Incidental Mutation 'R2140:Slitrk6'
ID 236162
Institutional Source Beutler Lab
Gene Symbol Slitrk6
Ensembl Gene ENSMUSG00000045871
Gene Name SLIT and NTRK-like family, member 6
Synonyms 4832410J21Rik
MMRRC Submission 040143-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.124) question?
Stock # R2140 (G1)
Quality Score 225
Status Validated
Chromosome 14
Chromosomal Location 110986012-110992581 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to G at 110988226 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Proline at position 494 (T494P)
Ref Sequence ENSEMBL: ENSMUSP00000077492 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078386]
AlphaFold Q8C110
Predicted Effect probably benign
Transcript: ENSMUST00000078386
AA Change: T494P

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000077492
Gene: ENSMUSG00000045871
AA Change: T494P

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Blast:LRRNT 30 68 4e-15 BLAST
LRR 87 110 1.71e1 SMART
LRR 111 134 3.07e-1 SMART
LRR 135 158 4.44e0 SMART
LRR_TYP 159 182 2.09e-3 SMART
LRR 185 206 6.23e1 SMART
LRRCT 218 268 5.61e-5 SMART
low complexity region 287 301 N/A INTRINSIC
Blast:LRRNT 327 364 2e-17 BLAST
LRR 388 408 2.68e1 SMART
LRR_TYP 409 432 3.63e-3 SMART
LRR_TYP 433 456 6.23e-2 SMART
LRR_TYP 457 480 3.69e-4 SMART
low complexity region 501 513 N/A INTRINSIC
LRRCT 516 566 1.53e-6 SMART
transmembrane domain 610 632 N/A INTRINSIC
low complexity region 634 642 N/A INTRINSIC
Meta Mutation Damage Score 0.0758 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency 100% (96/96)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the SLITRK protein family. Members of this family are integral membrane proteins that are characterized by two N-terminal leucine-rich repeat (LRR) domains and a C-terminal region that shares homology with trk neurotrophin receptors. This protein functions as a regulator of neurite outgrowth required for normal hearing and vision. Mutations in this gene are a cause of myopia and deafness. [provided by RefSeq, Dec 2014]
PHENOTYPE: Homozygous deficient mice show pronounced reduction in cochlear innervation. Innervation to the posterior crista is variably impaired and a there is a loss of neurons in the spiral and vestibular ganglia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 96 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610042L04Rik T C 14: 4,348,902 (GRCm38) I21T probably damaging Het
Adgrf1 A C 17: 43,611,693 (GRCm39) E186D probably damaging Het
Adgrf4 C T 17: 42,977,789 (GRCm39) R518Q possibly damaging Het
Afdn A G 17: 14,030,695 (GRCm39) E202G probably damaging Het
Agfg2 T A 5: 137,665,378 (GRCm39) R126W probably damaging Het
Alkbh2 C T 5: 114,263,777 (GRCm39) V77I probably benign Het
Alppl2 A G 1: 87,015,419 (GRCm39) S381P probably benign Het
Aqp2 A G 15: 99,477,247 (GRCm39) T72A probably damaging Het
Atp9b A G 18: 80,779,302 (GRCm39) C1123R probably damaging Het
AU016765 T A 17: 64,826,995 (GRCm39) noncoding transcript Het
Bscl2 T C 19: 8,822,684 (GRCm39) probably null Het
Ccdc80 A T 16: 44,947,809 (GRCm39) Y929F probably damaging Het
Cenpj T C 14: 56,764,389 (GRCm39) D1341G probably damaging Het
Cfap300 T C 9: 8,022,478 (GRCm39) D248G probably damaging Het
