Mutagenetix > Incidental Mutation

Incidental Mutation 'R2140:Dnah11'

236153

Institutional Source

Beutler Lab

Gene Symbol

Dnah11

Ensembl Gene

ENSMUSG00000018581

Gene Name

dynein, axonemal, heavy chain 11

Synonyms

b2b598Clo, Dnahc11, b2b1289Clo, lrd, b2b1727Clo, b2b1203Clo, b2b1279Clo

MMRRC Submission

040143-MU

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.584) question?

Stock #

R2140 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

117877982-118199043 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 118008810 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 2880 (T2880A)

Ref Sequence

ENSEMBL: ENSMUSP00000081867 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000084806]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000084806
AA Change: T2880A

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)

SMART Domains

Protein: ENSMUSP00000081867
Gene: ENSMUSG00000018581
AA Change: T2880A

Domain	Start	End	E-Value	Type
low complexity region	18	28	N/A	INTRINSIC
Pfam:DHC_N1	218	794	1.6e-162	PFAM
low complexity region	1266	1282	N/A	INTRINSIC
Pfam:DHC_N2	1297	1705	1e-130	PFAM
low complexity region	1757	1773	N/A	INTRINSIC
AAA	1869	1963	1.51e0	SMART
Pfam:AAA_5	2150	2286	1.6e-12	PFAM
AAA	2474	2619	1.48e-1	SMART
AAA	2819	2931	4.57e-1	SMART
Pfam:MT	3069	3413	3.2e-162	PFAM
Pfam:AAA_9	3434	3656	2.9e-88	PFAM
Pfam:Dynein_heavy	3790	4486	7.1e-235	PFAM

