Incidental Mutation 'R2141:Tnnt2'
ID236209
Institutional Source Beutler Lab
Gene Symbol Tnnt2
Ensembl Gene ENSMUSG00000026414
Gene Nametroponin T2, cardiac
SynonymscTnT, Tnt, cardiac TnT
MMRRC Submission 040144-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2141 (G1)
Quality Score217
Status Validated
Chromosome1
Chromosomal Location135836354-135852260 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) TG to TGG at 135846761 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000140282 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027671] [ENSMUST00000112085] [ENSMUST00000112086] [ENSMUST00000112087] [ENSMUST00000178204] [ENSMUST00000178854] [ENSMUST00000179863] [ENSMUST00000188028] [ENSMUST00000189355] [ENSMUST00000189732] [ENSMUST00000189826] [ENSMUST00000190451]
Predicted Effect probably benign
Transcript: ENSMUST00000027671
SMART Domains Protein: ENSMUSP00000027671
Gene: ENSMUSG00000026414

DomainStartEndE-ValueType
coiled coil region 1 31 N/A INTRINSIC
Pfam:Troponin 96 234 1e-33 PFAM
Pfam:Troponin 226 289 1.2e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000112085
SMART Domains Protein: ENSMUSP00000107715
Gene: ENSMUSG00000026414

DomainStartEndE-ValueType
low complexity region 5 17 N/A INTRINSIC
low complexity region 20 54 N/A INTRINSIC
Pfam:Troponin 100 238 2.4e-33 PFAM
Pfam:Troponin 230 293 2.7e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000112086
SMART Domains Protein: ENSMUSP00000107716
Gene: ENSMUSG00000026414

DomainStartEndE-ValueType
low complexity region 3 58 N/A INTRINSIC
Pfam:Troponin 106 244 2.5e-33 PFAM
Pfam:Troponin 236 299 2.8e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000112087
SMART Domains Protein: ENSMUSP00000107717
Gene: ENSMUSG00000026414

DomainStartEndE-ValueType
coiled coil region 1 37 N/A INTRINSIC
Pfam:Troponin 106 250 1.1e-38 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000178204
SMART Domains Protein: ENSMUSP00000137579
Gene: ENSMUSG00000026414

DomainStartEndE-ValueType
coiled coil region 1 38 N/A INTRINSIC
Pfam:Troponin 110 245 3.8e-34 PFAM
Pfam:Troponin 238 300 4.3e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000178854
SMART Domains Protein: ENSMUSP00000136265
Gene: ENSMUSG00000026414

DomainStartEndE-ValueType
coiled coil region 1 35 N/A INTRINSIC
Pfam:Troponin 100 244 1.7e-39 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000179863
SMART Domains Protein: ENSMUSP00000137093
Gene: ENSMUSG00000026414

DomainStartEndE-ValueType
coiled coil region 1 41 N/A INTRINSIC
Pfam:Troponin 110 251 3e-39 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186225
Predicted Effect probably benign
Transcript: ENSMUST00000188028
SMART Domains Protein: ENSMUSP00000140941
Gene: ENSMUSG00000026414

DomainStartEndE-ValueType
coiled coil region 1 41 N/A INTRINSIC
Pfam:Troponin 110 251 3e-39 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188098
Predicted Effect probably benign
Transcript: ENSMUST00000189355
SMART Domains Protein: ENSMUSP00000139919
Gene: ENSMUSG00000026414

DomainStartEndE-ValueType
coiled coil region 1 31 N/A INTRINSIC
Pfam:Troponin 96 240 1.6e-39 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000189732
SMART Domains Protein: ENSMUSP00000139669
Gene: ENSMUSG00000026414

DomainStartEndE-ValueType
coiled coil region 1 35 N/A INTRINSIC
Pfam:Troponin 100 244 1.7e-39 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000189826
SMART Domains Protein: ENSMUSP00000140807
Gene: ENSMUSG00000026414

DomainStartEndE-ValueType
coiled coil region 1 41 N/A INTRINSIC
Pfam:Troponin 110 201 1.7e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000190451
SMART Domains Protein: ENSMUSP00000140282
Gene: ENSMUSG00000026414