Cir1 A T 2: 73,142,781 (GRCm39) S18T probably damaging Het
Clcn6 A G 4: 148,108,594 (GRCm39) F145S possibly damaging Het
Cnksr1 A G 4: 133,956,939 (GRCm39) Y488H probably damaging Het
Cntrl CAGAG CAG 2: 35,012,818 (GRCm39) probably null Het
Crb1 T C 1: 139,164,750 (GRCm39) I1125V probably benign Het
Cyp3a13 A T 5: 137,919,716 (GRCm39) V20D possibly damaging Het
Dars1 T A 1: 128,299,899 (GRCm39) M362L probably benign Het
Dck T C 5: 88,920,582 (GRCm39) C101R probably damaging Het
Dnah11 T C 12: 117,972,545 (GRCm39) T2880A probably benign Het
Dnah7b T A 1: 46,307,830 (GRCm39) M3048K probably damaging Het
Eef1a2 C T 2: 180,790,535 (GRCm39) E374K probably benign Het
Eif3a A T 19: 60,763,832 (GRCm39) probably benign Het
Esco1 A G 18: 10,574,873 (GRCm39) probably null Het
Exoc8 C T 8: 125,624,154 (GRCm39) R71Q possibly damaging Het
Far1 G A 7: 113,165,667 (GRCm39) V445M possibly damaging Het
Fbn1 C A 2: 125,185,730 (GRCm39) C1648F probably damaging Het
Fmn1 A G 2: 113,425,393 (GRCm39) K1189R probably benign Het
Foxl2 C A 9: 98,838,540 (GRCm39) P276H unknown Het
Fpr3 T A 17: 18,190,879 (GRCm39) V50E probably damaging Het
Garem1 T A 18: 21,262,431 (GRCm39) R794S probably damaging Het
Gemin4 G C 11: 76,101,876 (GRCm39) P962A probably damaging Het
Glyatl3 T C 17: 41,221,975 (GRCm39) D93G probably benign Het
Gm4787 A G 12: 81,425,336 (GRCm39) I274T probably benign Het
Gucy1a1 C T 3: 82,026,193 (GRCm39) probably null Het
Hook1 GATGAATGA GATGA 4: 95,901,549 (GRCm39) 503 probably null Het
Ift20 G A 11: 78,430,860 (GRCm39) E68K probably damaging Het
Ints13 A G 6: 146,477,929 (GRCm39) S7P probably damaging Het
Kat5 T A 19: 5,655,713 (GRCm39) probably null Het
Kcnma1 A C 14: 23,364,288 (GRCm39) L988R probably damaging Het
Kcnq3 C A 15: 65,877,827 (GRCm39) probably benign Het
Kctd16 A G 18: 40,392,231 (GRCm39) E273G possibly damaging Het
Krt82 T A 15: 101,453,591 (GRCm39) Q265L probably damaging Het
Lama2 A T 10: 26,930,690 (GRCm39) probably null Het
Laptm4b G T 15: 34,238,478 (GRCm39) M3I probably benign Het
Lmtk2 A G 5: 144,084,433 (GRCm39) Y156C probably damaging Het
Lrrc58 G A 16: 37,701,771 (GRCm39) E350K probably damaging Het
Lrrk1 A T 7: 65,980,498 (GRCm39) D227E probably damaging Het
Macf1 C T 4: 123,248,895 (GRCm39) C7210Y probably damaging Het
Madd A G 2: 90,982,854 (GRCm39) I1363T possibly damaging Het
Mcm3 A G 1: 20,883,334 (GRCm39) V295A probably benign Het
Mki67 A G 7: 135,297,321 (GRCm39) I2571T possibly damaging Het
Mtrr C T 13: 68,717,059 (GRCm39) A385T possibly damaging Het
Myh7b A G 2: 155,462,043 (GRCm39) Y313C probably damaging Het
Myot A T 18: 44,487,192 (GRCm39) H343L possibly damaging Het
Myt1 C A 2: 181,467,772 (GRCm39) Q1069K probably damaging Het
Nid1 T A 13: 13,674,253 (GRCm39) D877E probably damaging Het
Nle1 A G 11: 82,796,394 (GRCm39) V159A probably damaging Het
Nmbr C A 10: 14,646,186 (GRCm39) Y353* probably null Het
Nos1ap T A 1: 170,156,735 (GRCm39) D241V probably damaging Het
Nostrin A C 2: 68,996,347 (GRCm39) Y209S probably damaging Het
Or14j4 T G 17: 37,921,362 (GRCm39) E93D probably benign Het
Or1e19 A T 11: 73,316,707 (GRCm39) M34K probably damaging Het
Or4a68 C T 2: 89,269,927 (GRCm39) R232H probably benign Het
Or5d40 A T 2: 88,015,439 (GRCm39) S73C probably benign Het