Predicted Effect

unknown
Transcript: ENSMUST00000176756
AA Change: T976A

Meta Mutation Damage Score

0.0987

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.1%
20x: 94.5%

Validation Efficiency

100% (96/96)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a ciliary outer dynein arm protein and is a member of the dynein heavy chain family. It is a microtubule-dependent motor ATPase and has been reported to be involved in the movement of respiratory cilia. Mutations in this gene have been implicated in causing Kartagener Syndrome (a combination of situs inversus totalis and Primary Ciliary Dyskinesia (PCD), also called Immotile Cilia Syndrome 1 (ICS1)) and male sterility. [provided by RefSeq, Mar 2013]
PHENOTYPE: Approximately half of live-born homozygous mutants show situs inversus indicating that this gene is no longer properly controlling left-right asymmetry. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 96 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2610042L04Rik	T	C	14: 4,348,902	I21T	probably damaging	Het
9230110C19Rik	T	C	9: 8,022,477	D248G	probably damaging	Het
Adgrf1	A	C	17: 43,300,802	E186D	probably damaging	Het
Adgrf4	C	T	17: 42,666,898	R518Q	possibly damaging	Het
Afdn	A	G	17: 13,810,433	E202G	probably damaging	Het
Agfg2	T	A	5: 137,667,116	R126W	probably damaging	Het
Alkbh2	C	T	5: 114,125,716	V77I	probably benign	Het
Alppl2	A	G	1: 87,087,697	S381P	probably benign	Het
Aqp2	A	G	15: 99,579,366	T72A	probably damaging	Het
Atp9b	A	G	18: 80,736,087	C1123R	probably damaging	Het
AU016765	T	A	17: 64,520,000		noncoding transcript	Het
Bscl2	T	C	19: 8,845,320		probably null	Het
Ccdc80	A	T	16: 45,127,446	Y929F	probably damaging	Het
Cenpj	T	C	14: 56,526,932	D1341G	probably damaging	Het
Cir1	A	T	2: 73,312,437	S18T	probably damaging	Het
Clcn6	A	G	4: 148,024,137	F145S	possibly damaging	Het
Cnksr1	A	G	4: 134,229,628	Y488H	probably damaging	Het
Cntrl	CAGAG	CAG	2: 35,122,806		probably null	Het
Crb1	T	C	1: 139,237,012	I1125V	probably benign	Het
Cyp3a13	A	T	5: 137,921,454	V20D	possibly damaging	Het
Dars	T	A	1: 128,372,162	M362L	probably benign	Het
Dck	T	C	5: 88,772,723	C101R	probably damaging	Het
Dnah7b	T	A	1: 46,268,670	M3048K	probably damaging	Het
Eef1a2	C	T	2: 181,148,742	E374K	probably benign	Het
Eif3a	A	T	19: 60,775,394		probably benign	Het
Esco1	A	G	18: 10,574,873		probably null	Het
Exoc8	C	T	8: 124,897,415	R71Q	possibly damaging	Het
Fam208a	C	T	14: 27,480,035	T1462I	probably damaging	Het
Far1	G	A	7: 113,566,460	V445M	possibly damaging	Het
Fbn1	C	A	2: 125,343,810	C1648F	probably damaging	Het
Fmn1	A	G	2: 113,595,048	K1189R	probably benign	Het
Foxl2	C	A	9: 98,956,487	P276H	unknown	Het
Fpr3	T	A	17: 17,970,617	V50E	probably damaging	Het
Garem1	T	A	18: 21,129,374	R794S	probably damaging	Het
Gemin4	G	C	11: 76,211,050	P962A	probably damaging	Het
Glyatl3	T	C	17: 40,911,084	D93G	probably benign	Het
Gm14124	A	T	2: 150,269,361	H657L	probably benign	Het
Gm4787	A	G	12: 81,378,562	I274T	probably benign	Het
