Incidental Mutation 'R2140:Adgrf1'
ID 236182
Institutional Source Beutler Lab
Gene Symbol Adgrf1
Ensembl Gene ENSMUSG00000041293
Gene Name adhesion G protein-coupled receptor F1
Synonyms Gpr110, 5031409J19Rik
MMRRC Submission 040143-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R2140 (G1)
Quality Score 225
Status Validated
Chromosome 17
Chromosomal Location 43270329-43324737 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to C at 43300802 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Aspartic acid at position 186 (E186D)
Ref Sequence ENSEMBL: ENSMUSP00000049380 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047399]
AlphaFold Q8VEC3
Predicted Effect probably damaging
Transcript: ENSMUST00000047399
AA Change: E186D

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000049380
Gene: ENSMUSG00000041293
AA Change: E186D

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
low complexity region 59 83 N/A INTRINSIC
Pfam:SEA 150 238 3.7e-10 PFAM
low complexity region 341 363 N/A INTRINSIC
GPS 528 576 5.56e-15 SMART
Pfam:7tm_2 580 832 2.1e-38 PFAM
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency 100% (96/96)
MGI Phenotype PHENOTYPE: Mice homozygous for a reporter allele exhibit normal viability and fertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 96 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610042L04Rik T C 14: 4,348,902 I21T probably damaging Het
9230110C19Rik T C 9: 8,022,477 D248G probably damaging Het
Adgrf4 C T 17: 42,666,898 R518Q possibly damaging Het
Afdn A G 17: 13,810,433 E202G probably damaging Het
Agfg2 T A 5: 137,667,116 R126W probably damaging Het
Alkbh2 C T 5: 114,125,716 V77I probably benign Het
Alppl2 A G 1: 87,087,697 S381P probably benign Het
Aqp2 A G 15: 99,579,366 T72A probably damaging Het
Atp9b A G 18: 80,736,087 C1123R probably damaging Het
AU016765 T A 17: 64,520,000 noncoding transcript Het
Bscl2 T C 19: 8,845,320 probably null Het
Ccdc80 A T 16: 45,127,446 Y929F probably damaging Het
Cenpj T C 14: 56,526,932 D1341G probably damaging Het
Cir1 A T 2: 73,312,437 S18T probably damaging Het
Clcn6 A G 4: 148,024,137 F145S possibly damaging Het
Cnksr1 A G 4: 134,229,628 Y488H probably damaging Het
Cntrl CAGAG CAG 2: 35,122,806 probably null Het
Crb1 T C 1: 139,237,012 I1125V probably benign Het
Cyp3a13 A T 5: 137,921,454 V20D possibly damaging Het
Dars T A 1: 128,372,162 M362L probably benign Het
Dck T C 5: 88,772,723 C101R probably damaging Het
Dnah11 T C 12: 118,008,810 T2880A probably benign Het
Dnah7b T A 1: 46,268,670 M3048K probably damaging Het
Eef1a2 C T 2: 181,148,742 E374K probably benign Het
Eif3a A T 19: 60,775,394 probably benign Het
Esco1 A G 18: 10,574,873 probably null Het
Exoc8 C T 8: 124,897,415 R71Q possibly damaging Het
Fam208a C T 14: 27,480,035 T1462I probably damaging Het
Far1 G A 7: 113,566,460 V445M possibly damaging Het
Fbn1 C A 2: 125,343,810 C1648F probably damaging Het
Fmn1 A G 2: 113,595,048 K1189R probably benign Het
Foxl2 C A 9: 98,956,487 P276H unknown Het
Fpr3 T A 17: 17,970,617 V50E probably damaging Het
Garem1 T A 18: 21,129,374 R794S probably damaging Het
Gemin4 G C 11: 76,211,050 P962A probably damaging Het
