign Het
Plxnb2 T C 15: 89,156,562 (GRCm38) D1787G probably benign Het
Pms1 T A 1: 53,281,988 (GRCm38) I29F probably damaging Het
Ptprt G A 2: 161,811,988 (GRCm38) T574I probably damaging Het
R3hdm1 A G 1: 128,190,693 (GRCm38) Y561C probably damaging Het
Rab17 A G 1: 90,960,078 (GRCm38) F120S probably benign Het
Rab7b T A 1: 131,698,419 (GRCm38) W62R probably damaging Het
Ryr2 C T 13: 11,560,607 (GRCm38) G4835E probably damaging Het
Ryr3 A G 2: 112,875,148 (GRCm38) V807A probably benign Het
Septin4 A T 11: 87,583,436 (GRCm38) Q60L probably benign Het
Slc23a1 C T 18: 35,626,434 (GRCm38) R26Q unknown Het
Slc7a4 C A 16: 17,574,544 (GRCm38) R342L possibly damaging Het
Slfn9 C T 11: 82,984,655 (GRCm38) C367Y possibly damaging Het
Slitrk6 T G 14: 110,750,794 (GRCm38) T494P probably benign Het
Tasor C T 14: 27,480,035 (GRCm38) T1462I probably damaging Het
Tiam1 A G 16: 89,849,645 (GRCm38) probably benign Het
Tiparp C A 3: 65,529,252 (GRCm38) probably benign Het
Tmem39b T C 4: 129,678,688 (GRCm38) T374A probably benign Het
Trim5 G A 7: 104,276,791 (GRCm38) R188* probably null Het
Ttn C T 2: 76,813,339 (GRCm38) G11436R probably damaging Het
Ubr4 C T 4: 139,477,207 (GRCm38) T4810M probably damaging Het
Vmn2r26 A T 6: 124,061,237 (GRCm38) E590D probably benign Het
Wwc1 A G 11: 35,870,528 (GRCm38) F650S probably benign Het
Xrcc6 T A 15: 82,022,977 (GRCm38) F167I probably damaging Het
Zfp1005 A T 2: 150,269,361 (GRCm38) H657L probably benign Het
Other mutations in Gucy1a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00951:Gucy1a1 APN 3 82,111,191 (GRCm38) missense probably benign 0.00
IGL01626:Gucy1a1 APN 3 82,108,619 (GRCm38) missense probably damaging 1.00
IGL01662:Gucy1a1 APN 3 82,109,253 (GRCm38) missense possibly damaging 0.63
IGL02480:Gucy1a1 APN 3 82,097,733 (GRCm38) missense probably damaging 1.00
IGL02902:Gucy1a1 APN 3 82,118,917 (GRCm38) missense possibly damaging 0.87
IGL03022:Gucy1a1 APN 3 82,109,097 (GRCm38) missense probably benign 0.30
IGL03056:Gucy1a1 APN 3 82,113,287 (GRCm38) missense probably benign 0.00
IGL03089:Gucy1a1 APN 3 82,097,681 (GRCm38) missense probably damaging 1.00
IGL03226:Gucy1a1 APN 3 82,119,024 (GRCm38) missense probably benign 0.00
IGL03377:Gucy1a1 APN 3 82,106,015 (GRCm38) missense probably damaging 1.00
R0245:Gucy1a1 UTSW 3 82,108,787 (GRCm38) missense possibly damaging 0.67
R0762:Gucy1a1 UTSW 3 82,094,896 (GRCm38) missense unknown
R0907:Gucy1a1 UTSW 3 82,111,191 (GRCm38) missense probably benign 0.00
R1242:Gucy1a1 UTSW 3 82,105,953 (GRCm38) splice site probably null
R1625:Gucy1a1 UTSW 3 82,102,055 (GRCm38) missense probably benign 0.02
R1671:Gucy1a1 UTSW 3 82,106,222 (GRCm38) missense probably damaging 1.00
R2056:Gucy1a1 UTSW 3 82,109,285 (GRCm38) missense possibly damaging 0.89
R2094:Gucy1a1 UTSW 3 82,113,332 (GRCm38) missense probably benign
R2154:Gucy1a1 UTSW 3 82,111,151 (GRCm38) critical splice donor site probably null
R3418:Gucy1a1 UTSW 3 82,106,133 (GRCm38) missense probably damaging 1.00
R3419:Gucy1a1 UTSW 3 82,106,133 (GRCm38) missense probably damaging 1.00
R4290:Gucy1a1 UTSW 3 82,094,759 (GRCm38) missense possibly damaging 0.95
R4291:Gucy1a1 UTSW 3 82,094,759 (GRCm38) missense possibly damaging 0.95
R4292:Gucy1a1 UTSW 3 82,094,759 (GRCm38) missense possibly damaging 0.95
R4294:Gucy1a1 UTSW 3 82,094,759 (GRCm38) missense possibly damaging 0.95
R4573:Gucy1a1 UTSW 3 82,108,922 (GRCm38) missense possibly damaging 0.95
R4629:Gucy1a1 UTSW 3 82,097,624 (GRCm38) missense probably damaging 1.00
R4755:Gucy1a1 UTSW 3 82,094,795 (GRCm38) missense probably benign 0.40
R4865:Gucy1a1 UTSW 3 82,119,162 (GRCm38) utr 5 prime probably benign
R5528:Gucy1a1 UTSW 3 82,109,073 (GRCm38) missense probably damaging 1.00
R5933:Gucy1a1 UTSW 3 82,094,807 (GRCm38) missense probably damaging 0.96
R6278:Gucy1a1 UTSW 3 82,097,634 (GRCm38) missense probably damaging 1.00
R6385:Gucy1a1 UTSW 3 82,109,006 (GRCm38) missense probably benign
R7011:Gucy1a1 UTSW 3 82,109,115 (GRCm38) missense probably damaging 1.00
R7361:Gucy1a1 UTSW 3 82,097,720 (GRCm38) missense probably damaging 1.00
R7648:Gucy1a1 UTSW 3 82,108,707 (GRCm38) missense possibly damaging 0.63
R7709:Gucy1a1 UTSW 3 82,094,789 (GRCm38) missense unknown
R7770:Gucy1a1 UTSW 3 82,108,805 (GRCm38) missense possibly damaging 0.95
R8443:Gucy1a1 UTSW 3 82,097,693 (GRCm38) missense probably damaging 1.00
R8531:Gucy1a1 UTSW 3 82,111,161 (GRCm38) missense probably benign
R8872:Gucy1a1 UTSW 3 82,108,742 (GRCm38) missense probably damaging 0.99
R9055:Gucy1a1 UTSW 3 82,109,126 (GRCm38) missense possibly damaging 0.73
R9168:Gucy1a1 UTSW 3 82,102,046 (GRCm38) missense probably damaging 0.97
R9231:Gucy1a1 UTSW 3 82,106,001 (GRCm38) missense probably damaging 1.00
R9316:Gucy1a1 UTSW 3 82,108,943 (GRCm38) missense possibly damaging 0.50
Predicted Primers PCR Primer
(F):5'- CAGAGTCTAATGATCTTTTGGAAGG -3'
(R):5'- TCCTAAGGAGCCAACAGAGG -3'

Sequencing Primer
(F):5'- GTGAAACTTTTGAAGATTGCACAC -3'
(R):5'- CCAACAGAGGAGGTGGCTG -3'
Posted On 2014-10-01