Gucy1a1	C	T	3: 82,118,886		probably null	Het
Hook1	GATGAATGA	GATGA	4: 96,013,312	503	probably null	Het
Ift20	G	A	11: 78,540,034	E68K	probably damaging	Het
Ints13	A	G	6: 146,576,431	S7P	probably damaging	Het
Kat5	T	A	19: 5,605,685		probably null	Het
Kcnma1	A	C	14: 23,314,220	L988R	probably damaging	Het
Kcnq3	C	A	15: 66,005,978		probably benign	Het
Kctd16	A	G	18: 40,259,178	E273G	possibly damaging	Het
Krt82	T	A	15: 101,545,156	Q265L	probably damaging	Het
Lama2	A	T	10: 27,054,694		probably null	Het
Laptm4b	G	T	15: 34,238,332	M3I	probably benign	Het
Lmtk2	A	G	5: 144,147,615	Y156C	probably damaging	Het
Lrrc58	G	A	16: 37,881,409	E350K	probably damaging	Het
Lrrk1	A	T	7: 66,330,750	D227E	probably damaging	Het
Macf1	C	T	4: 123,355,102	C7210Y	probably damaging	Het
Madd	A	G	2: 91,152,509	I1363T	possibly damaging	Het
Mcm3	A	G	1: 20,813,110	V295A	probably benign	Het
Mki67	A	G	7: 135,695,592	I2571T	possibly damaging	Het
Mtrr	C	T	13: 68,568,940	A385T	possibly damaging	Het
Myh7b	A	G	2: 155,620,123	Y313C	probably damaging	Het
Myot	A	T	18: 44,354,125	H343L	possibly damaging	Het
Myt1	C	A	2: 181,825,979	Q1069K	probably damaging	Het
Nid1	T	A	13: 13,499,668	D877E	probably damaging	Het
Nle1	A	G	11: 82,905,568	V159A	probably damaging	Het
Nmbr	C	A	10: 14,770,442	Y353*	probably null	Het
Nos1ap	T	A	1: 170,329,166	D241V	probably damaging	Het
Nostrin	A	C	2: 69,166,003	Y209S	probably damaging	Het
Olfr1099	A	T	2: 86,959,281	M59K	probably damaging	Het
Olfr115	T	G	17: 37,610,471	E93D	probably benign	Het
Olfr1168	A	T	2: 88,185,095	S73C	probably benign	Het
Olfr1240	C	T	2: 89,439,583	R232H	probably benign	Het
Olfr283	G	A	15: 98,378,396	T238I	possibly damaging	Het
Olfr378	A	T	11: 73,425,881	M34K	probably damaging	Het
Pcdh7	T	A	5: 58,128,996	V1138E	probably damaging	Het
Pglyrp3	T	G	3: 92,026,567	V173G	probably benign	Het
Plec	T	C	15: 76,183,174	T1331A	probably benign	Het
Plxnb2	T	C	15: 89,156,562	D1787G	probably benign	Het
Pms1	T	A	1: 53,281,988	I29F	probably damaging	Het
Ptprt	G	A	2: 161,811,988	T574I	probably damaging	Het
R3hdm1	A	G	1: 128,190,693	Y561C	probably damaging	Het
Rab17	A	G	1: 90,960,078	F120S	probably benign	Het
Rab7b	T	A	1: 131,698,419	W62R	probably damaging	Het
Ryr2	C	T	13: 11,560,607	G4835E	probably damaging	Het
Ryr3	A	G	2: 112,875,148	V807A	probably benign	Het
Sept4	A	T	11: 87,583,436	Q60L	probably benign	Het
Slc23a1	C	T	18: 35,626,434	R26Q	unknown	Het
Slc7a4	C	A	16: 17,574,544	R342L	possibly damaging	Het
Slfn9	C	T	11: 82,984,655	C367Y	possibly damaging	Het
Slitrk6	T	G	14: 110,750,794	T494P	probably benign	Het
Tiam1	A	G	16: 89,849,645		probably benign	Het
Tiparp	C	A	3: 65,529,252		probably benign	Het
Tmem39b	T	C	4: 129,678,688	T374A	probably benign	Het
Trim5	G	A	7: 104,276,791	R188*	probably null	Het
Ttn	C	T	2: 76,813,339	G11436R	probably damaging	Het
Ubr4	C	T	4: 139,477,207	T4810M	probably damaging	Het
Vmn2r26	A	T	6: 124,061,237	E590D	probably benign	Het
Wwc1	A	G	11: 35,870,528	F650S	probably benign	Het
Xrcc6	T	A	15: 82,022,977	F167I	probably damaging	Het

