Mutagenetix > Incidental Mutation

Incidental Mutation 'R2140:Hook1'

236119

Institutional Source

Beutler Lab

Gene Symbol

Hook1

Ensembl Gene

ENSMUSG00000028572

Gene Name

hook microtubule tethering protein 1

Synonyms

azh, A930033L17Rik, abnormal spermatozoon head shape

MMRRC Submission

040143-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R2140 (G1)

Quality Score

217

Status

Validated

Chromosome

Chromosomal Location

95967240-96025413 bp(+) (GRCm38)

Type of Mutation

frame shift

DNA Base Change (assembly)

GATGAATGA to GATGA at 96013312 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

at position 503 (503)

Ref Sequence

ENSEMBL: ENSMUSP00000030306 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000030306]

AlphaFold

Q8BIL5

PDB Structure

The solution structure of RSGI RUH-026, conserved domain of HOOK1 protein from mouse [SOLUTION NMR]

Predicted Effect

probably null
Transcript: ENSMUST00000030306
AA Change: 503

SMART Domains

Protein: ENSMUSP00000030306
Gene: ENSMUSG00000028572
AA Change: 503

Domain	Start	End	E-Value	Type
Pfam:HOOK	14	720	N/A	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000124202

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000125584

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000125627

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000141448

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000143326

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000146947

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000148291

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.1%
20x: 94.5%

Validation Efficiency

100% (96/96)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the hook family of coiled-coil proteins, which bind to microtubules and organelles through their N- and C-terminal domains, respectively. The encoded protein localizes to discrete punctuate subcellular structures, and interacts with several members of the Rab GTPase family involved in endocytosis. It is thought to link endocytic membrane trafficking to the microtubule cytoskeleton. Several alternatively spliced transcript variants have been identified, but the full-length nature of some of these variants has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mice have abnormal ladle shaped sperm with up to 40% lacking a flagella. Nonetheless, most males breed, although litter size is reduced. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 96 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2610042L04Rik	T	C	14: 4,348,902	I21T	probably damaging	Het
9230110C19Rik	T	C	9: 8,022,477	D248G	probably damaging	Het
Adgrf1	A	C	17: 43,300,802	E186D	probably damaging	Het
Adgrf4	C	T	17: 42,666,898	R518Q	possibly damaging	Het
Afdn	A	G	17: 13,810,433	E202G	probably damaging	Het
Agfg2	T	A	5: 137,667,116	R126W	probably damaging	Het
Alkbh2	C	T	5: 114,125,716	V77I	probably benign	Het
Alppl2	A	G	1: 87,087,697	S381P	probably benign	Het
Aqp2	A	G	15: 99,579,366	T72A	probably damaging	Het
Atp9b	A	G	18: 80,736,087	C1123R	probably damaging	Het
AU016765	T	A	17: 64,520,000		noncoding transcript	Het
Bscl2	T	C	19: 8,845,320		probably null	Het
Ccdc80	A	T	16: 45,127,446	Y929F	probably damaging	Het
Cenpj	T	C	14: 56,526,932	D1341G	probably damaging	Het
Cir1	A	T	2: 73,312,437	S18T	probably damaging	Het
Clcn6	A	G	4: 148,024,137	F145S	possibly damaging	Het
Cnksr1	A	G	4: 134,229,628	Y488H	probably damaging	Het
Cntrl	CAGAG	CAG	2: 35,122,806		probably null	Het
Crb1	T	C	1: 139,237,012	I1125V	probably benign	Het
Cyp3a13	A	T	5: 137,921,454	V20D	possibly damaging	Het
Dars	T	A	1: 128,372,162	M362L	probably benign	Het
Dck	T	C	5: 88,772,723	C101R	probably damaging	Het
Dnah11	T	C	12: 118,008,810	T2880A	probably benign	Het
