Incidental Mutation 'R2140:Lama2'
ID 236141
Institutional Source Beutler Lab
Gene Symbol Lama2
Ensembl Gene ENSMUSG00000019899
Gene Name laminin, alpha 2
Synonyms merosin, mer
MMRRC Submission 040143-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.413) question?
Stock # R2140 (G1)
Quality Score 225
Status Validated
Chromosome 10
Chromosomal Location 26980036-27619758 bp(-) (GRCm38)
Type of Mutation splice site
DNA Base Change (assembly) A to T at 27054694 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000092639]
AlphaFold no structure available at present
Predicted Effect probably null
Transcript: ENSMUST00000092639
SMART Domains Protein: ENSMUSP00000090304
Gene: ENSMUSG00000019899

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
LamNT 29 281 5.35e-129 SMART
EGF_Lam 283 337 2.11e-4 SMART
EGF_Lam 340 407 1.59e-8 SMART
EGF_Lam 410 462 5.44e-7 SMART
EGF_Lam 465 511 9.05e-4 SMART
LamB 574 706 2.26e-44 SMART
Pfam:Laminin_EGF 715 745 2.8e-4 PFAM
EGF_Lam 753 800 4.03e-10 SMART
EGF_Lam 803 858 3.01e-9 SMART
EGF_Lam 861 911 1.35e-11 SMART
EGF_Lam 914 960 7.23e-12 SMART
EGF_Lam 963 1007 5.87e-12 SMART
EGF_Lam 1010 1053 1.28e-12 SMART
EGF_Lam 1056 1099 2.37e-7 SMART
EGF_Lam 1102 1159 3.22e-9 SMART
LamB 1225 1360 1.95e-57 SMART
EGF_like 1364 1413 8.13e-1 SMART
EGF_Lam 1416 1462 5.48e-12 SMART
EGF_Lam 1465 1520 1.27e-7 SMART
EGF_Lam 1523 1567 2.4e-8 SMART
Pfam:Laminin_I 1584 1849 2e-92 PFAM
Blast:MA 1881 2113 1e-112 BLAST
LamG 2162 2307 1.28e-25 SMART
LamG 2356 2500 2.2e-33 SMART
LamG 2542 2688 3.31e-28 SMART
low complexity region 2725 2741 N/A INTRINSIC
LamG 2781 2914 2.25e-39 SMART
LamG 2956 3092 1.53e-32 SMART
Predicted Effect probably null
Transcript: ENSMUST00000219763
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency 100% (96/96)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Laminin, an extracellular protein, is a major component of the basement membrane. It is thought to mediate the attachment, migration, and organization of cells into tissues during embryonic development by interacting with other extracellular matrix components. It is composed of three subunits, alpha, beta, and gamma, which are bound to each other by disulfide bonds into a cross-shaped molecule. This gene encodes the alpha 2 chain, which constitutes one of the subunits of laminin 2 (merosin) and laminin 4 (s-merosin). Mutations in this gene have been identified as the cause of congenital merosin-deficient muscular dystrophy. Two transcript variants encoding different proteins have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted and spontaneous mutations exhibit progressive growth retardation, ataxia, muscle atrophy and degeneration, infertility, and premature lethality. Muscle fiber degeneration is evident as early as the first week of life. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 96 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610042L04Rik T C 14: 4,348,902 I21T probably damaging Het
9230110C19Rik T C 9: 8,022,477 D248G probably damaging Het
Adgrf1 A C 17: 43,300,802 E186D probably damaging Het
