Incidental Mutation 'R2140:Plxnb2'
ID236167
Institutional Source Beutler Lab
Gene Symbol Plxnb2
Ensembl Gene ENSMUSG00000036606
Gene Nameplexin B2
SynonymsDebt, 1110007H23Rik
MMRRC Submission 040143-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.952) question?
Stock #R2140 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location89155549-89180788 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 89156562 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 1787 (D1787G)
Ref Sequence ENSEMBL: ENSMUSP00000104955 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060808] [ENSMUST00000109331]
Predicted Effect probably benign
Transcript: ENSMUST00000060808
AA Change: D1787G

PolyPhen 2 Score 0.043 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000051731
Gene: ENSMUSG00000036606
AA Change: D1787G

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Sema 34 452 8.87e-92 SMART
PSI 470 521 1.94e-10 SMART
PSI 616 669 4.09e-1 SMART
PSI 761 804 7.02e-8 SMART
IPT 805 896 8.14e-19 SMART
IPT 897 983 1.1e-15 SMART
IPT 985 1096 5.06e-6 SMART
Pfam:Plexin_cytopl 1275 1809 1.6e-225 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000109331
AA Change: D1787G

PolyPhen 2 Score 0.043 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000104955
Gene: ENSMUSG00000036606
AA Change: D1787G

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Sema 34 452 8.87e-92 SMART
PSI 470 521 1.94e-10 SMART
PSI 616 669 4.09e-1 SMART
PSI 761 804 7.02e-8 SMART
IPT 805 896 8.14e-19 SMART
IPT 897 983 1.1e-15 SMART
IPT 985 1096 5.06e-6 SMART
Pfam:Plexin_cytopl 1274 1809 4.4e-251 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139372
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143014
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151418
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229966
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230393
Meta Mutation Damage Score 0.1227 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency 100% (96/96)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Members of the B class of plexins, such as PLXNB2 are transmembrane receptors that participate in axon guidance and cell migration in response to semaphorins (Perrot et al. (2002) [PubMed 12183458]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Homozygotes for a targeted mutation of this gene die perinatally of exencephaly or survive and seem normal despite severe abnormalities in cerebellar layering and foliation; the external granule cell layer is disorganized due to continued proliferation and migration of differentiated granule cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 96 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610042L04Rik T C 14: 4,348,902 I21T probably damaging Het
9230110C19Rik T C 9: 8,022,477 D248G probably damaging Het
Adgrf1 A C 17: 43,300,802 E186D probably damaging Het
Adgrf4 C T 17: 42,666,898 R518Q possibly damaging Het
Afdn A G 17: 13,810,433 E202G probably damaging Het
Agfg2 T A 5: 137,667,116 R126W probably damaging Het
Alkbh2 C T 5: 114,125,716 V77I probably benign Het
Alppl2 A G 1: 87,087,697 S381P probably benign Het