Dnah7b	T	A	1: 46,268,670	M3048K	probably damaging	Het
Eef1a2	C	T	2: 181,148,742	E374K	probably benign	Het
Eif3a	A	T	19: 60,775,394		probably benign	Het
Esco1	A	G	18: 10,574,873		probably null	Het
Exoc8	C	T	8: 124,897,415	R71Q	possibly damaging	Het
Fam208a	C	T	14: 27,480,035	T1462I	probably damaging	Het
Far1	G	A	7: 113,566,460	V445M	possibly damaging	Het
Fbn1	C	A	2: 125,343,810	C1648F	probably damaging	Het
Fmn1	A	G	2: 113,595,048	K1189R	probably benign	Het
Foxl2	C	A	9: 98,956,487	P276H	unknown	Het
Fpr3	T	A	17: 17,970,617	V50E	probably damaging	Het
Garem1	T	A	18: 21,129,374	R794S	probably damaging	Het
Gemin4	G	C	11: 76,211,050	P962A	probably damaging	Het
Glyatl3	T	C	17: 40,911,084	D93G	probably benign	Het
Gm14124	A	T	2: 150,269,361	H657L	probably benign	Het
Gm4787	A	G	12: 81,378,562	I274T	probably benign	Het
Gucy1a1	C	T	3: 82,118,886		probably null	Het
Ift20	G	A	11: 78,540,034	E68K	probably damaging	Het
Ints13	A	G	6: 146,576,431	S7P	probably damaging	Het
Kat5	T	A	19: 5,605,685		probably null	Het
Kcnma1	A	C	14: 23,314,220	L988R	probably damaging	Het
Kcnq3	C	A	15: 66,005,978		probably benign	Het
Kctd16	A	G	18: 40,259,178	E273G	possibly damaging	Het
Krt82	T	A	15: 101,545,156	Q265L	probably damaging	Het
Lama2	A	T	10: 27,054,694		probably null	Het
Laptm4b	G	T	15: 34,238,332	M3I	probably benign	Het
Lmtk2	A	G	5: 144,147,615	Y156C	probably damaging	Het
Lrrc58	G	A	16: 37,881,409	E350K	probably damaging	Het
Lrrk1	A	T	7: 66,330,750	D227E	probably damaging	Het
Macf1	C	T	4: 123,355,102	C7210Y	probably damaging	Het
Madd	A	G	2: 91,152,509	I1363T	possibly damaging	Het
Mcm3	A	G	1: 20,813,110	V295A	probably benign	Het
Mki67	A	G	7: 135,695,592	I2571T	possibly damaging	Het
Mtrr	C	T	13: 68,568,940	A385T	possibly damaging	Het
Myh7b	A	G	2: 155,620,123	Y313C	probably damaging	Het
Myot	A	T	18: 44,354,125	H343L	possibly damaging	Het
Myt1	C	A	2: 181,825,979	Q1069K	probably damaging	Het
Nid1	T	A	13: 13,499,668	D877E	probably damaging	Het
Nle1	A	G	11: 82,905,568	V159A	probably damaging	Het
Nmbr	C	A	10: 14,770,442	Y353*	probably null	Het
Nos1ap	T	A	1: 170,329,166	D241V	probably damaging	Het
Nostrin	A	C	2: 69,166,003	Y209S	probably damaging	Het
Olfr1099	A	T	2: 86,959,281	M59K	probably damaging	Het
Olfr115	T	G	17: 37,610,471	E93D	probably benign	Het
Olfr1168	A	T	2: 88,185,095	S73C	probably benign	Het
Olfr1240	C	T	2: 89,439,583	R232H	probably benign	Het
Olfr283	G	A	15: 98,378,396	T238I	possibly damaging	Het
Olfr378	A	T	11: 73,425,881	M34K	probably damaging	Het
Pcdh7	T	A	5: 58,128,996	V1138E	probably damaging	Het
Pglyrp3	T	G	3: 92,026,567	V173G	probably benign	Het
Plec	T	C	15: 76,183,174	T1331A	probably benign	Het
Plxnb2	T	C	15: 89,156,562	D1787G	probably benign	Het
Pms1	T	A	1: 53,281,988	I29F	probably damaging	Het
Ptprt	G	A	2: 161,811,988	T574I	probably damaging	Het
R3hdm1	A	G	1: 128,190,693	Y561C	probably damaging	Het
Rab17	A	G	1: 90,960,078	F120S	probably benign	Het
Rab7b	T	A	1: 131,698,419	W62R	probably damaging	Het
Ryr2	C	T	13: 11,560,607	G4835E	probably damaging	Het
Ryr3	A	G	2: 112,875,148	V807A	probably benign	Het
Sept4	A	T	11: 87,583,436	Q60L	probably benign	Het
Slc23a1	C	T	18: 35,626,434	R26Q	unknown	Het
Slc7a4	C	A	16: 17,574,544	R342L	possibly damaging	Het
Slfn9	C	T	11: 82,984,655	C367Y	possibly damaging	Het
Slitrk6	T	G	14: 110,750,794	T494P	probably benign	Het
Tiam1	A	G	16: 89,849,645		probably benign	Het
Tiparp	C	A	3: 65,529,252		probably benign	Het
Tmem39b	T	C	4: 129,678,688	T374A	probably benign	Het
Trim5	G	A	7: 104,276,791	R188*	probably null	Het
Ttn	C	T	2: 76,813,339	G11436R	probably damaging	Het
Ubr4	C	T	4: 139,477,207	T4810M	probably damaging	Het
Vmn2r26	A	T	6: 124,061,237	E590D	probably benign	Het
Wwc1	A	G	11: 35,870,528	F650S	probably benign	Het
Xrcc6	T	A	15: 82,022,977	F167I	probably damaging	Het