Adgrf4 C T 17: 42,666,898 R518Q possibly damaging Het
Afdn A G 17: 13,810,433 E202G probably damaging Het
Agfg2 T A 5: 137,667,116 R126W probably damaging Het
Alkbh2 C T 5: 114,125,716 V77I probably benign Het
Alppl2 A G 1: 87,087,697 S381P probably benign Het
Aqp2 A G 15: 99,579,366 T72A probably damaging Het
Atp9b A G 18: 80,736,087 C1123R probably damaging Het
AU016765 T A 17: 64,520,000 noncoding transcript Het
Bscl2 T C 19: 8,845,320 probably null Het
Ccdc80 A T 16: 45,127,446 Y929F probably damaging Het
Cenpj T C 14: 56,526,932 D1341G probably damaging Het
Cir1 A T 2: 73,312,437 S18T probably damaging Het
Clcn6 A G 4: 148,024,137 F145S possibly damaging Het
Cnksr1 A G 4: 134,229,628 Y488H probably damaging Het
Cntrl CAGAG CAG 2: 35,122,806 probably null Het
Crb1 T C 1: 139,237,012 I1125V probably benign Het
Cyp3a13 A T 5: 137,921,454 V20D possibly damaging Het
Dars T A 1: 128,372,162 M362L probably benign Het
Dck T C 5: 88,772,723 C101R probably damaging Het
Dnah11 T C 12: 118,008,810 T2880A probably benign Het
Dnah7b T A 1: 46,268,670 M3048K probably damaging Het
Eef1a2 C T 2: 181,148,742 E374K probably benign Het
Eif3a A T 19: 60,775,394 probably benign Het
Esco1 A G 18: 10,574,873 probably null Het
Exoc8 C T 8: 124,897,415 R71Q possibly damaging Het
Fam208a C T 14: 27,480,035 T1462I probably damaging Het
Far1 G A 7: 113,566,460 V445M possibly damaging Het
Fbn1 C A 2: 125,343,810 C1648F probably damaging Het
Fmn1 A G 2: 113,595,048 K1189R probably benign Het
Foxl2 C A 9: 98,956,487 P276H unknown Het
Fpr3 T A 17: 17,970,617 V50E probably damaging Het
Garem1 T A 18: 21,129,374 R794S probably damaging Het
Gemin4 G C 11: 76,211,050 P962A probably damaging Het
Glyatl3 T C 17: 40,911,084 D93G probably benign Het
Gm14124 A T 2: 150,269,361 H657L probably benign Het
Gm4787 A G 12: 81,378,562 I274T probably benign Het
Gucy1a1 C T 3: 82,118,886 probably null Het
Hook1 GATGAATGA GATGA 4: 96,013,312 503 probably null Het
Ift20 G A 11: 78,540,034 E68K probably damaging Het
Ints13 A G 6: 146,576,431 S7P probably damaging Het
Kat5 T A 19: 5,605,685 probably null Het
Kcnma1 A C 14: 23,314,220 L988R probably damaging Het
Kcnq3 C A 15: 66,005,978 probably benign Het
Kctd16 A G 18: 40,259,178 E273G possibly damaging Het
Krt82 T A 15: 101,545,156 Q265L probably damaging Het
Laptm4b G T 15: 34,238,332 M3I probably benign Het
Lmtk2 A G 5: 144,147,615 Y156C probably damaging Het
Lrrc58 G A 16: 37,881,409 E350K probably damaging Het
Lrrk1 A T 7: 66,330,750 D227E probably damaging Het
Macf1 C T 4: 123,355,102 C7210Y probably damaging Het
Madd A G 2: 91,152,509 I1363T possibly damaging Het
Mcm3 A G 1: 20,813,110 V295A probably benign Het
Mki67 A G 7: 135,695,592 I2571T possibly damaging Het
Mtrr C T 13: 68,568,940 A385T possibly damaging Het
Myh7b A G 2: 155,620,123 Y313C probably damaging Het
Myot A T 18: 44,354,125 H343L possibly damaging Het
Myt1 C A 2: 181,825,979 Q1069K probably damaging Het
Nid1 T A 13: 13,499,668 D877E probably damaging Het
Nle1 A G 11: 82,905,568 V159A probably damaging Het