Other mutations in Dnah11

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00341:Dnah11	APN	12	118198745	missense	probably benign	0.28
IGL00422:Dnah11	APN	12	118068096	missense	probably damaging	1.00
IGL00436:Dnah11	APN	12	118036459	missense	possibly damaging	0.56
IGL00540:Dnah11	APN	12	118186922	missense	probably benign	0.01
IGL00687:Dnah11	APN	12	117922004	splice site	probably benign
IGL00833:Dnah11	APN	12	118179580	missense	probably damaging	1.00
IGL00906:Dnah11	APN	12	117911202	missense	probably damaging	1.00
IGL00952:Dnah11	APN	12	118196651	missense	possibly damaging	0.56
IGL01111:Dnah11	APN	12	118142934	splice site	probably benign
IGL01121:Dnah11	APN	12	118050695	missense	probably benign	0.02
IGL01143:Dnah11	APN	12	118012740	missense	probably damaging	1.00
IGL01359:Dnah11	APN	12	117982999	missense	probably damaging	0.99
IGL01372:Dnah11	APN	12	118192399	missense	probably damaging	1.00
IGL01410:Dnah11	APN	12	118047256	nonsense	probably null
IGL01418:Dnah11	APN	12	117987482	nonsense	probably null
IGL01444:Dnah11	APN	12	118020232	missense	possibly damaging	0.91
IGL01606:Dnah11	APN	12	117983032	missense	probably benign	0.15
IGL01645:Dnah11	APN	12	118186998	missense	possibly damaging	0.90
IGL01932:Dnah11	APN	12	118192270	splice site	probably benign
IGL02104:Dnah11	APN	12	118192390	missense	probably benign
IGL02151:Dnah11	APN	12	118059888	splice site	probably benign
IGL02189:Dnah11	APN	12	118082579	missense	probably benign	0.00
IGL02417:Dnah11	APN	12	118057180	missense	probably damaging	1.00
IGL02421:Dnah11	APN	12	118186902	missense	probably damaging	1.00
IGL02444:Dnah11	APN	12	117975873	splice site	probably benign
IGL02474:Dnah11	APN	12	118027445	splice site	probably null
IGL02526:Dnah11	APN	12	118179618	missense	possibly damaging	0.70
IGL02887:Dnah11	APN	12	117911040	missense	probably damaging	1.00
IGL03011:Dnah11	APN	12	118012377	missense	probably benign	0.08
IGL03061:Dnah11	APN	12	117903121	missense	probably damaging	1.00
IGL03182:Dnah11	APN	12	118030291	missense	probably damaging	0.99
IGL03220:Dnah11	APN	12	118105985	missense	probably benign
IGL03238:Dnah11	APN	12	118109898	missense	probably damaging	1.00
IGL03493:Dnah11	APN	12	118012798	missense	probably benign	0.00
P0045:Dnah11	UTSW	12	118030327	missense	probably benign
R0009:Dnah11	UTSW	12	118045522	missense	possibly damaging	0.90
R0066:Dnah11	UTSW	12	118126886	missense	probably benign	0.05
R0172:Dnah11	UTSW	12	117987453	missense	probably damaging	1.00
R0206:Dnah11	UTSW	12	118043774	missense	probably damaging	0.98
R0206:Dnah11	UTSW	12	118043774	missense	probably damaging	0.98
R0208:Dnah11	UTSW	12	118043774	missense	probably damaging	0.98
R0230:Dnah11	UTSW	12	117983056	nonsense	probably null
R0270:Dnah11	UTSW	12	118041013	missense	probably damaging	1.00
R0311:Dnah11	UTSW	12	118127133	missense	probably benign	0.03
R0325:Dnah11	UTSW	12	118012339	missense	probably benign
R0370:Dnah11	UTSW	12	117995227	missense	probably benign
R0416:Dnah11	UTSW	12	117911058	missense	probably damaging	1.00
R0505:Dnah11	UTSW	12	118106510	missense	probably damaging	1.00
R0540:Dnah11	UTSW	12	118082511	missense	probably damaging	1.00
R0554:Dnah11	UTSW	12	117931178	missense	probably benign	0.01
R0607:Dnah11	UTSW	12	118082511	missense	probably damaging	1.00