Aqp2 A G 15: 99,579,366 T72A probably damaging Het
Atp9b A G 18: 80,736,087 C1123R probably damaging Het
AU016765 T A 17: 64,520,000 noncoding transcript Het
Bscl2 T C 19: 8,845,320 probably null Het
Ccdc80 A T 16: 45,127,446 Y929F probably damaging Het
Cenpj T C 14: 56,526,932 D1341G probably damaging Het
Cir1 A T 2: 73,312,437 S18T probably damaging Het
Clcn6 A G 4: 148,024,137 F145S possibly damaging Het
Cnksr1 A G 4: 134,229,628 Y488H probably damaging Het
Cntrl CAGAG CAG 2: 35,122,806 probably null Het
Crb1 T C 1: 139,237,012 I1125V probably benign Het
Cyp3a13 A T 5: 137,921,454 V20D possibly damaging Het
Dars T A 1: 128,372,162 M362L probably benign Het
Dck T C 5: 88,772,723 C101R probably damaging Het
Dnah11 T C 12: 118,008,810 T2880A probably benign Het
Dnah7b T A 1: 46,268,670 M3048K probably damaging Het
Eef1a2 C T 2: 181,148,742 E374K probably benign Het
Eif3a A T 19: 60,775,394 probably benign Het
Esco1 A G 18: 10,574,873 probably null Het
Exoc8 C T 8: 124,897,415 R71Q possibly damaging Het
Fam208a C T 14: 27,480,035 T1462I probably damaging Het
Far1 G A 7: 113,566,460 V445M possibly damaging Het
Fbn1 C A 2: 125,343,810 C1648F probably damaging Het
Fmn1 A G 2: 113,595,048 K1189R probably benign Het
Foxl2 C A 9: 98,956,487 P276H unknown Het
Fpr3 T A 17: 17,970,617 V50E probably damaging Het
Garem1 T A 18: 21,129,374 R794S probably damaging Het
Gemin4 G C 11: 76,211,050 P962A probably damaging Het
Glyatl3 T C 17: 40,911,084 D93G probably benign Het
Gm14124 A T 2: 150,269,361 H657L probably benign Het
Gm4787 A G 12: 81,378,562 I274T probably benign Het
Gucy1a1 C T 3: 82,118,886 probably null Het
Hook1 GATGAATGA GATGA 4: 96,013,312 probably null Het
Ift20 G A 11: 78,540,034 E68K probably damaging Het
Ints13 A G 6: 146,576,431 S7P probably damaging Het
Kat5 T A 19: 5,605,685 probably null Het
Kcnma1 A C 14: 23,314,220 L988R probably damaging Het
Kcnq3 C A 15: 66,005,978 probably benign Het
Kctd16 A G 18: 40,259,178 E273G possibly damaging Het
Krt82 T A 15: 101,545,156 Q265L probably damaging Het
Lama2 A T 10: 27,054,694 probably null Het
Laptm4b G T 15: 34,238,332 M3I probably benign Het
Lmtk2 A G 5: 144,147,615 Y156C probably damaging Het
Lrrc58 G A 16: 37,881,409 E350K probably damaging Het
Lrrk1 A T 7: 66,330,750 D227E probably damaging Het
Macf1 C T 4: 123,355,102 C7210Y probably damaging Het
Madd A G 2: 91,152,509 I1363T possibly damaging Het
Mcm3 A G 1: 20,813,110 V295A probably benign Het
Mki67 A G 7: 135,695,592 I2571T possibly damaging Het
Mtrr C T 13: 68,568,940 A385T possibly damaging Het
Myh7b A G 2: 155,620,123 Y313C probably damaging Het
Myot A T 18: 44,354,125 H343L possibly damaging Het
Myt1 C A 2: 181,825,979 Q1069K probably damaging Het
Nid1 T A 13: 13,499,668 D877E probably damaging Het
Nle1 A G 11: 82,905,568 V159A probably damaging Het
Nmbr C A 10: 14,770,442 Y353* probably null Het
Nos1ap T A 1: 170,329,166 D241V probably damaging Het
Nostrin A C 2: 69,166,003 Y209S probably damaging Het
Olfr1099 A T 2: 86,959,281 M59K probably damaging Het
Olfr115 T G 17: 37,610,471 E93D probably benign Het
Olfr1168 A T 2: 88,185,095 S73C probably benign Het