Nmbr C A 10: 14,770,442 Y353* probably null Het
Nos1ap T A 1: 170,329,166 D241V probably damaging Het
Nostrin A C 2: 69,166,003 Y209S probably damaging Het
Olfr1099 A T 2: 86,959,281 M59K probably damaging Het
Olfr115 T G 17: 37,610,471 E93D probably benign Het
Olfr1168 A T 2: 88,185,095 S73C probably benign Het
Olfr1240 C T 2: 89,439,583 R232H probably benign Het
Olfr283 G A 15: 98,378,396 T238I possibly damaging Het
Olfr378 A T 11: 73,425,881 M34K probably damaging Het
Pcdh7 T A 5: 58,128,996 V1138E probably damaging Het
Pglyrp3 T G 3: 92,026,567 V173G probably benign Het
Plec T C 15: 76,183,174 T1331A probably benign Het
Plxnb2 T C 15: 89,156,562 D1787G probably benign Het
Pms1 T A 1: 53,281,988 I29F probably damaging Het
Ptprt G A 2: 161,811,988 T574I probably damaging Het
R3hdm1 A G 1: 128,190,693 Y561C probably damaging Het
Rab17 A G 1: 90,960,078 F120S probably benign Het
Rab7b T A 1: 131,698,419 W62R probably damaging Het
Ryr2 C T 13: 11,560,607 G4835E probably damaging Het
Ryr3 A G 2: 112,875,148 V807A probably benign Het
Sept4 A T 11: 87,583,436 Q60L probably benign Het
Slc23a1 C T 18: 35,626,434 R26Q unknown Het
Slc7a4 C A 16: 17,574,544 R342L possibly damaging Het
Slfn9 C T 11: 82,984,655 C367Y possibly damaging Het
Slitrk6 T G 14: 110,750,794 T494P probably benign Het
Tiam1 A G 16: 89,849,645 probably benign Het
Tiparp C A 3: 65,529,252 probably benign Het
Tmem39b T C 4: 129,678,688 T374A probably benign Het
Trim5 G A 7: 104,276,791 R188* probably null Het
Ttn C T 2: 76,813,339 G11436R probably damaging Het
Ubr4 C T 4: 139,477,207 T4810M probably damaging Het
Vmn2r26 A T 6: 124,061,237 E590D probably benign Het
Wwc1 A G 11: 35,870,528 F650S probably benign Het
Xrcc6 T A 15: 82,022,977 F167I probably damaging Het
Other mutations in Lama2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00392:Lama2 APN 10 27188265 missense probably benign 0.01
IGL00467:Lama2 APN 10 27467197 splice site probably benign
IGL00470:Lama2 APN 10 27243742 missense probably benign 0.22
IGL00517:Lama2 APN 10 27197330 missense probably benign 0.01
IGL00541:Lama2 APN 10 27188306 missense probably benign 0.14
IGL00931:Lama2 APN 10 27006776 missense possibly damaging 0.92
IGL00951:Lama2 APN 10 27030285 missense probably benign 0.03
IGL00988:Lama2 APN 10 27369015 nonsense probably null
IGL01098:Lama2 APN 10 27031112 missense possibly damaging 0.66
IGL01152:Lama2 APN 10 27208429 missense probably benign 0.00
IGL01293:Lama2 APN 10 27231636 missense probably benign 0.38
IGL01338:Lama2 APN 10 27188272 missense probably benign 0.13
IGL01609:Lama2 APN 10 27344421 missense probably benign 0.03
IGL01643:Lama2 APN 10 27070372 splice site probably benign
IGL01675:Lama2 APN 10 27188054 missense possibly damaging 0.77
IGL01681:Lama2 APN 10 27265045 missense probably benign 0.33
IGL01694:Lama2 APN 10 27006742 missense possibly damaging 0.75
IGL01705:Lama2 APN 10 27189274 splice site probably benign
IGL01885:Lama2 APN 10 27105139 nonsense probably null
IGL01935:Lama2 APN 10 27422604 missense probably damaging 0.98
