Mutagenetix > Incidental Mutation

Incidental Mutation 'R2140:Garem1'

236185

Institutional Source

Beutler Lab

Gene Symbol

Garem1

Ensembl Gene

ENSMUSG00000042680

Gene Name

GRB2 associated regulator of MAPK1 subtype 1

Synonyms

Garem, Fam59a, LOC381126

MMRRC Submission

040143-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.116) question?

Stock #

R2140 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

21127201-21300138 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 21129374 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Serine at position 794 (R794S)

Ref Sequence

ENSEMBL: ENSMUSP00000048914 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000049260]

AlphaFold

Q3UFT3

Predicted Effect

probably damaging
Transcript: ENSMUST00000049260
AA Change: R794S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000048914
Gene: ENSMUSG00000042680
AA Change: R794S

Domain	Start	End	E-Value	Type
Pfam:CABIT	32	318	3.4e-79	PFAM
low complexity region	484	499	N/A	INTRINSIC
low complexity region	512	518	N/A	INTRINSIC
PDB:2DKZ\|A	795	874	2e-40	PDB
Blast:SAM	808	875	2e-36	BLAST
SCOP:d1kw4a_	812	873	4e-4	SMART

Meta Mutation Damage Score

0.0870

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.1%
20x: 94.5%

Validation Efficiency

100% (96/96)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an adaptor protein which functions in the epidermal growth factor (EGF) receptor-mediated signaling pathway. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2011]

