Mutagenetix > Incidental Mutation

Incidental Mutation 'R0201:Gria2'

23612

Institutional Source

Beutler Lab

Gene Symbol

Gria2

Ensembl Gene

ENSMUSG00000033981

Gene Name

glutamate receptor, ionotropic, AMPA2 (alpha 2)

Synonyms

Glur2, Glur-2, GluR-B, GluA2, GluR2

MMRRC Submission

038458-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.222) question?

Stock #

R0201 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

80681450-80802835 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 80707838 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Cysteine at position 445 (Y445C)

Ref Sequence

ENSEMBL: ENSMUSP00000141447 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000075316] [ENSMUST00000107745] [ENSMUST00000192463]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000075316
AA Change: Y445C

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000074787
Gene: ENSMUSG00000033981
AA Change: Y445C

Domain	Start	End	E-Value	Type
Pfam:ANF_receptor	49	379	2.7e-58	PFAM
PBPe	415	790	3.75e-132	SMART
Lig_chan-Glu_bd	425	490	2.96e-31	SMART
low complexity region	820	832	N/A	INTRINSIC
low complexity region	853	865	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000107745
AA Change: Y445C

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000103374
Gene: ENSMUSG00000033981
AA Change: Y445C

Domain	Start	End	E-Value	Type
Pfam:ANF_receptor	47	379	4.8e-53	PFAM
PBPe	415	790	8.16e-133	SMART
Lig_chan-Glu_bd	425	490	2.96e-31	SMART
low complexity region	820	832	N/A	INTRINSIC
low complexity region	853	865	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000192463
AA Change: Y445C

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000141447
Gene: ENSMUSG00000033981
AA Change: Y445C

Domain	Start	End	E-Value	Type
signal peptide	1	24	N/A	INTRINSIC
Pfam:ANF_receptor	47	379	1.7e-51	PFAM
PBPe	415	770	1.2e-105	SMART
Lig_chan-Glu_bd	425	490	2.2e-35	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000193645

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000194383

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000194523

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000195062

Meta Mutation Damage Score

0.8620

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.7%
20x: 94.2%

Validation Efficiency

97% (91/94)