IGL01994:Lama2 APN 10 27467203 critical splice donor site probably null
IGL02041:Lama2 APN 10 26984326 missense probably damaging 1.00
IGL02067:Lama2 APN 10 27176796 missense probably benign 0.02
IGL02097:Lama2 APN 10 27138960 missense probably benign 0.09
IGL02179:Lama2 APN 10 27070364 missense probably benign 0.01
IGL02268:Lama2 APN 10 27001116 splice site probably benign
IGL02302:Lama2 APN 10 27212043 missense probably benign 0.06
IGL02363:Lama2 APN 10 27366066 missense probably damaging 1.00
IGL02378:Lama2 APN 10 27043656 missense probably damaging 0.99
IGL02642:Lama2 APN 10 27467273 missense probably damaging 1.00
IGL02676:Lama2 APN 10 27118493 missense probably benign 0.00
IGL02695:Lama2 APN 10 27000775 missense probably benign
IGL02735:Lama2 APN 10 27104128 missense probably damaging 1.00
IGL02794:Lama2 APN 10 27041231 missense possibly damaging 0.73
IGL02823:Lama2 APN 10 27001145 missense probably damaging 1.00
IGL02869:Lama2 APN 10 27015538 missense probably damaging 0.99
IGL02942:Lama2 APN 10 27041220 missense probably damaging 1.00
IGL03201:Lama2 APN 10 27344570 nonsense probably null
IGL03268:Lama2 APN 10 27422653 missense probably damaging 1.00
IGL03288:Lama2 APN 10 27369051 missense probably damaging 1.00
IGL03380:Lama2 APN 10 27050265 missense probably damaging 1.00
IGL03407:Lama2 APN 10 27347021 missense probably damaging 1.00
cowboy UTSW 10 27043643 frame shift probably null
petri UTSW 10 26993398 splice site probably null
PIT4362001:Lama2 UTSW 10 27369136 missense probably damaging 1.00
PIT4382001:Lama2 UTSW 10 27204905 missense probably damaging 1.00
PIT4431001:Lama2 UTSW 10 27101430 missense probably damaging 1.00
R0038:Lama2 UTSW 10 26986797 missense probably benign 0.02
R0038:Lama2 UTSW 10 26986797 missense probably benign 0.02
R0114:Lama2 UTSW 10 26993068 nonsense probably null
R0142:Lama2 UTSW 10 27187845 missense probably benign
R0313:Lama2 UTSW 10 26993398 splice site probably null
R0376:Lama2 UTSW 10 27015546 missense possibly damaging 0.68
R0412:Lama2 UTSW 10 27190625 missense possibly damaging 0.58
R0472:Lama2 UTSW 10 26990867 missense probably damaging 1.00
R0607:Lama2 UTSW 10 27189131 missense probably benign 0.34
R0648:Lama2 UTSW 10 26989376 missense probably benign 0.00
R0667:Lama2 UTSW 10 27344410 splice site probably null
R0760:Lama2 UTSW 10 27044433 critical splice donor site probably null
R1240:Lama2 UTSW 10 27041124 missense probably damaging 1.00
R1385:Lama2 UTSW 10 27224043 missense probably benign 0.11
R1433:Lama2 UTSW 10 27187754 missense probably damaging 1.00
R1434:Lama2 UTSW 10 27208370 missense probably damaging 1.00
R1574:Lama2 UTSW 10 27324754 missense possibly damaging 0.65
R1574:Lama2 UTSW 10 27324754 missense possibly damaging 0.65
R1645:Lama2 UTSW 10 27368985 missense probably damaging 1.00
R1702:Lama2 UTSW 10 27190529 missense probably benign
R1703:Lama2 UTSW 10 27266671 missense probably damaging 1.00
R1769:Lama2 UTSW 10 27208406 missense probably damaging 1.00
R1769:Lama2 UTSW 10 27208407 missense probably benign
R1846:Lama2 UTSW 10 27212096 missense probably damaging 1.00