Allele List at MGI

Other mutations in this stock

Total: 96 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2610042L04Rik	T	C	14: 4,348,902	I21T	probably damaging	Het
9230110C19Rik	T	C	9: 8,022,477	D248G	probably damaging	Het
Adgrf1	A	C	17: 43,300,802	E186D	probably damaging	Het
Adgrf4	C	T	17: 42,666,898	R518Q	possibly damaging	Het
Afdn	A	G	17: 13,810,433	E202G	probably damaging	Het
Agfg2	T	A	5: 137,667,116	R126W	probably damaging	Het
Alkbh2	C	T	5: 114,125,716	V77I	probably benign	Het
Alppl2	A	G	1: 87,087,697	S381P	probably benign	Het
Aqp2	A	G	15: 99,579,366	T72A	probably damaging	Het
Atp9b	A	G	18: 80,736,087	C1123R	probably damaging	Het
AU016765	T	A	17: 64,520,000		noncoding transcript	Het
Bscl2	T	C	19: 8,845,320		probably null	Het
Ccdc80	A	T	16: 45,127,446	Y929F	probably damaging	Het
Cenpj	T	C	14: 56,526,932	D1341G	probably damaging	Het
Cir1	A	T	2: 73,312,437	S18T	probably damaging	Het
Clcn6	A	G	4: 148,024,137	F145S	possibly damaging	Het
Cnksr1	A	G	4: 134,229,628	Y488H	probably damaging	Het
Cntrl	CAGAG	CAG	2: 35,122,806		probably null	Het
Crb1	T	C	1: 139,237,012	I1125V	probably benign	Het
Cyp3a13	A	T	5: 137,921,454	V20D	possibly damaging	Het
Dars	T	A	1: 128,372,162	M362L	probably benign	Het
Dck	T	C	5: 88,772,723	C101R	probably damaging	Het
Dnah11	T	C	12: 118,008,810	T2880A	probably benign	Het
Dnah7b	T	A	1: 46,268,670	M3048K	probably damaging	Het
Eef1a2	C	T	2: 181,148,742	E374K	probably benign	Het
Eif3a	A	T	19: 60,775,394		probably benign	Het
Esco1	A	G	18: 10,574,873		probably null	Het
Exoc8	C	T	8: 124,897,415	R71Q	possibly damaging	Het
Fam208a	C	T	14: 27,480,035	T1462I	probably damaging	Het
Far1	G	A	7: 113,566,460	V445M	possibly damaging	Het
Fbn1	C	A	2: 125,343,810	C1648F	probably damaging	Het
Fmn1	A	G	2: 113,595,048	K1189R	probably benign	Het
Foxl2	C	A	9: 98,956,487	P276H	unknown	Het
Fpr3	T	A	17: 17,970,617	V50E	probably damaging	Het
Gemin4	G	C	11: 76,211,050	P962A	probably damaging	Het
Glyatl3	T	C	17: 40,911,084	D93G	probably benign	Het
Gm14124	A	T	2: 150,269,361	H657L	probably benign	Het
Gm4787	A	G	12: 81,378,562	I274T	probably benign	Het
Gucy1a1	C	T	3: 82,118,886		probably null	Het
Hook1	GATGAATGA	GATGA	4: 96,013,312	503	probably null	Het
Ift20	G	A	11: 78,540,034	E68K	probably damaging	Het
Ints13	A	G	6: 146,576,431	S7P	probably damaging	Het
Kat5	T	A	19: 5,605,685		probably null	Het
Kcnma1	A	C	14: 23,314,220	L988R	probably damaging	Het
Kcnq3	C	A	15: 66,005,978		probably benign	Het
Kctd16	A	G	18: 40,259,178	E273G	possibly damaging	Het
Krt82	T	A	15: 101,545,156	Q265L	probably damaging	Het
Lama2	A	T	10: 27,054,694		probably null	Het
Laptm4b	G	T	15: 34,238,332	M3I	probably benign	Het
Lmtk2	A	G	5: 144,147,615	Y156C	probably damaging	Het
Lrrc58	G	A	16: 37,881,409	E350K	probably damaging	Het
Lrrk1	A	T	7: 66,330,750	D227E	probably damaging	Het
Macf1	C	T	4: 123,355,102	C7210Y	probably damaging	Het
Madd	A	G	2: 91,152,509	I1363T	possibly damaging	Het
Mcm3	A	G	1: 20,813,110	V295A	probably benign	Het
Mki67	A	G	7: 135,695,592	I2571T	possibly damaging	Het
Mtrr	C	T	13: 68,568,940	A385T	possibly damaging	Het
Myh7b	A	G	2: 155,620,123	Y313C	probably damaging	Het
Myot	A	T	18: 44,354,125	H343L	possibly damaging	Het
Myt1	C	A	2: 181,825,979	Q1069K	probably damaging	Het
Nid1	T	A	13: 13,499,668	D877E	probably damaging	Het
Nle1	A	G	11: 82,905,568	V159A	probably damaging	Het
Nmbr	C	A	10: 14,770,442	Y353*	probably null	Het
Nos1ap	T	A	1: 170,329,166	D241V	probably damaging	Het
Nostrin	A	C	2: 69,166,003	Y209S	probably damaging	Het
Olfr1099	A	T	2: 86,959,281	M59K	probably damaging	Het
Olfr115	T	G	17: 37,610,471	E93D	probably benign	Het
Olfr1168	A	T	2: 88,185,095	S73C	probably benign	Het
Olfr1240	C	T	2: 89,439,583	R232H	probably benign	Het
Olfr283	G	A	15: 98,378,396	T238I	possibly damaging	Het
Olfr378	A	T	11: 73,425,881	M34K	probably damaging	Het
Pcdh7	T	A	5: 58,128,996	V1138E	probably damaging	Het
Pglyrp3	T	G	3: 92,026,567	V173G	probably benign	Het
Plec	T	C	15: 76,183,174	T1331A	probably benign	Het
Plxnb2	T	C	15: 89,156,562	D1787G	probably benign	Het
Pms1	T	A	1: 53,281,988	I29F	probably damaging	Het
Ptprt	G	A	2: 161,811,988	T574I	probably damaging	Het
R3hdm1	A	G	1: 128,190,693	Y561C	probably damaging	Het
Rab17	A	G	1: 90,960,078	F120S	probably benign	Het
Rab7b	T	A	1: 131,698,419	W62R	probably damaging	Het
Ryr2	C	T	13: 11,560,607	G4835E	probably damaging	Het
Ryr3	A	G	2: 112,875,148	V807A	probably benign	Het
Sept4	A	T	11: 87,583,436	Q60L	probably benign	Het
Slc23a1	C	T	18: 35,626,434	R26Q	unknown	Het
Slc7a4	C	A	16: 17,574,544	R342L	possibly damaging	Het
Slfn9	C	T	11: 82,984,655	C367Y	possibly damaging	Het
Slitrk6	T	G	14: 110,750,794	T494P	probably benign	Het
Tiam1	A	G	16: 89,849,645		probably benign	Het
Tiparp	C	A	3: 65,529,252		probably benign	Het
Tmem39b	T	C	4: 129,678,688	T374A	probably benign	Het
Trim5	G	A	7: 104,276,791	R188*	probably null	Het
Ttn	C	T	2: 76,813,339	G11436R	probably damaging	Het
Ubr4	C	T	4: 139,477,207	T4810M	probably damaging	Het
Vmn2r26	A	T	6: 124,061,237	E590D	probably benign	Het
Wwc1	A	G	11: 35,870,528	F650S	probably benign	Het
Xrcc6	T	A	15: 82,022,977	F167I	probably damaging	Het

