Incidental Mutation 'R2140:Dck'
ID 236126
Institutional Source Beutler Lab
Gene Symbol Dck
Ensembl Gene ENSMUSG00000029366
Gene Name deoxycytidine kinase
Synonyms
MMRRC Submission 040143-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R2140 (G1)
Quality Score 225
Status Validated
Chromosome 5
Chromosomal Location 88764996-88783281 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 88772723 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Cysteine to Arginine at position 101 (C101R)
Ref Sequence ENSEMBL: ENSMUSP00000031311 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031311]
AlphaFold P43346
Predicted Effect probably damaging
Transcript: ENSMUST00000031311
AA Change: C101R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000031311
Gene: ENSMUSG00000029366
AA Change: C101R

DomainStartEndE-ValueType
Pfam:dNK 24 258 2.5e-79 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196967
Meta Mutation Damage Score 0.9710 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency 100% (96/96)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Deoxycytidine kinase (DCK) is required for the phosphorylation of several deoxyribonucleosides and their nucleoside analogs. Deficiency of DCK is associated with resistance to antiviral and anticancer chemotherapeutic agents. Conversely, increased deoxycytidine kinase activity is associated with increased activation of these compounds to cytotoxic nucleoside triphosphate derivatives. DCK is clinically important because of its relationship to drug resistance and sensitivity. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene have profound defects in lymphopoiesis. Thymic T cell number and overall lymphocyte number are greatly reduced. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 96 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610042L04Rik T C 14: 4,348,902 I21T probably damaging Het
9230110C19Rik T C 9: 8,022,477 D248G probably damaging Het
Adgrf1 A C 17: 43,300,802 E186D probably damaging Het
Adgrf4 C T 17: 42,666,898 R518Q possibly damaging Het
Afdn A G 17: 13,810,433 E202G probably damaging Het
Agfg2 T A 5: 137,667,116 R126W probably damaging Het
Alkbh2 C T 5: 114,125,716 V77I probably benign Het
Alppl2 A G 1: 87,087,697 S381P probably benign Het
Aqp2 A G 15: 99,579,366 T72A probably damaging Het
Atp9b A G 18: 80,736,087 C1123R probably damaging Het
AU016765 T A 17: 64,520,000 noncoding transcript Het
Bscl2 T C 19: 8,845,320 probably null Het
Ccdc80 A T 16: 45,127,446 Y929F probably damaging Het
Cenpj T C 14: 56,526,932 D1341G probably damaging Het
Cir1 A T 2: 73,312,437 S18T probably damaging Het
Clcn6 A G 4: 148,024,137 F145S possibly damaging Het
Cnksr1 A G 4: 134,229,628 Y488H probably damaging Het
Cntrl CAGAG CAG 2: 35,122,806 probably null Het
Crb1 T C 1: 139,237,012 I1125V probably benign Het
Cyp3a13 A T 5: 137,921,454 V20D possibly damaging Het
Dars T A 1: 128,372,162 M362L probably benign Het
Dnah11 T C 12: 118,008,810 T2880A probably benign Het
Dnah7b T A 1: 46,268,670 M3048K probably damaging Het
Eef1a2 C T 2: 181,148,742 E374K probably benign Het
Eif3a A T 19: 60,775,394 probably benign Het
Esco1 A G 18: 10,574,873 probably null Het
Exoc8 C T 8: 124,897,415 R71Q possibly damaging Het
Fam208a C T 14: 27,480,035 T1462I probably damaging Het
Far1 G A 7: 113,566,460 V445M possibly damaging Het
Fbn1 C A 2: 125,343,810 C1648F probably damaging Het
Fmn1 A G 2: 113,595,048 K1189R probably benign Het
Foxl2 C A 9: 98,956,487 P276H unknown Het
Fpr3 T A 17: 17,970,617 V50E probably damaging Het
Garem1 T A 18: 21,129,374 R794S probably damaging Het
Gemin4 G C 11: 76,211,050 P962A probably damaging Het
Glyatl3 T C 17: 40,911,084 D93G probably benign Het
Gm14124 A T 2: 150,269,361 H657L probably benign Het
Gm4787 A G 12: 81,378,562 I274T probably benign Het
Gucy1a1 C T 3: 82,118,886 probably null Het
Hook1 GATGAATGA GATGA 4: 96,013,312 503 probably null Het
