Incidental Mutation 'R0201:Cc2d2a'
ID 23626
Institutional Source Beutler Lab
Gene Symbol Cc2d2a
Ensembl Gene ENSMUSG00000039765
Gene Name coiled-coil and C2 domain containing 2A
Synonyms b2b1035Clo, 5730509K17Rik
MMRRC Submission 038458-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.914) question?
Stock # R0201 (G1)
Quality Score 225
Status Validated
Chromosome 5
Chromosomal Location 43819715-43898317 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 43894854 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Cysteine at position 1437 (Y1437C)
Ref Sequence ENSEMBL: ENSMUSP00000114349 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048150] [ENSMUST00000125866]
AlphaFold Q8CFW7
Predicted Effect probably damaging
Transcript: ENSMUST00000048150
AA Change: Y1498C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000048320
Gene: ENSMUSG00000039765
AA Change: Y1498C

DomainStartEndE-ValueType
low complexity region 26 41 N/A INTRINSIC
low complexity region 58 67 N/A INTRINSIC
low complexity region 124 136 N/A INTRINSIC
low complexity region 203 217 N/A INTRINSIC
coiled coil region 472 501 N/A INTRINSIC
coiled coil region 553 582 N/A INTRINSIC
Pfam:CC2D2AN-C2 645 817 2e-36 PFAM
low complexity region 1005 1017 N/A INTRINSIC
low complexity region 1024 1036 N/A INTRINSIC
C2 1048 1208 3.43e-5 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000125866
AA Change: Y1437C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000114349
Gene: ENSMUSG00000039765
AA Change: Y1437C

DomainStartEndE-ValueType
low complexity region 9 18 N/A INTRINSIC
low complexity region 75 87 N/A INTRINSIC
low complexity region 154 168 N/A INTRINSIC
coiled coil region 423 452 N/A INTRINSIC
coiled coil region 504 533 N/A INTRINSIC
Pfam:CC2D2AN-C2 596 768 7.7e-44 PFAM
low complexity region 970 982 N/A INTRINSIC
C2 994 1154 2.3e-7 SMART
Meta Mutation Damage Score 0.3612 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 94.2%
Validation Efficiency 97% (91/94)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a coiled-coil and calcium binding domain protein that appears to play a critical role in cilia formation. Mutations in this gene cause Meckel syndrome type 6, as well as Joubert syndrome type 9. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2009]
PHENOTYPE: Mice homozygous for a null allele exhibit embryonic lethality with multiorgan defects related to cilia biogenesis. Homozygotes for a gene trap allele show randomized body axis, holoprosencephaly, and microphthalmia. Homozygotes for an ENU-induced allele show heterotaxia, congenital heart anomalies, kidney and eye defects, polydactyly, and cleft palate. [provided by MGI curators]
Allele List at MGI

All alleles(5) : Targeted, other(4) Gene trapped(1)

Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamdec1 A G 14: 68,819,406 (GRCm39) probably null Het
Adamts16 T A 13: 70,927,763 (GRCm39) Q492L possibly damaging Het
Aplnr A G 2: 84,967,521 (GRCm39) D182G probably damaging Het
Arnt2 G T 7: 84,010,867 (GRCm39) S3* probably null Het
Asxl3 T C 18: 22,656,211 (GRCm39) V1407A probably benign Het
Atg13 A T 2: 91,515,107 (GRCm39) probably null Het