DomainStartEndE-ValueType
coiled coil region 1 31 N/A INTRINSIC
PDB:2Z5H|T 85 114 3e-7 PDB
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency 97% (107/110)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is the tropomyosin-binding subunit of the troponin complex, which is located on the thin filament of striated muscles and regulates muscle contraction in response to alterations in intracellular calcium ion concentration. Mutations in this gene have been associated with familial hypertrophic cardiomyopathy as well as with dilated cardiomyopathy. Transcripts for this gene undergo alternative splicing that results in many tissue-specific isoforms, however, the full-length nature of some of these variants has not yet been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit embryonic lethality during and prior to organogenesis and abnormal heart development. Mice homozygous for an allele that lacks the lysine residue at position 210 exhibit dilated cardiomyopathy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 103 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810065E05Rik G T 11: 58,423,926 C150F probably damaging Het
4932431P20Rik T C 7: 29,531,510 noncoding transcript Het
Aagab T A 9: 63,616,675 probably null Het
Abca15 A C 7: 120,407,474 T1654P probably damaging Het
Abca17 T A 17: 24,334,266 Y157F probably benign Het
Aftph A T 11: 20,698,318 L813* probably null Het
Agap1 T C 1: 89,837,755 I615T probably damaging Het
Ak3 T G 19: 29,022,847 Q221H probably benign Het
Aldoa A G 7: 126,797,642 probably null Het
Anxa8 T C 14: 34,091,916 probably null Het
Baz2a A G 10: 128,123,612 D1329G probably damaging Het
Capn9 G A 8: 124,605,711 G430R possibly damaging Het
Cd55 C T 1: 130,449,423 V333I probably benign Het
Cep70 A G 9: 99,296,385 Y512C probably damaging Het
Cfhr2 T G 1: 139,831,155 R52S probably benign Het
Clcn6 A G 4: 148,024,137 F145S possibly damaging Het
Cnksr1 A G 4: 134,229,628 Y488H probably damaging Het
Diablo A G 5: 123,523,361 V24A probably benign Het
Dnah7b T A 1: 46,268,670 M3048K probably damaging Het
Dsel T C 1: 111,859,457 N1116S probably benign Het
Efnb1 A G X: 99,147,517 Y343C probably damaging Het
Esco1 A G 18: 10,574,873 probably null Het
Fam173b T C 15: 31,609,572 F146L probably benign Het
Fam26f G T 10: 34,127,695 A72E probably damaging Het
Fancd2 A G 6: 113,549,321 N335S probably benign Het
Flnc A G 6: 29,448,675 Y1304C probably damaging Het
Fubp3 A G 2: 31,600,557 probably benign Het
Gemin4 G C 11: 76,211,050 P962A probably damaging Het
Gjc3 A C 5: 137,957,546 L159R probably damaging Het
Gli1 A G 10: 127,336,727 L182P probably damaging Het
Gm21957 G T 7: 125,219,453 noncoding transcript Het
Gm28040 AGTG AGTGGCACCTTTGGTG 1: 133,327,321 probably benign Het
Gm4907 T A X: 23,907,310 V350E probably benign Het
Gm5885 A G 6: 133,529,275 noncoding transcript Het
Gm8989 T A 7: 106,329,956 T245S probably damaging Het
Gon4l A T 3: 88,887,595 T402S possibly damaging Het
Gprasp1 G A X: 135,802,042 E995K possibly damaging Het
Helb A T 10: 120,106,021 M254K possibly damaging Het
Ift20 G A 11: 78,540,034 E68K probably damaging Het
Igfn1 AGGG AGG 1: 135,974,852 probably benign Het
Impdh2 A G 9: 108,565,347 E305G possibly damaging Het
Ints7 T A 1: 191,604,860 C351S possibly damaging Het
Ipo9 ATCCTCCTCCTCCTCCTC ATCCTCCTCCTCCTCCTCCTC 1: 135,386,268 probably benign Het
Ipo9 A G 1: 135,402,250 V484A probably benign Het
Kcnq3 T C 15: 65,995,851 M648V probably benign Het
Kctd16 A G 18: 40,259,178 E273G possibly damaging Het
Kif18a T A 2: 109,333,503 N732K probably benign Het
Kif21b C T 1: 136,152,264 R513W probably damaging Het
Klhl36 T C 8: 119,876,772 C589R possibly damaging Het
Lck A G 4: 129,548,920 Y481H probably damaging Het
Lmtk2 A G 5: 144,147,615 Y156C probably damaging Het
Mical3 A T 6: 121,031,134 probably null Het
Mki67 A G 7: 135,695,592 I2571T possibly damaging Het
Mx2 G A 16: 97,538,703 E20K probably benign Het
Myo10 A G 15: 25,714,108 E87G probably benign Het
Myo18b T C 5: 112,874,026 K500R probably benign Het
N4bp2l2 A T 5: 150,647,536 I458N probably damaging Het
Nat10 T C 2: 103,731,303 probably null Het
Nfasc G A 1: 132,596,645 P932L probably damaging Het
