Incidental Mutation 'R2141:Kif21b'
ID236211
Institutional Source Beutler Lab
Gene Symbol Kif21b
Ensembl Gene ENSMUSG00000041642
Gene Namekinesin family member 21B
SynonymsN-5 kinesin, 2610511N21Rik
MMRRC Submission 040144-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.225) question?
Stock #R2141 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location136131389-136177998 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 136152264 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Tryptophan at position 513 (R513W)
Ref Sequence ENSEMBL: ENSMUSP00000074661 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075164] [ENSMUST00000130864]
Predicted Effect probably damaging
Transcript: ENSMUST00000075164
AA Change: R513W

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000074661
Gene: ENSMUSG00000041642
AA Change: R513W

DomainStartEndE-ValueType
KISc 6 379 6.39e-159 SMART
Blast:KISc 469 543 1e-14 BLAST
low complexity region 578 628 N/A INTRINSIC
coiled coil region 632 825 N/A INTRINSIC
low complexity region 847 866 N/A INTRINSIC
coiled coil region 931 991 N/A INTRINSIC
low complexity region 1109 1123 N/A INTRINSIC
low complexity region 1239 1249 N/A INTRINSIC
low complexity region 1266 1279 N/A INTRINSIC
WD40 1299 1336 2.89e-5 SMART
WD40 1339 1377 5.69e-4 SMART
WD40 1404 1441 6.42e-1 SMART
WD40 1444 1486 1.5e-3 SMART
WD40 1494 1532 4.8e-2 SMART
WD40 1535 1575 1.55e-5 SMART
WD40 1578 1615 3.81e-5 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122892
Predicted Effect possibly damaging
Transcript: ENSMUST00000130864
AA Change: R513W

PolyPhen 2 Score 0.947 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000114297
Gene: ENSMUSG00000041642
AA Change: R513W

DomainStartEndE-ValueType
KISc 6 379 6.39e-159 SMART
Blast:KISc 469 543 1e-14 BLAST
low complexity region 578 628 N/A INTRINSIC
coiled coil region 632 825 N/A INTRINSIC
low complexity region 847 866 N/A INTRINSIC
coiled coil region 931 991 N/A INTRINSIC
low complexity region 1109 1123 N/A INTRINSIC
low complexity region 1239 1249 N/A INTRINSIC
low complexity region 1266 1279 N/A INTRINSIC
WD40 1299 1336 2.89e-5 SMART
WD40 1339 1377 5.69e-4 SMART
WD40 1404 1441 6.42e-1 SMART
WD40 1444 1486 1.5e-3 SMART
WD40 1494 1532 4.8e-2 SMART
WD40 1535 1575 1.55e-5 SMART
WD40 1578 1615 5.1e-6 SMART
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency 97% (107/110)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the kinesin superfamily. Kinesins are ATP-dependent microtubule-based motor proteins that are involved in the intracellular transport of membranous organelles. Single nucleotide polymorphisms in this gene are associated with inflammatory bowel disease and multiple sclerosis. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Nov 2011]
PHENOTYPE: Homozygous KO reduces dendrite branching and spine density as a result of reduced microtubule growth, resulting in impaired spatial learning and cued conditioning behavior. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 103 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810065E05Rik G T 11: 58,423,926 C150F probably damaging Het
4932431P20Rik T C 7: 29,531,510 noncoding transcript Het
Aagab T A 9: 63,616,675 probably null Het
Abca15 A C 7: 120,407,474 T1654P probably damaging Het
Abca17 T A 17: 24,334,266 Y157F probably benign Het
Aftph A T 11: 20,698,318 L813* probably null Het
Agap1 T C 1: 89,837,755 I615T probably damaging Het