Atm A T 9: 53,365,579 (GRCm39) probably benign Het
Birc6 T G 17: 74,916,322 (GRCm39) V1746G possibly damaging Het
Cbln1 G T 8: 88,198,741 (GRCm39) T43K probably benign Het
Cbx5 T C 15: 103,108,127 (GRCm39) T173A probably damaging Het
Ccdc78 C A 17: 26,008,210 (GRCm39) probably benign Het
Cd2bp2 A G 7: 126,793,000 (GRCm39) Y341H probably damaging Het
Cdhr5 T A 7: 140,856,291 (GRCm39) D88V probably damaging Het
Ces1f T A 8: 93,993,957 (GRCm39) T275S probably null Het
Cimip4 T A 15: 78,263,028 (GRCm39) M209L probably damaging Het
Clca4a T C 3: 144,666,478 (GRCm39) N458S probably benign Het
Cog5 A G 12: 31,889,840 (GRCm39) K521R probably damaging Het
Csf2ra T A 19: 61,214,006 (GRCm39) T305S probably benign Het
Csmd3 T A 15: 47,483,125 (GRCm39) probably benign Het
Cts6 T A 13: 61,349,313 (GRCm39) R132* probably null Het
D5Ertd579e G T 5: 36,773,809 (GRCm39) N195K probably damaging Het
Ddx1 A G 12: 13,273,809 (GRCm39) V606A probably damaging Het
Dip2b G A 15: 100,084,028 (GRCm39) D884N probably damaging Het
Ehhadh A G 16: 21,592,243 (GRCm39) probably null Het
Enpp1 T A 10: 24,529,815 (GRCm39) T608S probably benign Het
Fancm T C 12: 65,148,406 (GRCm39) Y674H probably damaging Het
Fat4 T A 3: 38,945,745 (GRCm39) V1546D probably damaging Het
Fsd1 G A 17: 56,297,522 (GRCm39) A158T probably benign Het
Fzd2 T A 11: 102,496,948 (GRCm39) M464K probably damaging Het
Gjc2 A G 11: 59,068,416 (GRCm39) F22S possibly damaging Het
Gria2 T C 3: 80,615,145 (GRCm39) Y445C probably damaging Het
Hsdl1 T A 8: 120,292,995 (GRCm39) I147F possibly damaging Het
Ifi44 T C 3: 151,451,273 (GRCm39) Y226C probably damaging Het
Il16 A G 7: 83,371,516 (GRCm39) C97R probably damaging Het
Impg1 A T 9: 80,252,843 (GRCm39) S369T probably damaging Het
Jmjd1c A G 10: 67,054,888 (GRCm39) T390A unknown Het
Lgi1 A G 19: 38,289,741 (GRCm39) E269G possibly damaging Het
Lrp6 G T 6: 134,427,860 (GRCm39) Y1577* probably null Het
Lrrc74a G T 12: 86,808,547 (GRCm39) probably benign Het
Man1c1 A T 4: 134,367,709 (GRCm39) probably null Het
Map1lc3b A C 8: 122,317,289 (GRCm39) Q9P possibly damaging Het
Mboat1 G A 13: 30,386,358 (GRCm39) R124H probably benign Het
Mcu A G 10: 59,292,499 (GRCm39) L60P probably damaging Het
Mrs2 G T 13: 25,202,517 (GRCm39) Q75K probably benign Het
Muc2 CGTG CGTGTG 7: 141,699,185 (GRCm38) probably null Het
Neb G A 2: 52,096,890 (GRCm39) probably benign Het
Nlrp2 C T 7: 5,331,328 (GRCm39) G356D probably benign Het
Notch3 A G 17: 32,375,122 (GRCm39) probably benign Het
Npr2 A C 4: 43,641,617 (GRCm39) S474R probably damaging Het
Nup58 A G 14: 60,482,065 (GRCm39) F100L probably benign Het
Osbpl6 A C 2: 76,376,386 (GRCm39) D87A possibly damaging Het
Pabpc2 A T 18: 39,908,360 (GRCm39) M542L probably benign Het
Papln A G 12: 83,829,801 (GRCm39) probably benign Het
Parpbp T C 10: 87,928,758 (GRCm39) I561V possibly damaging Het
Pcdhb13 C T 18: 37,575,634 (GRCm39) A4V probably benign Het
Pelp1 T C 11: 70,286,530 (GRCm39) T533A possibly damaging Het
Poldip3 T A 15: 83,019,497 (GRCm39) M182L probably benign Het
Por T C 5: 135,760,032 (GRCm39) S240P possibly damaging Het
Pramel15 A T 4: 144,103,843 (GRCm39) probably benign Het