R1859:Lama2 UTSW 10 27031082 missense possibly damaging 0.51
R1871:Lama2 UTSW 10 26984494 missense probably damaging 1.00
R1903:Lama2 UTSW 10 27188399 missense probably damaging 1.00
R1906:Lama2 UTSW 10 27056527 critical splice donor site probably null
R1958:Lama2 UTSW 10 26981598 missense probably damaging 0.97
R1959:Lama2 UTSW 10 27422618 missense probably damaging 1.00
R1977:Lama2 UTSW 10 26990800 splice site probably null
R2063:Lama2 UTSW 10 27164926 missense probably damaging 1.00
R2079:Lama2 UTSW 10 27369053 missense probably damaging 0.99
R2085:Lama2 UTSW 10 27204841 nonsense probably null
R2125:Lama2 UTSW 10 27044453 nonsense probably null
R2219:Lama2 UTSW 10 27043569 missense probably damaging 0.99
R2259:Lama2 UTSW 10 27031127 missense probably benign 0.00
R2265:Lama2 UTSW 10 26992936 missense probably damaging 1.00
R2266:Lama2 UTSW 10 26986797 missense probably benign 0.02
R2267:Lama2 UTSW 10 26992936 missense probably damaging 1.00
R2268:Lama2 UTSW 10 26992936 missense probably damaging 1.00
R2269:Lama2 UTSW 10 26992936 missense probably damaging 1.00
R2862:Lama2 UTSW 10 27422612 nonsense probably null
R2912:Lama2 UTSW 10 27000803 missense probably benign
R2999:Lama2 UTSW 10 26989421 missense probably benign 0.18
R3034:Lama2 UTSW 10 27001235 missense probably benign 0.11
R3081:Lama2 UTSW 10 27001235 missense probably benign 0.11
R3107:Lama2 UTSW 10 27001235 missense probably benign 0.11
R3109:Lama2 UTSW 10 27001235 missense probably benign 0.11
R3436:Lama2 UTSW 10 27001235 missense probably benign 0.11
R3437:Lama2 UTSW 10 27001235 missense probably benign 0.11
R3706:Lama2 UTSW 10 27138996 missense probably damaging 1.00
R3780:Lama2 UTSW 10 27459339 missense probably damaging 1.00
R3807:Lama2 UTSW 10 27190665 frame shift probably null
R3919:Lama2 UTSW 10 27118505 missense probably damaging 1.00
R4014:Lama2 UTSW 10 26984376 missense probably damaging 1.00
R4131:Lama2 UTSW 10 27041174 missense probably benign 0.00
R4190:Lama2 UTSW 10 27266664 missense probably damaging 0.96
R4273:Lama2 UTSW 10 27347054 missense probably damaging 1.00
R4358:Lama2 UTSW 10 26984493 missense probably damaging 1.00
R4407:Lama2 UTSW 10 27212128 small deletion probably benign
R4415:Lama2 UTSW 10 26989344 nonsense probably null
R4426:Lama2 UTSW 10 27422558 missense probably damaging 1.00
R4590:Lama2 UTSW 10 26989414 missense probably benign 0.00
R4615:Lama2 UTSW 10 26981524 missense probably damaging 0.99
R4736:Lama2 UTSW 10 27204929 missense probably damaging 1.00
R4754:Lama2 UTSW 10 27118531 missense possibly damaging 0.58
R4791:Lama2 UTSW 10 27467271 missense probably damaging 1.00
R4834:Lama2 UTSW 10 27006749 missense probably benign 0.30
R4856:Lama2 UTSW 10 27043643 frame shift probably null
R4858:Lama2 UTSW 10 27043643 frame shift probably null
R4859:Lama2 UTSW 10 27043643 frame shift probably null
R4897:Lama2 UTSW 10 27043643 frame shift probably null
R4898:Lama2 UTSW 10 27043643 frame shift probably null
R4899:Lama2 UTSW 10 27043643 frame shift probably null
R4907:Lama2 UTSW 10 27164946 missense probably benign 0.11
