Incidental Mutation 'R2141:Nfasc'
ID236201
Institutional Source Beutler Lab
Gene Symbol Nfasc
Ensembl Gene ENSMUSG00000026442
Gene Nameneurofascin
SynonymsD430023G06Rik
MMRRC Submission 040144-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2141 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location132564690-132741797 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 132596645 bp
ZygosityHeterozygous
Amino Acid Change Proline to Leucine at position 932 (P932L)
Ref Sequence ENSEMBL: ENSMUSP00000139955 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043189] [ENSMUST00000094569] [ENSMUST00000163770] [ENSMUST00000187861] [ENSMUST00000188307]
Predicted Effect probably damaging
Transcript: ENSMUST00000043189
AA Change: P911L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000035454
Gene: ENSMUSG00000026442
AA Change: P911L

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
IG 42 131 4.5e0 SMART
IG 141 228 2.44e-7 SMART
IGc2 253 317 1.53e-17 SMART
IGc2 343 409 1.76e-8 SMART
IGc2 437 502 2.39e-10 SMART
IGc2 528 593 2.54e-5 SMART
FN3 607 690 2.17e-11 SMART
FN3 707 789 2.85e-6 SMART
FN3 805 896 2.21e-3 SMART
FN3 911 995 9.92e-6 SMART
low complexity region 996 1018 N/A INTRINSIC
transmembrane domain 1026 1048 N/A INTRINSIC
Pfam:Bravo_FIGEY 1049 1133 1.4e-29 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000094569
AA Change: P825L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000092148
Gene: ENSMUSG00000026442
AA Change: P825L

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
IG 48 137 4.5e0 SMART
IG 147 234 2.44e-7 SMART
IGc2 259 323 1.53e-17 SMART
IGc2 349 415 1.76e-8 SMART
IGc2 443 508 2.39e-10 SMART
IGc2 534 599 2.54e-5 SMART
FN3 628 711 2.17e-11 SMART
FN3 728 810 2.85e-6 SMART
FN3 825 909 9.92e-6 SMART
FN3 1010 1086 6.91e-5 SMART
transmembrane domain 1109 1131 N/A INTRINSIC
Pfam:Bravo_FIGEY 1132 1216 2.2e-29 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000163770
AA Change: P928L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000132979
Gene: ENSMUSG00000026442
AA Change: P928L

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
IG 42 131 4.5e0 SMART
IG 141 228 2.44e-7 SMART
IGc2 270 334 1.53e-17 SMART
IGc2 360 426 1.76e-8 SMART
IGc2 454 519 2.39e-10 SMART
IGc2 545 610 2.54e-5 SMART
FN3 624 707 2.17e-11 SMART
FN3 724 806 2.85e-6 SMART
FN3 822 913 2.21e-3 SMART
FN3 928 1012 9.92e-6 SMART
low complexity region 1013 1035 N/A INTRINSIC
transmembrane domain 1043 1065 N/A INTRINSIC
Pfam:Bravo_FIGEY 1066 1150 5e-30 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000186389
AA Change: P912L
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186539
Predicted Effect probably damaging
Transcript: ENSMUST00000187861
AA Change: P932L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000139955
Gene: ENSMUSG00000026442
AA Change: P932L

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
IG 48 137 1.8e-2 SMART
IG 147 234 1e-9 SMART
IGc2 259 323 6.4e-20 SMART
IGc2 349 415 7e-11 SMART
IGc2 443 508 9.7e-13 SMART
IGc2 534 599 1.1e-7 SMART
FN3 628 711 1e-13 SMART
FN3 728 810 1.4e-8 SMART
FN3 826 917 1.1e-5 SMART
FN3 932 1016 4.8e-8 SMART
FN3 1117 1193 3.4e-7 SMART
transmembrane domain 1216 1238 N/A INTRINSIC
Pfam:Bravo_FIGEY 1239 1325 2.6e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000188307
SMART Domains Protein: ENSMUSP00000139520
Gene: ENSMUSG00000026442

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