Pramel28 T C 4: 143,691,460 (GRCm39) E421G probably damaging Het
Prss22 A T 17: 24,215,275 (GRCm39) V167D probably damaging Het
Prss37 A C 6: 40,493,283 (GRCm39) L61R probably damaging Het
Psmd1 C T 1: 86,046,338 (GRCm39) T702M probably benign Het
Pxdn G T 12: 30,052,430 (GRCm39) G869V possibly damaging Het
Rabgap1l A G 1: 160,281,315 (GRCm39) probably benign Het
Rapgef6 T C 11: 54,510,767 (GRCm39) V228A probably damaging Het
Rnf169 T C 7: 99,575,210 (GRCm39) R462G possibly damaging Het
Rnft2 A G 5: 118,332,745 (GRCm39) probably benign Het
Sgo2b T C 8: 64,379,670 (GRCm39) D1054G probably benign Het
Sh3bgr T C 16: 96,029,717 (GRCm39) probably benign Het
Slc12a4 A G 8: 106,671,982 (GRCm39) V910A possibly damaging Het
Slc6a12 A T 6: 121,332,331 (GRCm39) I222F probably benign Het
Spty2d1 G A 7: 46,647,649 (GRCm39) R427* probably null Het
Ssc5d A G 7: 4,947,662 (GRCm39) T1339A probably benign Het
Sspo A C 6: 48,432,686 (GRCm39) E854A possibly damaging Het
Stx7 A G 10: 24,060,977 (GRCm39) probably benign Het
Styk1 A T 6: 131,278,693 (GRCm39) probably benign Het
Tmem163 T G 1: 127,596,374 (GRCm39) probably benign Het
Tmppe C CT 9: 114,233,707 (GRCm39) probably null Het
Tmx2 A G 2: 84,503,426 (GRCm39) V229A probably benign Het
Top2b T C 14: 16,383,174 (GRCm38) L54P probably damaging Het
Trim62 A T 4: 128,796,343 (GRCm39) Y280F probably benign Het
Tssk4 A T 14: 55,889,016 (GRCm39) K181* probably null Het
Tssk4 A T 14: 55,889,017 (GRCm39) K181M probably damaging Het
Ubn1 A G 16: 4,882,478 (GRCm39) D313G probably damaging Het
Ugt1a10 C T 1: 88,142,845 (GRCm39) P113L probably damaging Het
Ugt1a10 C T 1: 88,145,971 (GRCm39) P473L probably damaging Het
Other mutations in Cc2d2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00392:Cc2d2a APN 5 43,881,722 (GRCm39) splice site probably benign
IGL00937:Cc2d2a APN 5 43,845,464 (GRCm39) critical splice acceptor site probably null
IGL01322:Cc2d2a APN 5 43,846,345 (GRCm39) missense probably benign 0.00
IGL01349:Cc2d2a APN 5 43,881,126 (GRCm39) missense probably benign 0.01
IGL01448:Cc2d2a APN 5 43,841,527 (GRCm39) missense possibly damaging 0.65
IGL01871:Cc2d2a APN 5 43,846,311 (GRCm39) missense probably damaging 0.98
IGL01947:Cc2d2a APN 5 43,845,579 (GRCm39) missense probably damaging 0.96
IGL01976:Cc2d2a APN 5 43,840,457 (GRCm39) missense probably benign 0.02
IGL02113:Cc2d2a APN 5 43,842,590 (GRCm39) splice site probably null
IGL02364:Cc2d2a APN 5 43,892,792 (GRCm39) missense probably damaging 1.00
IGL02448:Cc2d2a APN 5 43,840,547 (GRCm39) splice site probably benign
IGL02458:Cc2d2a APN 5 43,875,896 (GRCm39) missense probably benign 0.01
IGL02542:Cc2d2a APN 5 43,846,252 (GRCm39) splice site probably benign
IGL02834:Cc2d2a APN 5 43,871,863 (GRCm39) nonsense probably null
IGL02940:Cc2d2a APN 5 43,885,636 (GRCm39) splice site probably null
IGL03003:Cc2d2a APN 5 43,828,608 (GRCm39) missense probably benign 0.22
IGL03183:Cc2d2a APN 5 43,889,721 (GRCm39) missense probably damaging 1.00
C9142:Cc2d2a UTSW 5 43,892,799 (GRCm39) splice site probably benign
P0028:Cc2d2a UTSW 5 43,841,541 (GRCm39) missense probably benign