Ift20 G A 11: 78,540,034 E68K probably damaging Het
Ints13 A G 6: 146,576,431 S7P probably damaging Het
Kat5 T A 19: 5,605,685 probably null Het
Kcnma1 A C 14: 23,314,220 L988R probably damaging Het
Kcnq3 C A 15: 66,005,978 probably benign Het
Kctd16 A G 18: 40,259,178 E273G possibly damaging Het
Krt82 T A 15: 101,545,156 Q265L probably damaging Het
Lama2 A T 10: 27,054,694 probably null Het
Laptm4b G T 15: 34,238,332 M3I probably benign Het
Lmtk2 A G 5: 144,147,615 Y156C probably damaging Het
Lrrc58 G A 16: 37,881,409 E350K probably damaging Het
Lrrk1 A T 7: 66,330,750 D227E probably damaging Het
Macf1 C T 4: 123,355,102 C7210Y probably damaging Het
Madd A G 2: 91,152,509 I1363T possibly damaging Het
Mcm3 A G 1: 20,813,110 V295A probably benign Het
Mki67 A G 7: 135,695,592 I2571T possibly damaging Het
Mtrr C T 13: 68,568,940 A385T possibly damaging Het
Myh7b A G 2: 155,620,123 Y313C probably damaging Het
Myot A T 18: 44,354,125 H343L possibly damaging Het
Myt1 C A 2: 181,825,979 Q1069K probably damaging Het
Nid1 T A 13: 13,499,668 D877E probably damaging Het
Nle1 A G 11: 82,905,568 V159A probably damaging Het
Nmbr C A 10: 14,770,442 Y353* probably null Het
Nos1ap T A 1: 170,329,166 D241V probably damaging Het
Nostrin A C 2: 69,166,003 Y209S probably damaging Het
Olfr1099 A T 2: 86,959,281 M59K probably damaging Het
Olfr115 T G 17: 37,610,471 E93D probably benign Het
Olfr1168 A T 2: 88,185,095 S73C probably benign Het
Olfr1240 C T 2: 89,439,583 R232H probably benign Het
Olfr283 G A 15: 98,378,396 T238I possibly damaging Het
Olfr378 A T 11: 73,425,881 M34K probably damaging Het
Pcdh7 T A 5: 58,128,996 V1138E probably damaging Het
Pglyrp3 T G 3: 92,026,567 V173G probably benign Het
Plec T C 15: 76,183,174 T1331A probably benign Het
Plxnb2 T C 15: 89,156,562 D1787G probably benign Het
Pms1 T A 1: 53,281,988 I29F probably damaging Het
Ptprt G A 2: 161,811,988 T574I probably damaging Het
R3hdm1 A G 1: 128,190,693 Y561C probably damaging Het
Rab17 A G 1: 90,960,078 F120S probably benign Het
Rab7b T A 1: 131,698,419 W62R probably damaging Het
Ryr2 C T 13: 11,560,607 G4835E probably damaging Het
Ryr3 A G 2: 112,875,148 V807A probably benign Het
Sept4 A T 11: 87,583,436 Q60L probably benign Het
Slc23a1 C T 18: 35,626,434 R26Q unknown Het
Slc7a4 C A 16: 17,574,544 R342L possibly damaging Het
Slfn9 C T 11: 82,984,655 C367Y possibly damaging Het
Slitrk6 T G 14: 110,750,794 T494P probably benign Het
Tiam1 A G 16: 89,849,645 probably benign Het
Tiparp C A 3: 65,529,252 probably benign Het
Tmem39b T C 4: 129,678,688 T374A probably benign Het
Trim5 G A 7: 104,276,791 R188* probably null Het
Ttn C T 2: 76,813,339 G11436R probably damaging Het
Ubr4 C T 4: 139,477,207 T4810M probably damaging Het
Vmn2r26 A T 6: 124,061,237 E590D probably benign Het
Wwc1 A G 11: 35,870,528 F650S probably benign Het
Xrcc6 T A 15: 82,022,977 F167I probably damaging Het
Other mutations in Dck
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01589:Dck APN 5 88774236 splice site probably benign
IGL02229:Dck APN 5 88774105 missense probably damaging 1.00
IGL02317:Dck APN 5 88774083 missense probably damaging 1.00
IGL02696:Dck APN 5 88772807 missense probably damaging 1.00
rosa UTSW 5 88772723 missense probably damaging 1.00
R0600:Dck UTSW 5 88781221 missense probably benign 0.01
R2019:Dck UTSW 5 88774084 missense probably damaging 1.00
R2037:Dck UTSW 5 88772717 missense probably damaging 1.00
R2142:Dck UTSW 5 88772723 missense probably damaging 1.00
R4834:Dck UTSW 5 88772736 missense probably damaging 1.00
R8702:Dck UTSW 5 88778413 missense probably damaging 0.99
R9149:Dck UTSW 5 88765307 missense probably benign
Predicted Primers PCR Primer
(F):5'- CGCATTTCTCTTTGAACCTCTTAAA -3'
(R):5'- CGCAGCCTCTAATTTGATTACCA -3'

Sequencing Primer
(F):5'- TTTAATCCCAGCATGGAGGC -3'
(R):5'- GCCTCTAATTTGATTACCAGGAAATG -3'
Posted On 2014-10-01