Other mutations in Hook1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02019:Hook1	APN	4	96022197	missense	probably benign	0.25
IGL02229:Hook1	APN	4	96001251	missense	possibly damaging	0.93
IGL03338:Hook1	APN	4	95998692	splice site	probably benign
grin	UTSW	4	96013312	frame shift	probably null
toothy	UTSW	4	96014805	splice site	probably null
PIT4453001:Hook1	UTSW	4	96014852	missense	probably damaging	0.99
R0558:Hook1	UTSW	4	95993212	splice site	probably benign
R0593:Hook1	UTSW	4	95998786	missense	possibly damaging	0.93
R0699:Hook1	UTSW	4	95995840	splice site	probably benign
R1004:Hook1	UTSW	4	96022287	missense	probably benign	0.00
R1465:Hook1	UTSW	4	96013256	missense	probably benign	0.00
R1465:Hook1	UTSW	4	96013256	missense	probably benign	0.00
R2278:Hook1	UTSW	4	95998720	missense	probably benign	0.00
R3784:Hook1	UTSW	4	95989651	missense	probably damaging	1.00
R4500:Hook1	UTSW	4	95993200	critical splice donor site	probably null
R4798:Hook1	UTSW	4	96002557	missense	possibly damaging	0.84
R5200:Hook1	UTSW	4	95993130	missense	probably damaging	1.00
R5546:Hook1	UTSW	4	96002528	missense	probably benign	0.03
R6532:Hook1	UTSW	4	96019756	splice site	probably null
R6629:Hook1	UTSW	4	96001270	missense	probably benign	0.03
R7010:Hook1	UTSW	4	96014811	missense	probably damaging	0.99
R7534:Hook1	UTSW	4	96017597	missense	probably benign	0.27
R8236:Hook1	UTSW	4	96014805	splice site	probably null
R8826:Hook1	UTSW	4	95992195	missense	probably benign	0.00
R8985:Hook1	UTSW	4	96022231	missense	probably benign	0.00
R9288:Hook1	UTSW	4	96013268	missense	probably damaging	1.00
R9445:Hook1	UTSW	4	96013262	missense	probably benign	0.12
R9445:Hook1	UTSW	4	96014812	missense	probably benign	0.00
R9463:Hook1	UTSW	4	96022273	missense	probably damaging	1.00
R9481:Hook1	UTSW	4	96013268	missense	probably damaging	1.00
R9548:Hook1	UTSW	4	96003571	missense	probably damaging	0.99
R9628:Hook1	UTSW	4	96013323	missense	probably damaging	1.00
R9718:Hook1	UTSW	4	96016441	missense	probably benign	0.01
X0027:Hook1	UTSW	4	95995811	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- GTGCACAAACGTATACATGGAC -3'
(R):5'- GCTGTCAGACCATTACTCACTTG -3'

Sequencing Primer
(F):5'- GCACAAACGTATACATGGACTTATAC -3'
(R):5'- GTCAGACCATTACTCACTTGATTTC -3'

Posted On

2014-10-01