Or8h9 A T 2: 86,789,625 (GRCm39) M59K probably damaging Het
Or8s2 G A 15: 98,276,277 (GRCm39) T238I possibly damaging Het
Pcdh7 T A 5: 58,286,338 (GRCm39) V1138E probably damaging Het
Pglyrp3 T G 3: 91,933,874 (GRCm39) V173G probably benign Het
Plec T C 15: 76,067,374 (GRCm39) T1331A probably benign Het
Plxnb2 T C 15: 89,040,765 (GRCm39) D1787G probably benign Het
Pms1 T A 1: 53,321,147 (GRCm39) I29F probably damaging Het
Ptprt G A 2: 161,653,908 (GRCm39) T574I probably damaging Het
R3hdm1 A G 1: 128,118,430 (GRCm39) Y561C probably damaging Het
Rab17 A G 1: 90,887,800 (GRCm39) F120S probably benign Het
Rab7b T A 1: 131,626,157 (GRCm39) W62R probably damaging Het
Ryr2 C T 13: 11,575,493 (GRCm39) G4835E probably damaging Het
Ryr3 A G 2: 112,705,493 (GRCm39) V807A probably benign Het
Septin4 A T 11: 87,474,262 (GRCm39) Q60L probably benign Het
Slc23a1 C T 18: 35,759,487 (GRCm39) R26Q unknown Het
Slc7a4 C A 16: 17,392,408 (GRCm39) R342L possibly damaging Het
Slfn9 C T 11: 82,875,481 (GRCm39) C367Y possibly damaging Het
Tasor C T 14: 27,201,992 (GRCm39) T1462I probably damaging Het
Tiam1 A G 16: 89,646,533 (GRCm39) probably benign Het
Tiparp C A 3: 65,436,673 (GRCm39) probably benign Het
Tmem39b T C 4: 129,572,481 (GRCm39) T374A probably benign Het
Trim5 G A 7: 103,925,998 (GRCm39) R188* probably null Het
Ttn C T 2: 76,643,683 (GRCm39) G11436R probably damaging Het
Ubr4 C T 4: 139,204,518 (GRCm39) T4810M probably damaging Het
Vmn2r26 A T 6: 124,038,196 (GRCm39) E590D probably benign Het
Wwc1 A G 11: 35,761,355 (GRCm39) F650S probably benign Het
Xrcc6 T A 15: 81,907,178 (GRCm39) F167I probably damaging Het
Zfp1005 A T 2: 150,111,281 (GRCm39) H657L probably benign Het
Other mutations in Slitrk6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00517:Slitrk6 APN 14 110,988,547 (GRCm39) missense probably benign 0.35
IGL01131:Slitrk6 APN 14 110,989,008 (GRCm39) missense probably damaging 1.00
IGL01294:Slitrk6 APN 14 110,987,506 (GRCm39) missense probably benign
IGL01295:Slitrk6 APN 14 110,988,868 (GRCm39) missense possibly damaging 0.50
IGL01762:Slitrk6 APN 14 110,989,056 (GRCm39) missense probably damaging 1.00
IGL02165:Slitrk6 APN 14 110,989,249 (GRCm39) missense probably benign 0.41
IGL02546:Slitrk6 APN 14 110,987,226 (GRCm39) missense probably benign 0.18
IGL03103:Slitrk6 APN 14 110,987,373 (GRCm39) missense probably benign
PIT1430001:Slitrk6 UTSW 14 110,987,859 (GRCm39) missense possibly damaging 0.93
PIT4480001:Slitrk6 UTSW 14 110,987,257 (GRCm39) frame shift probably null
R0035:Slitrk6 UTSW 14 110,987,364 (GRCm39) missense probably damaging 1.00
R0066:Slitrk6 UTSW 14 110,987,364 (GRCm39) missense probably damaging 1.00
R0067:Slitrk6 UTSW 14 110,987,364 (GRCm39) missense probably damaging 1.00
R0069:Slitrk6 UTSW 14 110,987,364 (GRCm39) missense probably damaging 1.00
R0107:Slitrk6 UTSW 14 110,989,395 (GRCm39) missense possibly damaging 0.69
R0157:Slitrk6 UTSW 14 110,987,364 (GRCm39) missense probably damaging 1.00
R0422:Slitrk6 UTSW 14 110,989,725 (GRCm39) start gained probably benign
R0422:Slitrk6 UTSW 14 110,987,364 (GRCm39) missense probably damaging 1.00
R0454:Slitrk6 UTSW 14 110,987,364 (GRCm39) missense probably damaging 1.00
R0505:Slitrk6 UTSW 14 110,987,364 (GRCm39) missense probably damaging 1.00