R0620:Dnah11	UTSW	12	117987469	missense	probably damaging	1.00
R0635:Dnah11	UTSW	12	118007996	missense	probably damaging	1.00
R0755:Dnah11	UTSW	12	117954829	missense	possibly damaging	0.95
R0755:Dnah11	UTSW	12	118198625	missense	probably benign	0.17
R0789:Dnah11	UTSW	12	117911232	missense	probably damaging	1.00
R0833:Dnah11	UTSW	12	118196662	missense	probably benign	0.01
R0835:Dnah11	UTSW	12	117916788	missense	probably damaging	1.00
R0836:Dnah11	UTSW	12	118196662	missense	probably benign	0.01
R0846:Dnah11	UTSW	12	117933850	missense	probably damaging	0.97
R0865:Dnah11	UTSW	12	118190844	nonsense	probably null
R0928:Dnah11	UTSW	12	118045562	missense	probably damaging	1.00
R0939:Dnah11	UTSW	12	118060407	missense	probably damaging	1.00
R1203:Dnah11	UTSW	12	117933812	missense	possibly damaging	0.81
R1394:Dnah11	UTSW	12	117972364	missense	possibly damaging	0.75
R1398:Dnah11	UTSW	12	118057106	nonsense	probably null
R1465:Dnah11	UTSW	12	118038695	missense	probably damaging	1.00
R1465:Dnah11	UTSW	12	118038695	missense	probably damaging	1.00
R1500:Dnah11	UTSW	12	118012829	splice site	probably null
R1535:Dnah11	UTSW	12	118018730	missense	probably damaging	1.00
R1539:Dnah11	UTSW	12	117931256	missense	probably benign	0.01
R1554:Dnah11	UTSW	12	118082499	missense	possibly damaging	0.92
R1574:Dnah11	UTSW	12	118060317	missense	probably damaging	1.00
R1574:Dnah11	UTSW	12	118060317	missense	probably damaging	1.00
R1615:Dnah11	UTSW	12	118050722	missense	probably damaging	1.00
R1618:Dnah11	UTSW	12	118015465	missense	probably damaging	0.98
R1638:Dnah11	UTSW	12	118015419	missense	possibly damaging	0.81
R1659:Dnah11	UTSW	12	118120724	missense	possibly damaging	0.94
R1671:Dnah11	UTSW	12	117916788	missense	probably damaging	1.00
R1678:Dnah11	UTSW	12	117933845	missense	possibly damaging	0.50
R1699:Dnah11	UTSW	12	118190868	missense	probably damaging	1.00
R1712:Dnah11	UTSW	12	118196644	missense	probably benign	0.32
R1728:Dnah11	UTSW	12	117916931	missense	probably damaging	1.00
R1729:Dnah11	UTSW	12	117916931	missense	probably damaging	1.00
R1764:Dnah11	UTSW	12	118190825	missense	probably benign	0.31
R1780:Dnah11	UTSW	12	118027558	missense	probably damaging	1.00
R1789:Dnah11	UTSW	12	118038780	missense	probably damaging	0.99
R1800:Dnah11	UTSW	12	117916788	missense	probably damaging	1.00
R1863:Dnah11	UTSW	12	118063852	missense	possibly damaging	0.92
R1892:Dnah11	UTSW	12	118106474	missense	possibly damaging	0.53
R1907:Dnah11	UTSW	12	118127556	missense	possibly damaging	0.66
R1964:Dnah11	UTSW	12	118142292	missense	possibly damaging	0.56
R1967:Dnah11	UTSW	12	117916788	missense	probably damaging	1.00
R1997:Dnah11	UTSW	12	118082468	missense	possibly damaging	0.64
R2086:Dnah11	UTSW	12	118113871	missense	possibly damaging	0.82
R2092:Dnah11	UTSW	12	118012716	missense	possibly damaging	0.50
R2108:Dnah11	UTSW	12	118020353	missense	probably damaging	1.00
R2261:Dnah11	UTSW	12	117880025	missense	probably benign	0.06
R2261:Dnah11	UTSW	12	117966639	missense	probably damaging	0.99
R2262:Dnah11	UTSW	12	117880025	missense	probably benign	0.06
R2262:Dnah11	UTSW	12	117966639	missense	probably damaging	0.99
R2263:Dnah11	UTSW	12	117880025	missense	probably benign	0.06
R2263:Dnah11	UTSW	12	117966639	missense	probably damaging	0.99
R2328:Dnah11	UTSW	12	117886686	missense	probably damaging	0.98