Ak3 T G 19: 29,022,847 Q221H probably benign Het
Aldoa A G 7: 126,797,642 probably null Het
Anxa8 T C 14: 34,091,916 probably null Het
Baz2a A G 10: 128,123,612 D1329G probably damaging Het
Capn9 G A 8: 124,605,711 G430R possibly damaging Het
Cd55 C T 1: 130,449,423 V333I probably benign Het
Cep70 A G 9: 99,296,385 Y512C probably damaging Het
Cfhr2 T G 1: 139,831,155 R52S probably benign Het
Clcn6 A G 4: 148,024,137 F145S possibly damaging Het
Cnksr1 A G 4: 134,229,628 Y488H probably damaging Het
Diablo A G 5: 123,523,361 V24A probably benign Het
Dnah7b T A 1: 46,268,670 M3048K probably damaging Het
Dsel T C 1: 111,859,457 N1116S probably benign Het
Efnb1 A G X: 99,147,517 Y343C probably damaging Het
Esco1 A G 18: 10,574,873 probably null Het
Fam173b T C 15: 31,609,572 F146L probably benign Het
Fam26f G T 10: 34,127,695 A72E probably damaging Het
Fancd2 A G 6: 113,549,321 N335S probably benign Het
Flnc A G 6: 29,448,675 Y1304C probably damaging Het
Fubp3 A G 2: 31,600,557 probably benign Het
Gemin4 G C 11: 76,211,050 P962A probably damaging Het
Gjc3 A C 5: 137,957,546 L159R probably damaging Het
Gli1 A G 10: 127,336,727 L182P probably damaging Het
Gm21957 G T 7: 125,219,453 noncoding transcript Het
Gm28040 AGTG AGTGGCACCTTTGGTG 1: 133,327,321 probably benign Het
Gm4907 T A X: 23,907,310 V350E probably benign Het
Gm5885 A G 6: 133,529,275 noncoding transcript Het
Gm8989 T A 7: 106,329,956 T245S probably damaging Het
Gon4l A T 3: 88,887,595 T402S possibly damaging Het
Gprasp1 G A X: 135,802,042 E995K possibly damaging Het
Helb A T 10: 120,106,021 M254K possibly damaging Het
Ift20 G A 11: 78,540,034 E68K probably damaging Het
Igfn1 AGGG AGG 1: 135,974,852 probably benign Het
Impdh2 A G 9: 108,565,347 E305G possibly damaging Het
Ints7 T A 1: 191,604,860 C351S possibly damaging Het
Ipo9 ATCCTCCTCCTCCTCCTC ATCCTCCTCCTCCTCCTCCTC 1: 135,386,268 probably benign Het
Ipo9 A G 1: 135,402,250 V484A probably benign Het
Kcnq3 T C 15: 65,995,851 M648V probably benign Het
Kctd16 A G 18: 40,259,178 E273G possibly damaging Het
Kif18a T A 2: 109,333,503 N732K probably benign Het
Klhl36 T C 8: 119,876,772 C589R possibly damaging Het
Lck A G 4: 129,548,920 Y481H probably damaging Het
Lmtk2 A G 5: 144,147,615 Y156C probably damaging Het
Mical3 A T 6: 121,031,134 probably null Het
Mki67 A G 7: 135,695,592 I2571T possibly damaging Het
Mx2 G A 16: 97,538,703 E20K probably benign Het
Myo10 A G 15: 25,714,108 E87G probably benign Het
Myo18b T C 5: 112,874,026 K500R probably benign Het
N4bp2l2 A T 5: 150,647,536 I458N probably damaging Het
Nat10 T C 2: 103,731,303 probably null Het
Nfasc G A 1: 132,596,645 P932L probably damaging Het
Nipa1 C A 7: 55,997,511 probably null Het
Nkpd1 A G 7: 19,524,237 Q647R probably damaging Het
Nlrc4 T A 17: 74,447,951 probably benign Het
Nmbr C A 10: 14,770,442 Y353* probably null Het
Nos1ap T A 1: 170,329,166 D241V probably damaging Het
Obsl1 G A 1: 75,486,756 T1764M probably benign Het
Olfr1025-ps1 A G 2: 85,918,827 I301V probably null Het
Olfr1173 A G 2: 88,275,010 V13A probably benign Het
Olfr1289 A T 2: 111,483,630 T95S probably benign Het
Olfr770 A G 10: 129,133,006 I254T probably benign Het
Optc A T 1: 133,903,796 probably null Het
Pank1 G A 19: 34,878,980 R33C possibly damaging Het
Pcmtd1 C T 1: 7,169,565 R77C probably damaging Het
Phkg2 G A 7: 127,582,214 probably null Het
Plcb4 G A 2: 135,976,099 V762M probably damaging Het