Other mutations in Garem1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00504:Garem1	APN	18	21148657	missense	probably damaging	1.00
IGL01588:Garem1	APN	18	21129797	missense	probably damaging	0.99
IGL02171:Garem1	APN	18	21129241	missense	probably damaging	0.98
IGL02270:Garem1	APN	18	21148450	missense	probably damaging	1.00
IGL03149:Garem1	APN	18	21131466	missense	probably damaging	1.00
R0136:Garem1	UTSW	18	21129991	missense	probably damaging	0.96
R0285:Garem1	UTSW	18	21129612	missense	probably benign
R0361:Garem1	UTSW	18	21299744	nonsense	probably null
R1068:Garem1	UTSW	18	21168755	missense	probably benign	0.00
R1537:Garem1	UTSW	18	21168874	splice site	probably null
R1726:Garem1	UTSW	18	21148262	missense	probably damaging	0.99
R1826:Garem1	UTSW	18	21129452	missense	probably benign	0.00
R3714:Garem1	UTSW	18	21148890	missense	probably damaging	1.00
R3937:Garem1	UTSW	18	21148806	nonsense	probably null
R4362:Garem1	UTSW	18	21236115	missense	possibly damaging	0.62
R4441:Garem1	UTSW	18	21168750	missense	possibly damaging	0.92
R4747:Garem1	UTSW	18	21129943	missense	probably benign
R4814:Garem1	UTSW	18	21148116	missense	probably damaging	1.00
R4831:Garem1	UTSW	18	21129768	missense	probably benign	0.01
R4838:Garem1	UTSW	18	21147893	missense	probably benign	0.00
R5805:Garem1	UTSW	18	21148435	missense	probably benign	0.04
R5963:Garem1	UTSW	18	21129430	missense	probably benign	0.45
R5982:Garem1	UTSW	18	21148351	missense	possibly damaging	0.64
R6134:Garem1	UTSW	18	21129824	missense	probably benign	0.00
R6242:Garem1	UTSW	18	21129172	missense	possibly damaging	0.72
R6453:Garem1	UTSW	18	21148739	missense	probably damaging	0.99
R6485:Garem1	UTSW	18	21129837	missense	probably benign	0.00
R6596:Garem1	UTSW	18	21148739	missense	probably damaging	0.99
R6662:Garem1	UTSW	18	21148247	missense	probably benign	0.45
R6883:Garem1	UTSW	18	21129712	missense	probably benign
R6937:Garem1	UTSW	18	21147770	missense	probably benign	0.00
R7027:Garem1	UTSW	18	21129994	missense	probably benign
R7256:Garem1	UTSW	18	21148754	missense	probably damaging	1.00
R7534:Garem1	UTSW	18	21299916	start gained	probably benign
R7620:Garem1	UTSW	18	21129841	missense	probably benign
R7869:Garem1	UTSW	18	21299700	missense	probably damaging	1.00
R7963:Garem1	UTSW	18	21148787	missense	probably damaging	0.98
R8058:Garem1	UTSW	18	21148564	missense	probably damaging	1.00
R8953:Garem1	UTSW	18	21131331	critical splice donor site	probably null
R9273:Garem1	UTSW	18	21148217	missense	probably damaging	0.99
R9411:Garem1	UTSW	18	21236000	critical splice donor site	probably null
R9475:Garem1	UTSW	18	21148313	missense	probably benign	0.00
R9789:Garem1	UTSW	18	21129928	missense	possibly damaging	0.81
Z1176:Garem1	UTSW	18	21129792	missense	probably damaging	1.00
Z1176:Garem1	UTSW	18	21148325	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CTATATCTTGGGCCTCCAGC -3'
(R):5'- ATGACCAAGCAGAGCGTCTC -3'

Sequencing Primer
(F):5'- GCTTAGTTTGAAATCCTCTGAGAG -3'
(R):5'- AAGCAGAGCGTCTCCTGCC -3'

Posted On

2014-10-01