Nipa1 C A 7: 55,997,511 probably null Het
Nkpd1 A G 7: 19,524,237 Q647R probably damaging Het
Nlrc4 T A 17: 74,447,951 probably benign Het
Nmbr C A 10: 14,770,442 Y353* probably null Het
Nos1ap T A 1: 170,329,166 D241V probably damaging Het
Obsl1 G A 1: 75,486,756 T1764M probably benign Het
Olfr1025-ps1 A G 2: 85,918,827 I301V probably null Het
Olfr1173 A G 2: 88,275,010 V13A probably benign Het
Olfr1289 A T 2: 111,483,630 T95S probably benign Het
Olfr770 A G 10: 129,133,006 I254T probably benign Het
Optc A T 1: 133,903,796 probably null Het
Pank1 G A 19: 34,878,980 R33C possibly damaging Het
Pcmtd1 C T 1: 7,169,565 R77C probably damaging Het
Phkg2 G A 7: 127,582,214 probably null Het
Plcb4 G A 2: 135,976,099 V762M probably damaging Het
Pramel7 T A 2: 87,489,977 H324L probably damaging Het
Prelp C T 1: 133,915,131 R92K probably benign Het
Rai1 C A 11: 60,189,467 S1452R possibly damaging Het
Ren1 C G 1: 133,350,778 probably null Het
Rev3l T C 10: 39,848,049 V785A probably benign Het
Rufy2 G T 10: 62,990,994 R104L probably damaging Het
Senp6 T A 9: 80,123,820 N8K probably damaging Het
Sept4 A T 11: 87,583,436 Q60L probably benign Het
Sipa1l2 G A 8: 125,491,491 P369L probably benign Het
Slc43a1 T C 2: 84,840,961 L37P probably damaging Het
Slf1 T A 13: 77,049,219 probably null Het
Ssr2 T A 3: 88,576,642 probably benign Het
Syt2 ACTCTCTCT ACTCTCTCTCT 1: 134,746,741 probably benign Het
Tas2r115 T C 6: 132,737,358 K210R probably benign Het
Tbx18 A G 9: 87,715,653 V276A probably damaging Het
Tie1 G A 4: 118,472,811 R1072* probably null Het
Tm2d2 C A 8: 25,022,658 T174K probably damaging Het
Tmem98 A G 11: 80,814,332 D82G possibly damaging Het
Tmub2 A G 11: 102,287,553 E94G possibly damaging Het
Tonsl A T 15: 76,632,661 I923N probably damaging Het
Trove2 T C 1: 143,760,034 D458G probably benign Het
Ttc21a G A 9: 119,964,295 V977M probably damaging Het
Ube2ql1 T C 13: 69,738,664 D226G probably damaging Het
Ubr4 C T 4: 139,477,207 T4810M probably damaging Het
Zadh2 T C 18: 84,094,543 Y115H probably benign Het
Zfp408 A G 2: 91,647,849 probably benign Het
Zfp473 T C 7: 44,733,077 T610A possibly damaging Het
Zfp804b A G 5: 6,772,583 V160A probably benign Het
Zfp960 A G 17: 17,087,884 T287A probably benign Het
Other mutations in Tnnt2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00858:Tnnt2 APN 1 135851702 missense probably damaging 1.00
IGL00885:Tnnt2 APN 1 135846764 splice site probably benign
IGL02223:Tnnt2 APN 1 135842015 intron probably benign
IGL03094:Tnnt2 APN 1 135849462 critical splice donor site probably null
R0827:Tnnt2 UTSW 1 135843796 intron probably benign
R1469:Tnnt2 UTSW 1 135852055 missense possibly damaging 0.83
R1469:Tnnt2 UTSW 1 135852055 missense possibly damaging 0.83
R1478:Tnnt2 UTSW 1 135848026 missense probably benign 0.40
R1728:Tnnt2 UTSW 1 135845506 intron probably benign
R1729:Tnnt2 UTSW 1 135845506 intron probably benign
R1730:Tnnt2 UTSW 1 135845506 intron probably benign
R1739:Tnnt2 UTSW 1 135845506 intron probably benign
R1762:Tnnt2 UTSW 1 135845506 intron probably benign
R1783:Tnnt2 UTSW 1 135845506 intron probably benign
R1784:Tnnt2 UTSW 1 135845506 intron probably benign
R1785:Tnnt2 UTSW 1 135845506 intron probably benign
R1891:Tnnt2 UTSW 1 135840859 critical splice acceptor site probably null
R2049:Tnnt2 UTSW 1 135846761 splice site probably benign
R2104:Tnnt2 UTSW 1 135843809 intron probably benign
R2130:Tnnt2 UTSW 1 135846761 splice site probably benign
R2225:Tnnt2 UTSW 1 135843791 intron probably benign
R2227:Tnnt2 UTSW 1 135843791 intron probably benign
R2504:Tnnt2 UTSW 1 135852065 missense probably damaging 0.96
R4883:Tnnt2 UTSW 1 135847758 nonsense probably null
R5963:Tnnt2 UTSW 1 135843862 intron probably benign
R6082:Tnnt2 UTSW 1 135849434 missense probably benign 0.30
R6261:Tnnt2 UTSW 1 135850554 intron probably null
R7208:Tnnt2 UTSW 1 135850376 splice site probably null
R7241:Tnnt2 UTSW 1 135851706 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCAGATCTACTAGACCTGGGAG -3'
(R):5'- TCTGTCCAAGGCCATGACTAG -3'

Sequencing Primer
(F):5'- TCTACTAGACCTGGGAGAGACTC -3'
(R):5'- CCCCACTCTGTAGATGAATGTAC -3'
Posted On2014-10-01