Pramel7 T A 2: 87,489,977 H324L probably damaging Het
Prelp C T 1: 133,915,131 R92K probably benign Het
Rai1 C A 11: 60,189,467 S1452R possibly damaging Het
Ren1 C G 1: 133,350,778 probably null Het
Rev3l T C 10: 39,848,049 V785A probably benign Het
Rufy2 G T 10: 62,990,994 R104L probably damaging Het
Senp6 T A 9: 80,123,820 N8K probably damaging Het
Sept4 A T 11: 87,583,436 Q60L probably benign Het
Sipa1l2 G A 8: 125,491,491 P369L probably benign Het
Slc43a1 T C 2: 84,840,961 L37P probably damaging Het
Slf1 T A 13: 77,049,219 probably null Het
Ssr2 T A 3: 88,576,642 probably benign Het
Syt2 ACTCTCTCT ACTCTCTCTCT 1: 134,746,741 probably benign Het
Tas2r115 T C 6: 132,737,358 K210R probably benign Het
Tbx18 A G 9: 87,715,653 V276A probably damaging Het
Tie1 G A 4: 118,472,811 R1072* probably null Het
Tm2d2 C A 8: 25,022,658 T174K probably damaging Het
Tmem98 A G 11: 80,814,332 D82G possibly damaging Het
Tmub2 A G 11: 102,287,553 E94G possibly damaging Het
Tnnt2 TG TGG 1: 135,846,761 probably benign Het
Tonsl A T 15: 76,632,661 I923N probably damaging Het
Trove2 T C 1: 143,760,034 D458G probably benign Het
Ttc21a G A 9: 119,964,295 V977M probably damaging Het
Ube2ql1 T C 13: 69,738,664 D226G probably damaging Het
Ubr4 C T 4: 139,477,207 T4810M probably damaging Het
Zadh2 T C 18: 84,094,543 Y115H probably benign Het
Zfp408 A G 2: 91,647,849 probably benign Het
Zfp473 T C 7: 44,733,077 T610A possibly damaging Het
Zfp804b A G 5: 6,772,583 V160A probably benign Het
Zfp960 A G 17: 17,087,884 T287A probably benign Het
Other mutations in Kif21b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00990:Kif21b APN 1 136152342 missense possibly damaging 0.68
IGL01020:Kif21b APN 1 136154094 splice site probably benign
IGL01288:Kif21b APN 1 136172184 missense probably benign 0.00
IGL02105:Kif21b APN 1 136171303 missense probably benign
IGL02264:Kif21b APN 1 136159757 missense probably damaging 1.00
IGL02303:Kif21b APN 1 136159757 missense probably damaging 1.00
IGL02308:Kif21b APN 1 136159757 missense probably damaging 1.00
IGL02310:Kif21b APN 1 136159757 missense probably damaging 1.00
IGL02419:Kif21b APN 1 136151267 missense probably benign 0.00
IGL02553:Kif21b APN 1 136154121 missense probably damaging 1.00
IGL02568:Kif21b APN 1 136172867 missense probably damaging 0.96
IGL02657:Kif21b APN 1 136172230 missense possibly damaging 0.88
IGL03068:Kif21b APN 1 136158355 unclassified probably benign
IGL03230:Kif21b APN 1 136162812 missense probably benign 0.03
R0190:Kif21b UTSW 1 136171219 missense probably benign 0.32
R0349:Kif21b UTSW 1 136149311 missense probably damaging 0.97
R0501:Kif21b UTSW 1 136163099 missense probably benign 0.44
R0620:Kif21b UTSW 1 136159428 missense possibly damaging 0.88
R0629:Kif21b UTSW 1 136172157 critical splice acceptor site probably null
R0741:Kif21b UTSW 1 136159744 missense probably damaging 1.00
R1087:Kif21b UTSW 1 136162823 missense probably damaging 1.00
R1217:Kif21b UTSW 1 136152376 missense probably damaging 1.00
R1464:Kif21b UTSW 1 136156153 missense possibly damaging 0.50
R1464:Kif21b UTSW 1 136156153 missense possibly damaging 0.50
R1511:Kif21b UTSW 1 136169324 critical splice donor site probably null
R1512:Kif21b UTSW 1 136152805 missense probably benign 0.01
R1513:Kif21b UTSW 1 136156111 missense probably damaging 0.98
R1591:Kif21b UTSW 1 136149317 missense probably damaging 1.00