R2352:Dnah11	UTSW	12	117928330	missense	probably damaging	1.00
R2410:Dnah11	UTSW	12	118027527	missense	probably damaging	1.00
R2885:Dnah11	UTSW	12	117987427	nonsense	probably null
R3499:Dnah11	UTSW	12	117911023	missense	probably damaging	1.00
R3741:Dnah11	UTSW	12	118131341	missense	probably benign	0.05
R3742:Dnah11	UTSW	12	118131341	missense	probably benign	0.05
R3779:Dnah11	UTSW	12	118130713	splice site	probably benign
R3785:Dnah11	UTSW	12	118017602	missense	probably damaging	1.00
R3883:Dnah11	UTSW	12	117978453	splice site	probably benign
R4014:Dnah11	UTSW	12	117974914	missense	probably benign	0.16
R4043:Dnah11	UTSW	12	117879943	missense	probably damaging	1.00
R4072:Dnah11	UTSW	12	118106492	missense	probably damaging	1.00
R4073:Dnah11	UTSW	12	118045678	missense	probably benign	0.01
R4074:Dnah11	UTSW	12	118045678	missense	probably benign	0.01
R4076:Dnah11	UTSW	12	118045678	missense	probably benign	0.01
R4201:Dnah11	UTSW	12	117966659	missense	possibly damaging	0.63
R4224:Dnah11	UTSW	12	118130892	missense	probably benign	0.06
R4233:Dnah11	UTSW	12	117916791	missense	probably damaging	1.00
R4358:Dnah11	UTSW	12	118125843	nonsense	probably null
R4430:Dnah11	UTSW	12	117983011	missense	probably benign	0.26
R4465:Dnah11	UTSW	12	117987451	missense	probably benign	0.09
R4489:Dnah11	UTSW	12	117916896	missense	probably benign	0.31
R4572:Dnah11	UTSW	12	118010125	missense	probably benign	0.00
R4574:Dnah11	UTSW	12	118012255	critical splice donor site	probably null
R4657:Dnah11	UTSW	12	118192427	missense	probably benign	0.02
R4709:Dnah11	UTSW	12	118018760	missense	probably benign	0.26
R4740:Dnah11	UTSW	12	118120544	missense	probably benign	0.28
R4803:Dnah11	UTSW	12	118127608	missense	possibly damaging	0.50
R4896:Dnah11	UTSW	12	117995200	missense	probably damaging	1.00
R4908:Dnah11	UTSW	12	118126883	missense	probably benign	0.37
R5018:Dnah11	UTSW	12	118130728	missense	probably benign	0.00
R5071:Dnah11	UTSW	12	118082453	nonsense	probably null
R5074:Dnah11	UTSW	12	118082453	nonsense	probably null
R5080:Dnah11	UTSW	12	118198830	start codon destroyed	probably null	0.01
R5097:Dnah11	UTSW	12	118017700	missense	probably damaging	1.00
R5131:Dnah11	UTSW	12	117954751	missense	probably damaging	1.00
R5215:Dnah11	UTSW	12	118157361	missense	probably benign	0.09
R5252:Dnah11	UTSW	12	118125941	missense	probably damaging	1.00
R5296:Dnah11	UTSW	12	117883416	missense	probably damaging	1.00
R5308:Dnah11	UTSW	12	118085680	missense	possibly damaging	0.60
R5368:Dnah11	UTSW	12	117954893	missense	probably damaging	1.00
R5383:Dnah11	UTSW	12	118085697	missense	probably damaging	0.99
R5499:Dnah11	UTSW	12	118106474	missense	possibly damaging	0.53
R5503:Dnah11	UTSW	12	117880451	critical splice donor site	probably null
R5546:Dnah11	UTSW	12	117975848	missense	possibly damaging	0.83
R5578:Dnah11	UTSW	12	118018802	missense	probably damaging	0.99
R5657:Dnah11	UTSW	12	117883617	missense	probably damaging	1.00
R5702:Dnah11	UTSW	12	118113907	missense	probably benign	0.04
R5706:Dnah11	UTSW	12	118023935	missense	probably damaging	1.00
R5727:Dnah11	UTSW	12	118127106	missense	probably damaging	1.00
R5737:Dnah11	UTSW	12	118192390	missense	probably benign
R5884:Dnah11	UTSW	12	118177534	missense	probably benign	0.00