Glyatl3 T C 17: 40,911,084 D93G probably benign Het
Gm14124 A T 2: 150,269,361 H657L probably benign Het
Gm4787 A G 12: 81,378,562 I274T probably benign Het
Gucy1a1 C T 3: 82,118,886 probably null Het
Hook1 GATGAATGA GATGA 4: 96,013,312 503 probably null Het
Ift20 G A 11: 78,540,034 E68K probably damaging Het
Ints13 A G 6: 146,576,431 S7P probably damaging Het
Kat5 T A 19: 5,605,685 probably null Het
Kcnma1 A C 14: 23,314,220 L988R probably damaging Het
Kcnq3 C A 15: 66,005,978 probably benign Het
Kctd16 A G 18: 40,259,178 E273G possibly damaging Het
Krt82 T A 15: 101,545,156 Q265L probably damaging Het
Lama2 A T 10: 27,054,694 probably null Het
Laptm4b G T 15: 34,238,332 M3I probably benign Het
Lmtk2 A G 5: 144,147,615 Y156C probably damaging Het
Lrrc58 G A 16: 37,881,409 E350K probably damaging Het
Lrrk1 A T 7: 66,330,750 D227E probably damaging Het
Macf1 C T 4: 123,355,102 C7210Y probably damaging Het
Madd A G 2: 91,152,509 I1363T possibly damaging Het
Mcm3 A G 1: 20,813,110 V295A probably benign Het
Mki67 A G 7: 135,695,592 I2571T possibly damaging Het
Mtrr C T 13: 68,568,940 A385T possibly damaging Het
Myh7b A G 2: 155,620,123 Y313C probably damaging Het
Myot A T 18: 44,354,125 H343L possibly damaging Het
Myt1 C A 2: 181,825,979 Q1069K probably damaging Het
Nid1 T A 13: 13,499,668 D877E probably damaging Het
Nle1 A G 11: 82,905,568 V159A probably damaging Het
Nmbr C A 10: 14,770,442 Y353* probably null Het
Nos1ap T A 1: 170,329,166 D241V probably damaging Het
Nostrin A C 2: 69,166,003 Y209S probably damaging Het
Olfr1099 A T 2: 86,959,281 M59K probably damaging Het
Olfr115 T G 17: 37,610,471 E93D probably benign Het
Olfr1168 A T 2: 88,185,095 S73C probably benign Het
Olfr1240 C T 2: 89,439,583 R232H probably benign Het
Olfr283 G A 15: 98,378,396 T238I possibly damaging Het
Olfr378 A T 11: 73,425,881 M34K probably damaging Het
Pcdh7 T A 5: 58,128,996 V1138E probably damaging Het
Pglyrp3 T G 3: 92,026,567 V173G probably benign Het
Plec T C 15: 76,183,174 T1331A probably benign Het
Plxnb2 T C 15: 89,156,562 D1787G probably benign Het
Pms1 T A 1: 53,281,988 I29F probably damaging Het
Ptprt G A 2: 161,811,988 T574I probably damaging Het
R3hdm1 A G 1: 128,190,693 Y561C probably damaging Het
Rab17 A G 1: 90,960,078 F120S probably benign Het
Rab7b T A 1: 131,698,419 W62R probably damaging Het
Ryr2 C T 13: 11,560,607 G4835E probably damaging Het
Ryr3 A G 2: 112,875,148 V807A probably benign Het
Sept4 A T 11: 87,583,436 Q60L probably benign Het
Slc23a1 C T 18: 35,626,434 R26Q unknown Het
Slc7a4 C A 16: 17,574,544 R342L possibly damaging Het
Slfn9 C T 11: 82,984,655 C367Y possibly damaging Het
Slitrk6 T G 14: 110,750,794 T494P probably benign Het
Tiam1 A G 16: 89,849,645 probably benign Het
Tiparp C A 3: 65,529,252 probably benign Het
Tmem39b T C 4: 129,678,688 T374A probably benign Het
Trim5 G A 7: 104,276,791 R188* probably null Het
Ttn C T 2: 76,813,339 G11436R probably damaging Het
Ubr4 C T 4: 139,477,207 T4810M probably damaging Het
Vmn2r26 A T 6: 124,061,237 E590D probably benign Het
Wwc1 A G 11: 35,870,528 F650S probably benign Het
Xrcc6 T A 15: 82,022,977 F167I probably damaging Het
Other mutations in Adgrf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01343:Adgrf1 APN 17 43313195 missense probably null 0.92