IG 42 131 1.8e-2 SMART
IG 141 228 1e-9 SMART
IGc2 253 317 6.4e-20 SMART
IGc2 343 409 7e-11 SMART
IGc2 437 502 9.7e-13 SMART
IGc2 528 593 1.1e-7 SMART
FN3 622 705 1e-13 SMART
FN3 722 804 1.4e-8 SMART
FN3 820 890 3.8e-1 SMART
Meta Mutation Damage Score 0.45 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency 97% (107/110)
MGI Phenotype FUNCTION: This gene encodes an L1 family immunoglobulin cell adhesion molecule with multiple IGcam and fibronectin domains. The protein functions in neurite outgrowth, neurite fasciculation, and organization of the axon initial segment (AIS) and nodes of Ranvier on axons during early development. Both the AIS and nodes of Ranvier contain high densities of voltage-gated Na+ (Nav) channels which are clustered by interactions with cytoskeletal and scaffolding proteins including this protein, gliomedin, ankyrin 3 (ankyrin-G), and betaIV spectrin. This protein links the AIS extracellular matrix to the intracellular cytoskeleton. This gene undergoes extensive alternative splicing, and the full-length nature of some variants has not been determined. [provided by RefSeq, May 2009]
PHENOTYPE: Mice homozygous for a null allele die within 6 to 7 days of birth, exhibit reduced nerve conduction velocity and abnormal paranodal junction formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 103 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810065E05Rik G T 11: 58,423,926 C150F probably damaging Het
4932431P20Rik T C 7: 29,531,510 noncoding transcript Het
Aagab T A 9: 63,616,675 probably null Het
Abca15 A C 7: 120,407,474 T1654P probably damaging Het
Abca17 T A 17: 24,334,266 Y157F probably benign Het
Aftph A T 11: 20,698,318 L813* probably null Het
Agap1 T C 1: 89,837,755 I615T probably damaging Het
Ak3 T G 19: 29,022,847 Q221H probably benign Het
Aldoa A G 7: 126,797,642 probably null Het
Anxa8 T C 14: 34,091,916 probably null Het
Baz2a A G 10: 128,123,612 D1329G probably damaging Het
Capn9 G A 8: 124,605,711 G430R possibly damaging Het
Cd55 C T 1: 130,449,423 V333I probably benign Het
Cep70 A G 9: 99,296,385 Y512C probably damaging Het
Cfhr2 T G 1: 139,831,155 R52S probably benign Het
Clcn6 A G 4: 148,024,137 F145S possibly damaging Het
Cnksr1 A G 4: 134,229,628 Y488H probably damaging Het
Diablo A G 5: 123,523,361 V24A probably benign Het
Dnah7b T A 1: 46,268,670 M3048K probably damaging Het
Dsel T C 1: 111,859,457 N1116S probably benign Het
Efnb1 A G X: 99,147,517 Y343C probably damaging Het
Esco1 A G 18: 10,574,873 probably null Het
Fam173b T C 15: 31,609,572 F146L probably benign Het
Fam26f G T 10: 34,127,695 A72E probably damaging Het
Fancd2 A G 6: 113,549,321 N335S probably benign Het
Flnc A G 6: 29,448,675 Y1304C probably damaging Het
Fubp3 A G 2: 31,600,557 probably benign Het
Gemin4 G C 11: 76,211,050 P962A probably damaging Het
Gjc3 A C 5: 137,957,546 L159R probably damaging Het
Gli1 A G 10: 127,336,727 L182P probably damaging Het
Gm21957 G T 7: 125,219,453 noncoding transcript Het
Gm28040 AGTG AGTGGCACCTTTGGTG 1: 133,327,321 probably benign Het
Gm4907 T A X: 23,907,310 V350E probably benign Het
Gm5885 A G 6: 133,529,275 noncoding transcript Het
Gm8989 T A 7: 106,329,956 T245S probably damaging Het
Gon4l A T 3: 88,887,595 T402S possibly damaging Het
Gprasp1 G A X: 135,802,042 E995K possibly damaging Het
Helb A T 10: 120,106,021 M254K possibly damaging Het
Ift20 G A 11: 78,540,034 E68K probably damaging Het