R5900:Dnah11	UTSW	12	118082431	splice site	probably null
R5905:Dnah11	UTSW	12	117954924	missense	probably damaging	1.00
R5928:Dnah11	UTSW	12	117914636	splice site	probably null
R5973:Dnah11	UTSW	12	118110952	missense	probably benign	0.02
R6024:Dnah11	UTSW	12	118030272	missense	probably benign	0.34
R6056:Dnah11	UTSW	12	117928456	missense	probably benign	0.03
R6075:Dnah11	UTSW	12	118104851	missense	probably damaging	1.00
R6092:Dnah11	UTSW	12	117928456	missense	probably benign
R6191:Dnah11	UTSW	12	118190897	missense	probably benign
R6197:Dnah11	UTSW	12	118179747	missense	probably benign	0.03
R6262:Dnah11	UTSW	12	117931178	missense	probably damaging	0.98
R6321:Dnah11	UTSW	12	118142292	missense	possibly damaging	0.56
R6454:Dnah11	UTSW	12	117916855	missense	probably benign	0.01
R6614:Dnah11	UTSW	12	117886676	missense	possibly damaging	0.72
R6694:Dnah11	UTSW	12	118186882	splice site	probably null
R6712:Dnah11	UTSW	12	118050722	missense	probably damaging	1.00
R6720:Dnah11	UTSW	12	118045646	missense	probably damaging	1.00
R6742:Dnah11	UTSW	12	118113894	missense	possibly damaging	0.82
R6806:Dnah11	UTSW	12	117987676	splice site	probably null
R6895:Dnah11	UTSW	12	117995191	missense	probably damaging	0.99
R6939:Dnah11	UTSW	12	118106562	missense	probably damaging	1.00
R6940:Dnah11	UTSW	12	118198768	missense	probably benign
R6945:Dnah11	UTSW	12	118060310	missense	probably damaging	1.00
R6958:Dnah11	UTSW	12	117933809	missense	probably damaging	1.00
R6970:Dnah11	UTSW	12	118108944	missense	probably benign	0.00
R6976:Dnah11	UTSW	12	118198643	missense	probably benign	0.16
R7000:Dnah11	UTSW	12	118017661	missense	probably damaging	1.00
R7011:Dnah11	UTSW	12	117922018	frame shift	probably null
R7101:Dnah11	UTSW	12	118068145	missense	probably benign
R7106:Dnah11	UTSW	12	117961149	missense	probably benign	0.15
R7203:Dnah11	UTSW	12	118045522	missense	possibly damaging	0.90
R7219:Dnah11	UTSW	12	118041095	missense	possibly damaging	0.95
R7219:Dnah11	UTSW	12	118126889	missense	probably benign	0.00
R7308:Dnah11	UTSW	12	117995275	missense	probably damaging	1.00
R7361:Dnah11	UTSW	12	118018742	missense	probably damaging	1.00
R7367:Dnah11	UTSW	12	117987442	missense	possibly damaging	0.59
R7399:Dnah11	UTSW	12	118027477	missense	probably benign	0.00
R7399:Dnah11	UTSW	12	118125785	missense	probably damaging	1.00
R7404:Dnah11	UTSW	12	118104808	missense	probably benign	0.36
R7473:Dnah11	UTSW	12	117903176	missense	probably benign	0.19
R7545:Dnah11	UTSW	12	117931204	missense	probably damaging	1.00
R7608:Dnah11	UTSW	12	118140770	splice site	probably null
R7625:Dnah11	UTSW	12	118196642	missense	probably benign
R7761:Dnah11	UTSW	12	118023913	missense	probably damaging	1.00
R7879:Dnah11	UTSW	12	118041009	missense	probably damaging	1.00
R7881:Dnah11	UTSW	12	117987502	missense	probably benign	0.04
R7904:Dnah11	UTSW	12	117903268	missense	possibly damaging	0.72
R8100:Dnah11	UTSW	12	117966633	missense	probably damaging	0.99
R8179:Dnah11	UTSW	12	117878549	missense	possibly damaging	0.90
R8192:Dnah11	UTSW	12	118012446	missense	probably benign
R8254:Dnah11	UTSW	12	117878524	missense	possibly damaging	0.89
R8268:Dnah11	UTSW	12	118027508	nonsense	probably null
R8272:Dnah11	UTSW	12	118111017	missense	probably benign	0.01
R8344:Dnah11	UTSW	12	118085731	missense	probably benign	0.00