R0633:Slitrk6 UTSW 14 110,989,317 (GRCm39) missense probably damaging 1.00
R0711:Slitrk6 UTSW 14 110,987,251 (GRCm39) missense probably damaging 1.00
R0843:Slitrk6 UTSW 14 110,987,530 (GRCm39) missense probably benign
R1298:Slitrk6 UTSW 14 110,989,297 (GRCm39) missense possibly damaging 0.94
R1693:Slitrk6 UTSW 14 110,988,360 (GRCm39) missense probably damaging 1.00
R1756:Slitrk6 UTSW 14 110,987,984 (GRCm39) missense probably benign
R1998:Slitrk6 UTSW 14 110,989,255 (GRCm39) missense probably damaging 0.99
R2049:Slitrk6 UTSW 14 110,988,226 (GRCm39) missense probably benign 0.00
R2142:Slitrk6 UTSW 14 110,988,226 (GRCm39) missense probably benign 0.00
R2314:Slitrk6 UTSW 14 110,989,387 (GRCm39) missense probably damaging 1.00
R2566:Slitrk6 UTSW 14 110,987,704 (GRCm39) missense probably benign 0.00
R4231:Slitrk6 UTSW 14 110,988,820 (GRCm39) missense probably benign 0.02
R4236:Slitrk6 UTSW 14 110,987,580 (GRCm39) missense probably benign 0.07
R4247:Slitrk6 UTSW 14 110,988,171 (GRCm39) missense probably damaging 1.00
R4576:Slitrk6 UTSW 14 110,987,602 (GRCm39) missense probably benign 0.05
R4856:Slitrk6 UTSW 14 110,989,315 (GRCm39) missense probably damaging 1.00
R4858:Slitrk6 UTSW 14 110,989,315 (GRCm39) missense probably damaging 1.00
R4859:Slitrk6 UTSW 14 110,989,315 (GRCm39) missense probably damaging 1.00
R4860:Slitrk6 UTSW 14 110,989,315 (GRCm39) missense probably damaging 1.00
R4860:Slitrk6 UTSW 14 110,989,315 (GRCm39) missense probably damaging 1.00
R4886:Slitrk6 UTSW 14 110,989,315 (GRCm39) missense probably damaging 1.00
R4931:Slitrk6 UTSW 14 110,987,811 (GRCm39) missense probably damaging 1.00
R5255:Slitrk6 UTSW 14 110,987,185 (GRCm39) makesense probably null
R5281:Slitrk6 UTSW 14 110,987,805 (GRCm39) missense probably damaging 1.00
R5450:Slitrk6 UTSW 14 110,987,529 (GRCm39) missense probably benign
R5579:Slitrk6 UTSW 14 110,988,649 (GRCm39) missense possibly damaging 0.82
R5689:Slitrk6 UTSW 14 110,989,558 (GRCm39) missense probably benign
R5935:Slitrk6 UTSW 14 110,987,305 (GRCm39) missense probably benign 0.00
R6016:Slitrk6 UTSW 14 110,987,958 (GRCm39) missense probably benign 0.00
R6312:Slitrk6 UTSW 14 110,987,679 (GRCm39) missense probably benign 0.00
R6890:Slitrk6 UTSW 14 110,988,528 (GRCm39) nonsense probably null
R6952:Slitrk6 UTSW 14 110,987,974 (GRCm39) missense probably benign
R7378:Slitrk6 UTSW 14 110,987,295 (GRCm39) missense probably damaging 1.00
R8354:Slitrk6 UTSW 14 110,989,478 (GRCm39) missense probably damaging 1.00
R8401:Slitrk6 UTSW 14 110,989,453 (GRCm39) missense possibly damaging 0.67
R8454:Slitrk6 UTSW 14 110,989,478 (GRCm39) missense probably damaging 1.00
R8807:Slitrk6 UTSW 14 110,988,123 (GRCm39) missense possibly damaging 0.77
R8814:Slitrk6 UTSW 14 110,987,370 (GRCm39) missense probably benign
R8826:Slitrk6 UTSW 14 110,988,801 (GRCm39) missense probably benign
R9681:Slitrk6 UTSW 14 110,988,258 (GRCm39) missense probably damaging 1.00
R9740:Slitrk6 UTSW 14 110,987,444 (GRCm39) missense probably benign 0.13
R9740:Slitrk6 UTSW 14 110,987,430 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGAAGATCACTGTTGAGGGC -3'
(R):5'- ATGTTCCTTGGTCTCCACAG -3'

Sequencing Primer
(F):5'- TTCTTGTCAAGATGCCCTGG -3'
(R):5'- TGGTCTCCACAGTCTCGAG -3'
Posted On 2014-10-01