Igfn1 AGGG AGG 1: 135,974,852 probably benign Het
Impdh2 A G 9: 108,565,347 E305G possibly damaging Het
Ints7 T A 1: 191,604,860 C351S possibly damaging Het
Ipo9 ATCCTCCTCCTCCTCCTC ATCCTCCTCCTCCTCCTCCTC 1: 135,386,268 probably benign Het
Ipo9 A G 1: 135,402,250 V484A probably benign Het
Kcnq3 T C 15: 65,995,851 M648V probably benign Het
Kctd16 A G 18: 40,259,178 E273G possibly damaging Het
Kif18a T A 2: 109,333,503 N732K probably benign Het
Kif21b C T 1: 136,152,264 R513W probably damaging Het
Klhl36 T C 8: 119,876,772 C589R possibly damaging Het
Lck A G 4: 129,548,920 Y481H probably damaging Het
Lmtk2 A G 5: 144,147,615 Y156C probably damaging Het
Mical3 A T 6: 121,031,134 probably null Het
Mki67 A G 7: 135,695,592 I2571T possibly damaging Het
Mx2 G A 16: 97,538,703 E20K probably benign Het
Myo10 A G 15: 25,714,108 E87G probably benign Het
Myo18b T C 5: 112,874,026 K500R probably benign Het
N4bp2l2 A T 5: 150,647,536 I458N probably damaging Het
Nat10 T C 2: 103,731,303 probably null Het
Nipa1 C A 7: 55,997,511 probably null Het
Nkpd1 A G 7: 19,524,237 Q647R probably damaging Het
Nlrc4 T A 17: 74,447,951 probably benign Het
Nmbr C A 10: 14,770,442 Y353* probably null Het
Nos1ap T A 1: 170,329,166 D241V probably damaging Het
Obsl1 G A 1: 75,486,756 T1764M probably benign Het
Olfr1025-ps1 A G 2: 85,918,827 I301V probably null Het
Olfr1173 A G 2: 88,275,010 V13A probably benign Het
Olfr1289 A T 2: 111,483,630 T95S probably benign Het
Olfr770 A G 10: 129,133,006 I254T probably benign Het
Optc A T 1: 133,903,796 probably null Het
Pank1 G A 19: 34,878,980 R33C possibly damaging Het
Pcmtd1 C T 1: 7,169,565 R77C probably damaging Het
Phkg2 G A 7: 127,582,214 probably null Het
Plcb4 G A 2: 135,976,099 V762M probably damaging Het
Pramel7 T A 2: 87,489,977 H324L probably damaging Het
Prelp C T 1: 133,915,131 R92K probably benign Het
Rai1 C A 11: 60,189,467 S1452R possibly damaging Het
Ren1 C G 1: 133,350,778 probably null Het
Rev3l T C 10: 39,848,049 V785A probably benign Het
Rufy2 G T 10: 62,990,994 R104L probably damaging Het
Senp6 T A 9: 80,123,820 N8K probably damaging Het
Sept4 A T 11: 87,583,436 Q60L probably benign Het
Sipa1l2 G A 8: 125,491,491 P369L probably benign Het
Slc43a1 T C 2: 84,840,961 L37P probably damaging Het
Slf1 T A 13: 77,049,219 probably null Het
Ssr2 T A 3: 88,576,642 probably benign Het
Syt2 ACTCTCTCT ACTCTCTCTCT 1: 134,746,741 probably benign Het
Tas2r115 T C 6: 132,737,358 K210R probably benign Het
Tbx18 A G 9: 87,715,653 V276A probably damaging Het
Tie1 G A 4: 118,472,811 R1072* probably null Het
Tm2d2 C A 8: 25,022,658 T174K probably damaging Het
Tmem98 A G 11: 80,814,332 D82G possibly damaging Het
Tmub2 A G 11: 102,287,553 E94G possibly damaging Het
Tnnt2 TG TGG 1: 135,846,761 probably benign Het
Tonsl A T 15: 76,632,661 I923N probably damaging Het
Trove2 T C 1: 143,760,034 D458G probably benign Het
Ttc21a G A 9: 119,964,295 V977M probably damaging Het
Ube2ql1 T C 13: 69,738,664 D226G probably damaging Het
Ubr4 C T 4: 139,477,207 T4810M probably damaging Het
Zadh2 T C 18: 84,094,543 Y115H probably benign Het
Zfp408 A G 2: 91,647,849 probably benign Het
Zfp473 T C 7: 44,733,077 T610A possibly damaging Het
Zfp804b A G 5: 6,772,583 V160A probably benign Het
Zfp960 A G 17: 17,087,884 T287A probably benign Het
Other mutations in Nfasc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00895:Nfasc APN 1 132573798 nonsense probably null