MGI Phenotype

FUNCTION: Glutamate receptors are the predominant excitatory neurotransmitter receptors in the mammalian brain and are activated in a variety of normal neurophysiologic processes. This gene product belongs to a family of glutamate receptors that are sensitive to alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate (AMPA), and function as ligand-activated cation channels. These channels are assembled from 4 related subunits, Gria1-4. The subunit encoded by this gene (Gria2) is subject to RNA editing (CAG->CGG; Q->R) within the second transmembrane domain, which is thought to render the channel impermeable to Ca(2+). Alternative splicing, resulting in transcript variants encoding different isoforms, (including the flip and flop isoforms that vary in their signal transduction properties), has been noted for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit epilepsy, deficient dendritic architecture, altered exploratory behavior, impaired motor and learning performance, and increased mortality. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 87 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adamdec1	A	G	14: 68,581,957		probably null	Het
Adamts16	T	A	13: 70,779,644	Q492L	possibly damaging	Het
Aplnr	A	G	2: 85,137,177	D182G	probably damaging	Het
Arnt2	G	T	7: 84,361,659	S3*	probably null	Het
Asxl3	T	C	18: 22,523,154	V1407A	probably benign	Het
Atg13	A	T	2: 91,684,762		probably null	Het
Atm	A	T	9: 53,454,279		probably benign	Het
Birc6	T	G	17: 74,609,327	V1746G	possibly damaging	Het
Cbln1	G	T	8: 87,472,113	T43K	probably benign	Het
Cbx5	T	C	15: 103,199,700	T173A	probably damaging	Het
Cc2d2a	A	G	5: 43,737,512	Y1437C	probably damaging	Het
Ccdc78	C	A	17: 25,789,236		probably benign	Het
Cd2bp2	A	G	7: 127,193,828	Y341H	probably damaging	Het
Cdhr5	T	A	7: 141,276,378	D88V	probably damaging	Het
Ces1f	T	A	8: 93,267,329	T275S	probably null	Het
Clca4a	T	C	3: 144,960,717	N458S	probably benign	Het
Cog5	A	G	12: 31,839,841	K521R	probably damaging	Het
Csf2ra	T	A	19: 61,225,568	T305S	probably benign	Het
Csmd3	T	A	15: 47,619,729		probably benign	Het
Cts6	T	A	13: 61,201,499	R132*	probably null	Het
D5Ertd579e	G	T	5: 36,616,465	N195K	probably damaging	Het
Ddx1	A	G	12: 13,223,808	V606A	probably damaging	Het
Dip2b	G	A	15: 100,186,147	D884N	probably damaging	Het
Ehhadh	A	G	16: 21,773,493		probably null	Het
Enpp1	T	A	10: 24,653,917	T608S	probably benign	Het
Fancm	T	C	12: 65,101,632	Y674H	probably damaging	Het
Fat4	T	A	3: 38,891,596	V1546D	probably damaging	Het
Fsd1	G	A	17: 55,990,522	A158T	probably benign	Het
Fzd2	T	A	11: 102,606,122	M464K	probably damaging	Het
Gjc2	A	G	11: 59,177,590	F22S	possibly damaging	Het
Gm13101	T	C	4: 143,964,890	E421G	probably damaging	Het
Hsdl1	T	A	8: 119,566,256	I147F	possibly damaging	Het