R4911:Lama2 UTSW 10 27138927 missense probably damaging 1.00
R4924:Lama2 UTSW 10 27369141 missense probably damaging 0.98
R5023:Lama2 UTSW 10 27190504 missense probably damaging 0.97
R5057:Lama2 UTSW 10 27164986 missense probably damaging 1.00
R5070:Lama2 UTSW 10 27350251 critical splice donor site probably null
R5116:Lama2 UTSW 10 27118560 missense probably benign 0.08
R5177:Lama2 UTSW 10 27190703 missense possibly damaging 0.94
R5198:Lama2 UTSW 10 27347003 missense probably damaging 0.96
R5289:Lama2 UTSW 10 27212073 nonsense probably null
R5327:Lama2 UTSW 10 27138946 missense probably benign
R5424:Lama2 UTSW 10 26984396 missense probably damaging 1.00
R5469:Lama2 UTSW 10 27041189 missense possibly damaging 0.92
R5620:Lama2 UTSW 10 26990880 missense probably damaging 0.99
R5667:Lama2 UTSW 10 27190544 missense probably damaging 1.00
R5671:Lama2 UTSW 10 27190544 missense probably damaging 1.00
R5815:Lama2 UTSW 10 26986851 missense probably damaging 1.00
R5917:Lama2 UTSW 10 27190697 missense probably damaging 1.00
R5935:Lama2 UTSW 10 27015498 missense probably benign
R5976:Lama2 UTSW 10 27190676 missense probably benign 0.00
R5979:Lama2 UTSW 10 27235732 missense probably damaging 0.99
R6004:Lama2 UTSW 10 27235785 missense probably benign 0.01
R6180:Lama2 UTSW 10 26981499 missense probably benign 0.03
R6198:Lama2 UTSW 10 27188022 missense probably damaging 1.00
R6257:Lama2 UTSW 10 26986899 missense possibly damaging 0.85
R6271:Lama2 UTSW 10 27023329 missense possibly damaging 0.67
R6322:Lama2 UTSW 10 27190547 missense probably damaging 0.96
R6354:Lama2 UTSW 10 27212068 missense probably damaging 1.00
R6431:Lama2 UTSW 10 27053031 missense possibly damaging 0.50
R6499:Lama2 UTSW 10 27031158 missense probably damaging 1.00
R6535:Lama2 UTSW 10 27104131 missense probably damaging 1.00
R6545:Lama2 UTSW 10 27176797 missense probably benign
R6636:Lama2 UTSW 10 27124568 missense probably benign 0.13
R6891:Lama2 UTSW 10 27328072 nonsense probably null
R6891:Lama2 UTSW 10 27328082 nonsense probably null
R6902:Lama2 UTSW 10 26981629 missense probably damaging 1.00
R6908:Lama2 UTSW 10 27031196 splice site probably null
R7168:Lama2 UTSW 10 27366152 critical splice acceptor site probably null
R7233:Lama2 UTSW 10 27231663 missense probably damaging 1.00
R7272:Lama2 UTSW 10 27124556 missense probably damaging 1.00
R7274:Lama2 UTSW 10 27119980 missense probably damaging 0.99
R7419:Lama2 UTSW 10 27266634 missense probably benign
R7423:Lama2 UTSW 10 27212226 missense probably benign 0.00
R7554:Lama2 UTSW 10 27155496 missense probably damaging 1.00
R7569:Lama2 UTSW 10 27265050 missense probably damaging 1.00
R7574:Lama2 UTSW 10 27006730 missense probably benign 0.03
R7584:Lama2 UTSW 10 27104261 missense possibly damaging 0.78
R7586:Lama2 UTSW 10 27101393 missense probably benign 0.00
R7603:Lama2 UTSW 10 27266680 missense possibly damaging 0.55
R7691:Lama2 UTSW 10 27208393 missense possibly damaging 0.67
R7750:Lama2 UTSW 10 26990924 missense probably damaging 0.97
R7841:Lama2 UTSW 10 27155533 missense probably benign 0.00