IGL01088:Nfasc APN 1 132642776 utr 5 prime probably benign
IGL01958:Nfasc APN 1 132608438 nonsense probably null
IGL01999:Nfasc APN 1 132605247 splice site probably benign
IGL02170:Nfasc APN 1 132610366 nonsense probably null
IGL02187:Nfasc APN 1 132570481 missense probably damaging 1.00
IGL02192:Nfasc APN 1 132570481 missense probably damaging 1.00
IGL02452:Nfasc APN 1 132620924 critical splice donor site probably null
IGL02698:Nfasc APN 1 132634737 missense probably benign 0.06
IGL02797:Nfasc APN 1 132610448 missense probably damaging 1.00
IGL03000:Nfasc APN 1 132621509 splice site probably benign
IGL03027:Nfasc APN 1 132610469 missense probably damaging 1.00
jiggle UTSW 1 132602021 missense probably damaging 1.00
tremble UTSW 1 132611595 missense probably damaging 1.00
PIT4377001:Nfasc UTSW 1 132583066 missense unknown
R0240:Nfasc UTSW 1 132601983 missense probably damaging 1.00
R0240:Nfasc UTSW 1 132601983 missense probably damaging 1.00
R0241:Nfasc UTSW 1 132636993 missense probably benign 0.02
R0241:Nfasc UTSW 1 132636993 missense probably benign 0.02
R0418:Nfasc UTSW 1 132611595 missense probably damaging 1.00
R0513:Nfasc UTSW 1 132603846 missense possibly damaging 0.95
R0639:Nfasc UTSW 1 132603816 missense probably damaging 1.00
R0646:Nfasc UTSW 1 132608438 nonsense probably null
R1103:Nfasc UTSW 1 132607057 splice site probably benign
R1269:Nfasc UTSW 1 132610788 missense probably damaging 1.00
R1550:Nfasc UTSW 1 132608503 missense probably damaging 0.96
R1749:Nfasc UTSW 1 132611632 missense probably damaging 1.00
R1773:Nfasc UTSW 1 132610839 missense probably damaging 1.00
R1921:Nfasc UTSW 1 132610805 missense probably damaging 1.00
R1987:Nfasc UTSW 1 132610886 missense probably damaging 1.00
R2239:Nfasc UTSW 1 132583022 intron probably benign
R2413:Nfasc UTSW 1 132595505 missense probably damaging 1.00
R2428:Nfasc UTSW 1 132595654 missense possibly damaging 0.55
R2472:Nfasc UTSW 1 132588221 intron probably benign
R2517:Nfasc UTSW 1 132597763 unclassified probably null
R3850:Nfasc UTSW 1 132631733 missense probably damaging 1.00
R4050:Nfasc UTSW 1 132610305 splice site probably benign
R4061:Nfasc UTSW 1 132597845 missense probably damaging 1.00
R4088:Nfasc UTSW 1 132595591 missense probably damaging 1.00
R4342:Nfasc UTSW 1 132631705 missense probably damaging 1.00
R4343:Nfasc UTSW 1 132631705 missense probably damaging 1.00
R4345:Nfasc UTSW 1 132631705 missense probably damaging 1.00
R4452:Nfasc UTSW 1 132634671 missense probably damaging 1.00
R4818:Nfasc UTSW 1 132603830 missense possibly damaging 0.87
R4851:Nfasc UTSW 1 132602021 missense probably damaging 1.00
R5014:Nfasc UTSW 1 132584447 intron probably benign
R5768:Nfasc UTSW 1 132605145 missense probably benign 0.00
R6145:Nfasc UTSW 1 132634717 missense probably damaging 1.00
R6335:Nfasc UTSW 1 132576394 missense probably damaging 0.98
R6379:Nfasc UTSW 1 132570542 nonsense probably null
R6486:Nfasc UTSW 1 132605214 missense probably damaging 1.00
R7022:Nfasc UTSW 1 132621049 missense probably damaging 1.00
R7062:Nfasc UTSW 1 132601969 critical splice donor site probably null
R7084:Nfasc UTSW 1 132570509 missense unknown
R7275:Nfasc UTSW 1 132634263 missense probably damaging 1.00
R7286:Nfasc UTSW 1 132602052 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCACATTTCCTACGGAATGCC -3'
(R):5'- TGAAAGTGGTTGCCAGGCAG -3'

Sequencing Primer
(F):5'- AATGCCCTCTGCGCCCATAG -3'
(R):5'- CCTAAGGTCATGCCTTCA -3'
Posted On2014-10-01