R0193:Cc2d2a UTSW 5 43,893,460 (GRCm39) missense probably damaging 1.00
R0211:Cc2d2a UTSW 5 43,845,608 (GRCm39) splice site probably null
R0243:Cc2d2a UTSW 5 43,853,980 (GRCm39) splice site probably benign
R0317:Cc2d2a UTSW 5 43,864,243 (GRCm39) critical splice donor site probably null
R0453:Cc2d2a UTSW 5 43,860,636 (GRCm39) missense probably benign 0.00
R0558:Cc2d2a UTSW 5 43,881,729 (GRCm39) splice site probably benign
R0624:Cc2d2a UTSW 5 43,887,371 (GRCm39) missense probably benign
R0634:Cc2d2a UTSW 5 43,838,723 (GRCm39) splice site probably benign
R1503:Cc2d2a UTSW 5 43,852,581 (GRCm39) missense probably damaging 1.00
R1635:Cc2d2a UTSW 5 43,879,812 (GRCm39) missense probably damaging 1.00
R1686:Cc2d2a UTSW 5 43,896,713 (GRCm39) missense possibly damaging 0.81
R1707:Cc2d2a UTSW 5 43,881,030 (GRCm39) splice site probably null
R1715:Cc2d2a UTSW 5 43,876,003 (GRCm39) missense probably damaging 0.97
R1765:Cc2d2a UTSW 5 43,871,873 (GRCm39) missense probably damaging 0.99
R1794:Cc2d2a UTSW 5 43,845,594 (GRCm39) missense probably damaging 1.00
R1881:Cc2d2a UTSW 5 43,898,170 (GRCm39) missense probably damaging 0.99
R1917:Cc2d2a UTSW 5 43,863,564 (GRCm39) missense probably damaging 1.00
R2005:Cc2d2a UTSW 5 43,883,715 (GRCm39) critical splice donor site probably null
R2201:Cc2d2a UTSW 5 43,841,375 (GRCm39) splice site probably benign
R2244:Cc2d2a UTSW 5 43,889,775 (GRCm39) missense probably damaging 1.00
R2368:Cc2d2a UTSW 5 43,861,230 (GRCm39) missense probably benign
R2442:Cc2d2a UTSW 5 43,828,647 (GRCm39) critical splice donor site probably null
R2511:Cc2d2a UTSW 5 43,892,737 (GRCm39) missense probably damaging 0.99
R3023:Cc2d2a UTSW 5 43,842,593 (GRCm39) splice site probably null
R3147:Cc2d2a UTSW 5 43,866,497 (GRCm39) missense probably damaging 1.00
R3148:Cc2d2a UTSW 5 43,866,497 (GRCm39) missense probably damaging 1.00
R3426:Cc2d2a UTSW 5 43,893,451 (GRCm39) missense probably benign 0.00
R3609:Cc2d2a UTSW 5 43,869,668 (GRCm39) missense probably damaging 0.99
R3610:Cc2d2a UTSW 5 43,869,668 (GRCm39) missense probably damaging 0.99
R3611:Cc2d2a UTSW 5 43,869,668 (GRCm39) missense probably damaging 0.99
R3839:Cc2d2a UTSW 5 43,876,056 (GRCm39) missense probably benign
R3870:Cc2d2a UTSW 5 43,876,033 (GRCm39) nonsense probably null
R4334:Cc2d2a UTSW 5 43,840,476 (GRCm39) missense probably benign 0.00
R4913:Cc2d2a UTSW 5 43,896,665 (GRCm39) missense probably benign 0.12
R5179:Cc2d2a UTSW 5 43,845,563 (GRCm39) missense possibly damaging 0.82
R5315:Cc2d2a UTSW 5 43,877,775 (GRCm39) missense probably damaging 0.99
R5352:Cc2d2a UTSW 5 43,863,555 (GRCm39) missense probably damaging 1.00
R5386:Cc2d2a UTSW 5 43,887,383 (GRCm39) missense probably benign 0.01
R5538:Cc2d2a UTSW 5 43,852,518 (GRCm39) missense possibly damaging 0.94
R5568:Cc2d2a UTSW 5 43,866,433 (GRCm39) missense probably damaging 0.99
R5618:Cc2d2a UTSW 5 43,887,249 (GRCm39) missense probably benign 0.00
R5653:Cc2d2a UTSW 5 43,879,804 (GRCm39) missense possibly damaging 0.81
R5817:Cc2d2a UTSW 5 43,869,760 (GRCm39) missense probably damaging 1.00
R5858:Cc2d2a UTSW 5 43,873,117 (GRCm39) missense probably damaging 1.00