R7864:Lama2 UTSW 10 27056615 missense probably benign 0.08
R7960:Lama2 UTSW 10 26993098 missense probably benign 0.04
R7964:Lama2 UTSW 10 27223981 critical splice donor site probably null
R7980:Lama2 UTSW 10 27363613 missense probably damaging 0.98
R8013:Lama2 UTSW 10 27344498 missense probably benign 0.00
R8028:Lama2 UTSW 10 27328149 missense probably benign 0.13
R8097:Lama2 UTSW 10 27190664 nonsense probably null
R8100:Lama2 UTSW 10 27041117 missense probably benign 0.03
R8110:Lama2 UTSW 10 26990870 missense probably damaging 1.00
R8122:Lama2 UTSW 10 27054596 missense possibly damaging 0.87
R8264:Lama2 UTSW 10 27467222 missense probably benign 0.07
R8315:Lama2 UTSW 10 27422659 missense probably damaging 1.00
R8318:Lama2 UTSW 10 26984338 missense probably damaging 1.00
R8419:Lama2 UTSW 10 27422563 missense probably benign 0.26
R8475:Lama2 UTSW 10 27101373 missense possibly damaging 0.69
R8735:Lama2 UTSW 10 27190534 missense probably damaging 1.00
R8754:Lama2 UTSW 10 27001151 missense possibly damaging 0.83
R8817:Lama2 UTSW 10 27187873 missense probably damaging 1.00
R8851:Lama2 UTSW 10 27366123 missense possibly damaging 0.94
R8859:Lama2 UTSW 10 27459388 missense possibly damaging 0.58
R8886:Lama2 UTSW 10 27369161 splice site probably benign
R8937:Lama2 UTSW 10 26986820 missense probably damaging 1.00
R8993:Lama2 UTSW 10 27422714 missense possibly damaging 0.91
R9025:Lama2 UTSW 10 26984371 missense probably benign 0.00
R9027:Lama2 UTSW 10 27204885 missense probably damaging 1.00
R9047:Lama2 UTSW 10 27006701 missense possibly damaging 0.50
R9075:Lama2 UTSW 10 26981592 missense probably damaging 1.00
R9135:Lama2 UTSW 10 27422519 missense probably damaging 1.00
R9165:Lama2 UTSW 10 27053026 critical splice donor site probably null
R9192:Lama2 UTSW 10 27328185 missense possibly damaging 0.95
R9254:Lama2 UTSW 10 27422689 missense probably damaging 0.96
R9326:Lama2 UTSW 10 27030197 missense probably benign 0.04
R9356:Lama2 UTSW 10 27212190 missense probably damaging 0.99
R9358:Lama2 UTSW 10 27188382 missense possibly damaging 0.95
R9358:Lama2 UTSW 10 27616765 missense unknown
R9376:Lama2 UTSW 10 27118624 missense probably benign 0.11
R9381:Lama2 UTSW 10 27188027 nonsense probably null
R9397:Lama2 UTSW 10 27105121 missense probably benign 0.01
R9460:Lama2 UTSW 10 27422479 missense probably damaging 1.00
R9478:Lama2 UTSW 10 27015482 missense probably damaging 0.98
R9503:Lama2 UTSW 10 26989444 missense possibly damaging 0.57
R9514:Lama2 UTSW 10 27224019 missense probably benign 0.00
R9515:Lama2 UTSW 10 27001174 missense probably benign 0.23
R9516:Lama2 UTSW 10 27224019 missense probably benign 0.00
R9533:Lama2 UTSW 10 26986875 missense probably damaging 1.00
R9619:Lama2 UTSW 10 27188286 missense probably damaging 1.00
R9721:Lama2 UTSW 10 27467342 missense possibly damaging 0.58
Predicted Primers PCR Primer
(F):5'- TTGGAAGGATCTTTCACCACAG -3'
(R):5'- TGGGCACTTATAATAAAGCTCCC -3'

Sequencing Primer
(F):5'- GAAGGATCTTTCACCACAGCGTTC -3'
(R):5'- GTCTGAGGTCATGCATTC -3'
Posted On 2014-10-01