IGL01359:Adgrf1 APN 17 43310686 missense probably damaging 0.99
IGL02131:Adgrf1 APN 17 43303747 missense probably damaging 0.99
IGL02692:Adgrf1 APN 17 43303778 missense probably damaging 1.00
IGL02891:Adgrf1 APN 17 43311161 missense probably damaging 0.96
IGL03027:Adgrf1 APN 17 43296714 missense probably damaging 1.00
IGL03296:Adgrf1 APN 17 43321153 splice site probably benign
R0211:Adgrf1 UTSW 17 43296690 missense probably damaging 1.00
R0211:Adgrf1 UTSW 17 43296690 missense probably damaging 1.00
R0389:Adgrf1 UTSW 17 43303788 critical splice donor site probably null
R0488:Adgrf1 UTSW 17 43310411 missense probably damaging 0.99
R1591:Adgrf1 UTSW 17 43310981 missense probably damaging 1.00
R1817:Adgrf1 UTSW 17 43310033 missense probably benign 0.01
R1819:Adgrf1 UTSW 17 43310033 missense probably benign 0.01
R2009:Adgrf1 UTSW 17 43321221 nonsense probably null
R2032:Adgrf1 UTSW 17 43311275 missense probably damaging 1.00
R3953:Adgrf1 UTSW 17 43310207 missense probably benign 0.08
R4679:Adgrf1 UTSW 17 43310493 missense probably damaging 1.00
R4775:Adgrf1 UTSW 17 43311163 missense probably damaging 1.00
R4858:Adgrf1 UTSW 17 43303672 missense probably damaging 1.00
R4894:Adgrf1 UTSW 17 43299084 nonsense probably null
R4895:Adgrf1 UTSW 17 43310620 missense probably benign 0.33
R4935:Adgrf1 UTSW 17 43295239 missense probably benign 0.00
R5027:Adgrf1 UTSW 17 43303747 missense probably damaging 0.99
R5373:Adgrf1 UTSW 17 43291005 start gained probably benign
R5374:Adgrf1 UTSW 17 43291005 start gained probably benign
R5455:Adgrf1 UTSW 17 43321143 splice site probably null
R5579:Adgrf1 UTSW 17 43311064 missense probably damaging 1.00
R5985:Adgrf1 UTSW 17 43293255 missense probably benign 0.00
R6038:Adgrf1 UTSW 17 43295209 missense probably benign 0.00
R6038:Adgrf1 UTSW 17 43295209 missense probably benign 0.00
R6160:Adgrf1 UTSW 17 43310687 missense probably damaging 1.00
R6227:Adgrf1 UTSW 17 43310273 missense probably benign 0.05
R6500:Adgrf1 UTSW 17 43310372 missense probably damaging 1.00
R7066:Adgrf1 UTSW 17 43310260 missense probably benign 0.05
R7099:Adgrf1 UTSW 17 43310602 missense probably benign 0.00
R7561:Adgrf1 UTSW 17 43311109 missense possibly damaging 0.94
R8359:Adgrf1 UTSW 17 43310395 missense probably damaging 0.99
R8480:Adgrf1 UTSW 17 43295164 missense probably benign 0.08
R8543:Adgrf1 UTSW 17 43313206 missense probably null 0.99
R9023:Adgrf1 UTSW 17 43303760 missense possibly damaging 0.53
R9074:Adgrf1 UTSW 17 43290988 start gained probably benign
R9207:Adgrf1 UTSW 17 43310273 missense probably benign 0.05
R9232:Adgrf1 UTSW 17 43310404 missense probably benign 0.07
R9425:Adgrf1 UTSW 17 43310383 missense possibly damaging 0.84
R9526:Adgrf1 UTSW 17 43305346 missense possibly damaging 0.95
R9697:Adgrf1 UTSW 17 43314471 missense possibly damaging 0.71
R9711:Adgrf1 UTSW 17 43310689 missense possibly damaging 0.81
Z1177:Adgrf1 UTSW 17 43310147 missense probably benign 0.14
Predicted Primers PCR Primer
(F):5'- CTGGGGCTACAGATGCAC -3'
(R):5'- CAGACCTCATGCTTGCAAGG -3'

Sequencing Primer
(F):5'- TCATGGCCGTGACAATGAC -3'
(R):5'- CTCATGCTTGCAAGGTAGACACTG -3'
Posted On 2014-10-01