R5905:Cc2d2a UTSW 5 43,869,768 (GRCm39) missense probably benign
R5912:Cc2d2a UTSW 5 43,877,772 (GRCm39) missense probably damaging 0.97
R6073:Cc2d2a UTSW 5 43,887,317 (GRCm39) missense probably damaging 1.00
R6084:Cc2d2a UTSW 5 43,826,015 (GRCm39) missense probably benign
R6142:Cc2d2a UTSW 5 43,860,540 (GRCm39) missense probably damaging 0.97
R6176:Cc2d2a UTSW 5 43,866,455 (GRCm39) missense probably benign 0.32
R6238:Cc2d2a UTSW 5 43,828,577 (GRCm39) missense probably benign 0.11
R6381:Cc2d2a UTSW 5 43,873,118 (GRCm39) missense possibly damaging 0.69
R6404:Cc2d2a UTSW 5 43,861,416 (GRCm39) missense possibly damaging 0.58
R6455:Cc2d2a UTSW 5 43,896,754 (GRCm39) missense possibly damaging 0.69
R6695:Cc2d2a UTSW 5 43,876,019 (GRCm39) missense probably damaging 0.99
R6805:Cc2d2a UTSW 5 43,838,673 (GRCm39) missense probably damaging 1.00
R6919:Cc2d2a UTSW 5 43,860,557 (GRCm39) missense probably benign 0.19
R6970:Cc2d2a UTSW 5 43,875,927 (GRCm39) missense probably damaging 1.00
R7024:Cc2d2a UTSW 5 43,891,271 (GRCm39) missense probably benign 0.10
R7054:Cc2d2a UTSW 5 43,857,321 (GRCm39) nonsense probably null
R7071:Cc2d2a UTSW 5 43,866,455 (GRCm39) missense probably benign 0.13
R7098:Cc2d2a UTSW 5 43,840,481 (GRCm39) missense probably benign 0.00
R7366:Cc2d2a UTSW 5 43,887,332 (GRCm39) missense probably damaging 1.00
R7908:Cc2d2a UTSW 5 43,864,188 (GRCm39) missense probably benign 0.00
R7920:Cc2d2a UTSW 5 43,896,651 (GRCm39) missense probably benign 0.09
R7950:Cc2d2a UTSW 5 43,852,638 (GRCm39) critical splice donor site probably null
R8007:Cc2d2a UTSW 5 43,863,442 (GRCm39) missense possibly damaging 0.71
R8117:Cc2d2a UTSW 5 43,869,781 (GRCm39) missense probably damaging 1.00
R8123:Cc2d2a UTSW 5 43,867,896 (GRCm39) missense probably benign
R8179:Cc2d2a UTSW 5 43,857,295 (GRCm39) missense probably damaging 0.96
R8279:Cc2d2a UTSW 5 43,893,487 (GRCm39) missense probably benign 0.01
R8293:Cc2d2a UTSW 5 43,845,570 (GRCm39) missense probably damaging 0.97
R8480:Cc2d2a UTSW 5 43,842,486 (GRCm39) splice site probably null
R8482:Cc2d2a UTSW 5 43,852,581 (GRCm39) missense probably damaging 1.00
R8731:Cc2d2a UTSW 5 43,892,788 (GRCm39) missense probably damaging 1.00
R8780:Cc2d2a UTSW 5 43,896,692 (GRCm39) missense probably damaging 1.00
R8784:Cc2d2a UTSW 5 43,860,645 (GRCm39) missense possibly damaging 0.90
R8871:Cc2d2a UTSW 5 43,857,285 (GRCm39) missense possibly damaging 0.71
R8972:Cc2d2a UTSW 5 43,867,884 (GRCm39) missense probably benign
R9122:Cc2d2a UTSW 5 43,831,081 (GRCm39) missense probably null 0.07
R9125:Cc2d2a UTSW 5 43,860,563 (GRCm39) missense probably benign
R9203:Cc2d2a UTSW 5 43,891,179 (GRCm39) missense probably benign 0.01
R9310:Cc2d2a UTSW 5 43,852,488 (GRCm39) missense probably damaging 1.00
R9343:Cc2d2a UTSW 5 43,875,999 (GRCm39) missense probably damaging 1.00
R9353:Cc2d2a UTSW 5 43,860,691 (GRCm39) critical splice donor site probably null
Z1177:Cc2d2a UTSW 5 43,860,546 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- GGCAACAGTGAGTCCACAACCTTAG -3'
(R):5'- GTGTCATGCAATATGCGACACTTCC -3'

Sequencing Primer
(F):5'- gcagaggacttagcacacac -3'
(R):5'- ATATGCGACACTTCCTTCATTTGAG -3'
Posted On 2013-04-16