Olfr1240 C T 2: 89,439,583 R232H probably benign Het
Olfr283 G A 15: 98,378,396 T238I possibly damaging Het
Olfr378 A T 11: 73,425,881 M34K probably damaging Het
Pcdh7 T A 5: 58,128,996 V1138E probably damaging Het
Pglyrp3 T G 3: 92,026,567 V173G probably benign Het
Plec T C 15: 76,183,174 T1331A probably benign Het
Pms1 T A 1: 53,281,988 I29F probably damaging Het
Ptprt G A 2: 161,811,988 T574I probably damaging Het
R3hdm1 A G 1: 128,190,693 Y561C probably damaging Het
Rab17 A G 1: 90,960,078 F120S probably benign Het
Rab7b T A 1: 131,698,419 W62R probably damaging Het
Ryr2 C T 13: 11,560,607 G4835E probably damaging Het
Ryr3 A G 2: 112,875,148 V807A probably benign Het
Sept4 A T 11: 87,583,436 Q60L probably benign Het
Slc23a1 C T 18: 35,626,434 R26Q unknown Het
Slc7a4 C A 16: 17,574,544 R342L possibly damaging Het
Slfn9 C T 11: 82,984,655 C367Y possibly damaging Het
Slitrk6 T G 14: 110,750,794 T494P probably benign Het
Tiam1 A G 16: 89,849,645 probably benign Het
Tiparp C A 3: 65,529,252 probably benign Het
Tmem39b T C 4: 129,678,688 T374A probably benign Het
Trim5 G A 7: 104,276,791 R188* probably null Het
Ttn C T 2: 76,813,339 G11436R probably damaging Het
Ubr4 C T 4: 139,477,207 T4810M probably damaging Het
Vmn2r26 A T 6: 124,061,237 E590D probably benign Het
Wwc1 A G 11: 35,870,528 F650S probably benign Het
Xrcc6 T A 15: 82,022,977 F167I probably damaging Het
Other mutations in Plxnb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00546:Plxnb2 APN 15 89162366 splice site probably benign
IGL01574:Plxnb2 APN 15 89162683 splice site probably null
IGL01695:Plxnb2 APN 15 89157214 missense possibly damaging 0.96
IGL01763:Plxnb2 APN 15 89161981 splice site probably null
IGL01921:Plxnb2 APN 15 89164271 missense possibly damaging 0.78
IGL02129:Plxnb2 APN 15 89160410 missense probably benign 0.04
IGL02153:Plxnb2 APN 15 89165813 nonsense probably null
IGL02637:Plxnb2 APN 15 89164057 missense possibly damaging 0.53
IGL02892:Plxnb2 APN 15 89161222 critical splice donor site probably null
IGL03108:Plxnb2 APN 15 89158031 missense probably benign 0.32
IGL03115:Plxnb2 APN 15 89162438 splice site probably benign
P0040:Plxnb2 UTSW 15 89162935 missense probably damaging 1.00
R0022:Plxnb2 UTSW 15 89163276 critical splice donor site probably null
R0095:Plxnb2 UTSW 15 89165331 missense probably benign
R0103:Plxnb2 UTSW 15 89161769 missense possibly damaging 0.85
R0544:Plxnb2 UTSW 15 89158613 splice site probably benign
R0671:Plxnb2 UTSW 15 89157981 missense probably benign 0.14
R1279:Plxnb2 UTSW 15 89162321 missense probably benign 0.02
R1530:Plxnb2 UTSW 15 89167192 missense probably benign
R1542:Plxnb2 UTSW 15 89165921 missense probably damaging 1.00
R1610:Plxnb2 UTSW 15 89158493 missense probably damaging 1.00
R1686:Plxnb2 UTSW 15 89162462 missense probably damaging 1.00
R1702:Plxnb2 UTSW 15 89161984 critical splice donor site probably null
R1996:Plxnb2 UTSW 15 89158768 missense probably benign 0.13
R1997:Plxnb2 UTSW 15 89158768 missense probably benign 0.13
R2031:Plxnb2 UTSW 15 89162810 nonsense probably null
R2049:Plxnb2 UTSW 15 89159002 missense probably damaging 1.00