Ifi44	T	C	3: 151,745,636	Y226C	probably damaging	Het
Il16	A	G	7: 83,722,308	C97R	probably damaging	Het
Impg1	A	T	9: 80,345,561	S369T	probably damaging	Het
Jmjd1c	A	G	10: 67,219,109	T390A	unknown	Het
Lgi1	A	G	19: 38,301,293	E269G	possibly damaging	Het
Lrp6	G	T	6: 134,450,897	Y1577*	probably null	Het
Lrrc74a	G	T	12: 86,761,773		probably benign	Het
Man1c1	A	T	4: 134,640,398		probably null	Het
Map1lc3b	A	C	8: 121,590,550	Q9P	possibly damaging	Het
Mboat1	G	A	13: 30,202,375	R124H	probably benign	Het
Mcu	A	G	10: 59,456,677	L60P	probably damaging	Het
Mrs2	G	T	13: 25,018,534	Q75K	probably benign	Het
Muc2	CGTG	CGTGTG	7: 141,699,185		probably null	Het
Neb	G	A	2: 52,206,878		probably benign	Het
Nlrp2	C	T	7: 5,328,329	G356D	probably benign	Het
Notch3	A	G	17: 32,156,148		probably benign	Het
Npr2	A	C	4: 43,641,617	S474R	probably damaging	Het
Nupl1	A	G	14: 60,244,616	F100L	probably benign	Het
Osbpl6	A	C	2: 76,546,042	D87A	possibly damaging	Het
Pabpc2	A	T	18: 39,775,307	M542L	probably benign	Het
Papln	A	G	12: 83,783,027		probably benign	Het
Parpbp	T	C	10: 88,092,896	I561V	possibly damaging	Het
Pcdhb13	C	T	18: 37,442,581	A4V	probably benign	Het
Pelp1	T	C	11: 70,395,704	T533A	possibly damaging	Het
Poldip3	T	A	15: 83,135,296	M182L	probably benign	Het
Por	T	C	5: 135,731,178	S240P	possibly damaging	Het
Pramef20	A	T	4: 144,377,273		probably benign	Het
Prss22	A	T	17: 23,996,301	V167D	probably damaging	Het
Prss37	A	C	6: 40,516,349	L61R	probably damaging	Het
Psmd1	C	T	1: 86,118,616	T702M	probably benign	Het
Pxdn	G	T	12: 30,002,431	G869V	possibly damaging	Het
Rabgap1l	A	G	1: 160,453,745		probably benign	Het
Rapgef6	T	C	11: 54,619,941	V228A	probably damaging	Het
Rnf169	T	C	7: 99,926,003	R462G	possibly damaging	Het
Rnft2	A	G	5: 118,194,680		probably benign	Het
Sgo2b	T	C	8: 63,926,636	D1054G	probably benign	Het
Sh3bgr	T	C	16: 96,228,517		probably benign	Het
Slc12a4	A	G	8: 105,945,350	V910A	possibly damaging	Het
Slc6a12	A	T	6: 121,355,372	I222F	probably benign	Het
Spty2d1	G	A	7: 46,997,901	R427*	probably null	Het
Ssc5d	A	G	7: 4,944,663	T1339A	probably benign	Het
Sspo	A	C	6: 48,455,752	E854A	possibly damaging	Het
Stx7	A	G	10: 24,185,079		probably benign	Het
Styk1	A	T	6: 131,301,730		probably benign	Het
Tex33	T	A	15: 78,378,828	M209L	probably damaging	Het
Tmem163	T	G	1: 127,668,637		probably benign	Het
Tmppe	C	CT	9: 114,404,639		probably null	Het
Tmx2	A	G	2: 84,673,082	V229A	probably benign	Het
Top2b	T	C	14: 16,383,174	L54P	probably damaging	Het
Trim62	A	T	4: 128,902,550	Y280F	probably benign	Het
Tssk4	A	T	14: 55,651,559	K181*	probably null	Het
Tssk4	A	T	14: 55,651,560	K181M	probably damaging	Het
Ubn1	A	G	16: 5,064,614	D313G	probably damaging	Het
Ugt1a10	C	T	1: 88,215,123	P113L	probably damaging	Het
Ugt1a10	C	T	1: 88,218,249	P473L	probably damaging	Het