R1616:Kif21b UTSW 1 136171685 missense probably damaging 1.00
R1628:Kif21b UTSW 1 136171220 missense probably benign 0.01
R1658:Kif21b UTSW 1 136171285 missense probably damaging 1.00
R1728:Kif21b UTSW 1 136160121 missense possibly damaging 0.85
R1741:Kif21b UTSW 1 136156142 missense probably damaging 1.00
R1784:Kif21b UTSW 1 136160121 missense possibly damaging 0.85
R1807:Kif21b UTSW 1 136147793 missense possibly damaging 0.94
R1896:Kif21b UTSW 1 136147845 missense possibly damaging 0.90
R1970:Kif21b UTSW 1 136171156 missense probably damaging 1.00
R1984:Kif21b UTSW 1 136147546 missense probably damaging 1.00
R1985:Kif21b UTSW 1 136147546 missense probably damaging 1.00
R1986:Kif21b UTSW 1 136147546 missense probably damaging 1.00
R1988:Kif21b UTSW 1 136152264 missense probably damaging 0.98
R1990:Kif21b UTSW 1 136161770 missense probably damaging 1.00
R2014:Kif21b UTSW 1 136148282 missense probably damaging 1.00
R2045:Kif21b UTSW 1 136160313 missense probably damaging 1.00
R2248:Kif21b UTSW 1 136172966 missense probably damaging 1.00
R2886:Kif21b UTSW 1 136147874 splice site probably benign
R2896:Kif21b UTSW 1 136154217 missense possibly damaging 0.82
R3706:Kif21b UTSW 1 136159410 missense probably benign 0.06
R3780:Kif21b UTSW 1 136156226 missense probably damaging 0.99
R3827:Kif21b UTSW 1 136162994 critical splice donor site probably null
R4227:Kif21b UTSW 1 136154093 splice site probably null
R4600:Kif21b UTSW 1 136147864 missense probably benign 0.39
R4608:Kif21b UTSW 1 136148186 intron probably benign
R4749:Kif21b UTSW 1 136144749 nonsense probably null
R4841:Kif21b UTSW 1 136145220 missense probably damaging 1.00
R4842:Kif21b UTSW 1 136145220 missense probably damaging 1.00
R4933:Kif21b UTSW 1 136151325 splice site probably null
R4959:Kif21b UTSW 1 136148370 missense possibly damaging 0.90
R5018:Kif21b UTSW 1 136172234 missense probably benign 0.30
R5116:Kif21b UTSW 1 136152783 missense probably damaging 0.99
R5119:Kif21b UTSW 1 136163100 missense probably benign
R5197:Kif21b UTSW 1 136144625 missense probably damaging 1.00
R5230:Kif21b UTSW 1 136171673 missense probably damaging 1.00
R5249:Kif21b UTSW 1 136169228 missense probably damaging 1.00
R5337:Kif21b UTSW 1 136171143 missense probably damaging 1.00
R5358:Kif21b UTSW 1 136172292 missense possibly damaging 0.85
R5466:Kif21b UTSW 1 136147525 missense probably damaging 1.00
R5557:Kif21b UTSW 1 136170059 missense probably damaging 1.00
R5727:Kif21b UTSW 1 136170009 missense probably damaging 1.00
R5865:Kif21b UTSW 1 136151137 nonsense probably null
R5929:Kif21b UTSW 1 136151207 missense probably damaging 1.00
R6274:Kif21b UTSW 1 136149418 missense possibly damaging 0.57
R6349:Kif21b UTSW 1 136158326 missense probably damaging 1.00
R6648:Kif21b UTSW 1 136152397 missense probably benign 0.00
R6831:Kif21b UTSW 1 136144758 nonsense probably null
R7156:Kif21b UTSW 1 136147824 missense probably damaging 1.00
R7165:Kif21b UTSW 1 136149448 missense probably damaging 0.98
R7327:Kif21b UTSW 1 136159649 missense possibly damaging 0.60
R7680:Kif21b UTSW 1 136147869 critical splice donor site probably null
X0053:Kif21b UTSW 1 136149316 missense probably damaging 1.00
X0066:Kif21b UTSW 1 136172945 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGATCCAGAACTACATCCGGG -3'
(R):5'- GGGGTTCACCTTCAAATGTTC -3'

Sequencing Primer
(F):5'- CAGAACTACATCCGGGAGATCG -3'
(R):5'- CACCTTCAAATGTTCTGGTGTCAGG -3'
Posted On2014-10-01