R2072:Plxnb2 UTSW 15 89158451 missense probably damaging 1.00
R2076:Plxnb2 UTSW 15 89158026 missense probably damaging 1.00
R2418:Plxnb2 UTSW 15 89161069 missense possibly damaging 0.72
R2419:Plxnb2 UTSW 15 89161069 missense possibly damaging 0.72
R3752:Plxnb2 UTSW 15 89157255 splice site probably benign
R3825:Plxnb2 UTSW 15 89166399 missense probably benign 0.05
R4154:Plxnb2 UTSW 15 89159642 missense probably damaging 0.98
R4197:Plxnb2 UTSW 15 89157018 missense probably damaging 1.00
R4385:Plxnb2 UTSW 15 89160623 missense probably damaging 0.96
R4434:Plxnb2 UTSW 15 89162803 missense probably damaging 1.00
R4678:Plxnb2 UTSW 15 89160928 missense probably benign 0.37
R4717:Plxnb2 UTSW 15 89157419 nonsense probably null
R4773:Plxnb2 UTSW 15 89166947 missense probably benign 0.06
R4905:Plxnb2 UTSW 15 89157411 missense probably damaging 1.00
R5368:Plxnb2 UTSW 15 89159593 missense possibly damaging 0.94
R5418:Plxnb2 UTSW 15 89166491 missense probably benign 0.00
R5484:Plxnb2 UTSW 15 89164209 splice site probably null
R5520:Plxnb2 UTSW 15 89167543 missense possibly damaging 0.65
R5566:Plxnb2 UTSW 15 89164020 missense probably benign 0.05
R5568:Plxnb2 UTSW 15 89157435 missense probably damaging 1.00
R5619:Plxnb2 UTSW 15 89162809 missense possibly damaging 0.92
R5685:Plxnb2 UTSW 15 89167032 missense probably damaging 1.00
R5688:Plxnb2 UTSW 15 89158696 missense probably damaging 1.00
R5809:Plxnb2 UTSW 15 89167571 missense possibly damaging 0.61
R5813:Plxnb2 UTSW 15 89160759 missense possibly damaging 0.81
R5866:Plxnb2 UTSW 15 89167572 missense probably damaging 1.00
R6016:Plxnb2 UTSW 15 89161022 missense possibly damaging 0.55
R6117:Plxnb2 UTSW 15 89158000 missense probably benign 0.04
R6187:Plxnb2 UTSW 15 89167258 missense probably damaging 1.00
R6260:Plxnb2 UTSW 15 89165291 missense probably benign 0.22
R6263:Plxnb2 UTSW 15 89161986 missense probably damaging 0.99
R6269:Plxnb2 UTSW 15 89160713 missense probably benign 0.18
R6351:Plxnb2 UTSW 15 89157770 missense possibly damaging 0.95
R6522:Plxnb2 UTSW 15 89164426 missense probably benign 0.18
R6856:Plxnb2 UTSW 15 89164320 missense probably benign 0.27
R6930:Plxnb2 UTSW 15 89160389 missense probably benign
R7354:Plxnb2 UTSW 15 89165725 missense possibly damaging 0.92
R7513:Plxnb2 UTSW 15 89158322 critical splice acceptor site probably null
R7522:Plxnb2 UTSW 15 89161774 missense probably benign 0.20
R7730:Plxnb2 UTSW 15 89162330 missense probably benign
R7766:Plxnb2 UTSW 15 89161271 missense probably benign 0.01
R7781:Plxnb2 UTSW 15 89157022 missense possibly damaging 0.89
R8126:Plxnb2 UTSW 15 89163303 missense probably benign
R8131:Plxnb2 UTSW 15 89158713 missense probably damaging 1.00
R8372:Plxnb2 UTSW 15 89158493 missense probably damaging 1.00
R8736:Plxnb2 UTSW 15 89162058 missense probably damaging 1.00
R8772:Plxnb2 UTSW 15 89162746 missense probably damaging 1.00
X0027:Plxnb2 UTSW 15 89160713 missense probably benign 0.18
Z1177:Plxnb2 UTSW 15 89159096 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTCCTCCAGAGCATTGATGATC -3'
(R):5'- ACTGAGGTGCTTAGAACCCTG -3'

Sequencing Primer
(F):5'- AGCATTGATGATCTGGTGGG -3'
(R):5'- TGCTTAGAACCCTGGTGCC -3'
Posted On2014-10-01