Other mutations in Gria2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00796:Gria2	APN	3	80710790	missense	probably benign	0.12
IGL00832:Gria2	APN	3	80707251	missense	probably damaging	1.00
IGL01086:Gria2	APN	3	80692381	missense	probably damaging	1.00
IGL01409:Gria2	APN	3	80707697	critical splice donor site	probably null
IGL01924:Gria2	APN	3	80710331	missense	probably benign	0.13
IGL01999:Gria2	APN	3	80732091	missense	probably damaging	1.00
IGL02355:Gria2	APN	3	80706937	missense	probably damaging	1.00
IGL02362:Gria2	APN	3	80706937	missense	probably damaging	1.00
IGL02389:Gria2	APN	3	80709422	missense	probably benign	0.14
IGL02444:Gria2	APN	3	80702553	missense	possibly damaging	0.65
IGL02532:Gria2	APN	3	80706999	missense	probably damaging	1.00
IGL02991:Gria2	UTSW	3	80707809	nonsense	probably null
R0015:Gria2	UTSW	3	80707767	missense	probably damaging	1.00
R0148:Gria2	UTSW	3	80707731	missense	probably damaging	1.00
R0411:Gria2	UTSW	3	80710858	splice site	probably benign
R0551:Gria2	UTSW	3	80732026	splice site	probably benign
R0655:Gria2	UTSW	3	80732070	nonsense	probably null
R0866:Gria2	UTSW	3	80722024	splice site	probably benign
R1393:Gria2	UTSW	3	80707098	missense	probably damaging	1.00
R1458:Gria2	UTSW	3	80732045	missense	possibly damaging	0.71
R1563:Gria2	UTSW	3	80691397	missense	probably damaging	0.96
R1771:Gria2	UTSW	3	80692301	nonsense	probably null
R1775:Gria2	UTSW	3	80691338	missense	probably benign	0.09
R1902:Gria2	UTSW	3	80722108	missense	probably damaging	0.98
R1993:Gria2	UTSW	3	80802357	missense	probably benign
R1994:Gria2	UTSW	3	80802357	missense	probably benign
R1995:Gria2	UTSW	3	80802357	missense	probably benign
R2001:Gria2	UTSW	3	80710805	missense	probably benign	0.28
R2389:Gria2	UTSW	3	80702625	missense	probably damaging	1.00
R2520:Gria2	UTSW	3	80706962	missense	probably damaging	1.00
R2679:Gria2	UTSW	3	80740953	splice site	probably benign
R2865:Gria2	UTSW	3	80732085	missense	probably benign	0.00
R2869:Gria2	UTSW	3	80702492	missense	probably damaging	1.00
R2869:Gria2	UTSW	3	80702492	missense	probably damaging	1.00
R2870:Gria2	UTSW	3	80702492	missense	probably damaging	1.00
R2870:Gria2	UTSW	3	80702492	missense	probably damaging	1.00
R2871:Gria2	UTSW	3	80702492	missense	probably damaging	1.00
R2871:Gria2	UTSW	3	80702492	missense	probably damaging	1.00
R2872:Gria2	UTSW	3	80702492	missense	probably damaging	1.00
R2872:Gria2	UTSW	3	80702492	missense	probably damaging	1.00
R3716:Gria2	UTSW	3	80741004	missense	possibly damaging	0.77
R3967:Gria2	UTSW	3	80710777	missense	possibly damaging	0.95
R4285:Gria2	UTSW	3	80707662	intron	probably benign
R4611:Gria2	UTSW	3	80692492	missense	probably damaging	0.99
R4612:Gria2	UTSW	3	80732051	missense	probably damaging	1.00
R4616:Gria2	UTSW	3	80706897	missense	probably damaging	1.00
R4706:Gria2	UTSW	3	80740990	missense	probably benign
R4996:Gria2	UTSW	3	80707141	missense	probably damaging	0.99
R5502:Gria2	UTSW	3	80706945	missense	probably damaging	1.00
R5930:Gria2	UTSW	3	80707249	missense	possibly damaging	0.91
R6142:Gria2	UTSW	3	80801717	missense	probably benign	0.13
R6233:Gria2	UTSW	3	80707203	missense	probably damaging	0.99
R6317:Gria2	UTSW	3	80741004	missense	possibly damaging	0.79
R6453:Gria2	UTSW	3	80740974	missense	possibly damaging	0.93
R6526:Gria2	UTSW	3	80692469	missense	probably damaging	1.00
R6545:Gria2	UTSW	3	80741144	missense	probably damaging	0.99
R6574:Gria2	UTSW	3	80689296	missense	probably damaging	0.99
R6720:Gria2	UTSW	3	80802304	missense	probably benign	0.37
R7009:Gria2	UTSW	3	80706972	missense	probably damaging	1.00
R7049:Gria2	UTSW	3	80689327	missense	probably damaging	0.99
R7191:Gria2	UTSW	3	80732085	missense	probably benign	0.24
R7225:Gria2	UTSW	3	80802631	unclassified	probably benign
R7374:Gria2	UTSW	3	80741076	missense	probably benign
R7837:Gria2	UTSW	3	80710788	missense	probably benign	0.18
R8034:Gria2	UTSW	3	80801699	missense	probably damaging	1.00
R8125:Gria2	UTSW	3	80707243	missense	possibly damaging	0.88
R8189:Gria2	UTSW	3	80722182	missense	probably damaging	1.00
R8209:Gria2	UTSW	3	80709457	missense	probably benign	0.01
R8362:Gria2	UTSW	3	80707890	missense	possibly damaging	0.82
R8481:Gria2	UTSW	3	80801691	missense	possibly damaging	0.95
R8500:Gria2	UTSW	3	80692467	missense	probably damaging	0.99
R8516:Gria2	UTSW	3	80706987	missense	probably benign	0.27
R8918:Gria2	UTSW	3	80692399	missense	probably damaging	1.00
R8939:Gria2	UTSW	3	80710863	intron	probably benign
R8971:Gria2	UTSW	3	80707893	missense	probably damaging	0.98
R9229:Gria2	UTSW	3	80802382	start codon destroyed	probably null	0.60

Predicted Primers

PCR Primer
(F):5'- TGTGTGCTTGAAGACAAGTGAAATGC -3'
(R):5'- TGAGGAGTCATGCTAACAGCTTTTGG -3'

Sequencing Primer
(F):5'- GTCAACAATCTTAGATGTGGGC -3'
(R):5'- GCTAACAGCTTTTGGGTATCTTAC -3'

Posted On

2013-04-16