R8515:Dnah11	UTSW	12	117975798	missense	probably damaging	1.00
R8528:Dnah11	UTSW	12	118008803	missense	probably damaging	0.96
R8557:Dnah11	UTSW	12	117878512	missense	probably benign
R8676:Dnah11	UTSW	12	118190804	missense	probably damaging	1.00
R8738:Dnah11	UTSW	12	118085649	critical splice donor site	probably null
R8773:Dnah11	UTSW	12	117995215	missense	possibly damaging	0.94
R8818:Dnah11	UTSW	12	117911029	missense	probably damaging	1.00
R8855:Dnah11	UTSW	12	118192372	missense	probably benign	0.03
R8866:Dnah11	UTSW	12	118192372	missense	probably benign	0.03
R8881:Dnah11	UTSW	12	118113912	missense	probably benign	0.00
R8881:Dnah11	UTSW	12	118126815	missense	probably benign	0.05
R8920:Dnah11	UTSW	12	118113939	missense	probably damaging	0.99
R8944:Dnah11	UTSW	12	118127646	missense	possibly damaging	0.63
R8945:Dnah11	UTSW	12	118023983	missense	probably benign	0.36
R8962:Dnah11	UTSW	12	117952538	missense	probably damaging	1.00
R8962:Dnah11	UTSW	12	117954895	missense	probably damaging	1.00
R9059:Dnah11	UTSW	12	118130843	missense	probably benign	0.00
R9155:Dnah11	UTSW	12	118027516	missense	probably damaging	0.99
R9162:Dnah11	UTSW	12	118027516	missense	probably damaging	0.99
R9164:Dnah11	UTSW	12	118027516	missense	probably damaging	0.99
R9171:Dnah11	UTSW	12	117931183	missense	probably damaging	0.99
R9186:Dnah11	UTSW	12	118190897	missense	probably benign
R9205:Dnah11	UTSW	12	118027516	missense	probably damaging	0.99
R9208:Dnah11	UTSW	12	118027516	missense	probably damaging	0.99
R9234:Dnah11	UTSW	12	117987360	missense	probably damaging	1.00
R9264:Dnah11	UTSW	12	118027527	missense	probably damaging	1.00
R9290:Dnah11	UTSW	12	118027516	missense	probably damaging	0.99
R9291:Dnah11	UTSW	12	118027516	missense	probably damaging	0.99
R9315:Dnah11	UTSW	12	118179606	missense	probably benign	0.11
R9353:Dnah11	UTSW	12	118179699	missense	probably benign	0.00
R9375:Dnah11	UTSW	12	117920968	missense	possibly damaging	0.67
R9392:Dnah11	UTSW	12	118047320	nonsense	probably null
R9392:Dnah11	UTSW	12	118177555	missense	probably benign	0.00
R9433:Dnah11	UTSW	12	118012272	missense	probably damaging	1.00
R9511:Dnah11	UTSW	12	117914617	missense	probably damaging	1.00
R9526:Dnah11	UTSW	12	118186976	missense	probably damaging	0.98
R9566:Dnah11	UTSW	12	117974993	missense	possibly damaging	0.69
R9673:Dnah11	UTSW	12	118018778	missense	possibly damaging	0.91
R9705:Dnah11	UTSW	12	118131035	missense	probably damaging	1.00
R9716:Dnah11	UTSW	12	118060413	missense	probably damaging	0.99
R9746:Dnah11	UTSW	12	117878576	nonsense	probably null
R9764:Dnah11	UTSW	12	117920969	missense	probably benign	0.05
RF023:Dnah11	UTSW	12	117954850	missense	probably damaging	1.00
RF047:Dnah11	UTSW	12	118010083	missense	probably damaging	1.00
Z1088:Dnah11	UTSW	12	117895012	missense	probably damaging	1.00
Z1088:Dnah11	UTSW	12	117982969	missense	probably damaging	1.00
Z1176:Dnah11	UTSW	12	117931177	missense	possibly damaging	0.81
Z1176:Dnah11	UTSW	12	118127119	missense	probably benign	0.00
Z1176:Dnah11	UTSW	12	118130799	missense	probably damaging	0.97

Predicted Primers

PCR Primer
(F):5'- GCTTTCTCCCCAAAGACTGC -3'
(R):5'- GCTCACTAGTAAATGCTAGAGTTGG -3'

Sequencing Primer
(F):5'- TTCTCCCCAAAGACTGCCCTAG -3'
(R):5'- CTAGTAAATGCTAGAGTTGGAGGTG -3'

Posted On

2014-10-01