Incidental Mutation 'R2141:Rai1'
ID236280
Institutional Source Beutler Lab
Gene Symbol Rai1
Ensembl Gene ENSMUSG00000062115
Gene Nameretinoic acid induced 1
SynonymsGt1
MMRRC Submission 040144-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2141 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location60105013-60199197 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 60189467 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 1452 (S1452R)
Ref Sequence ENSEMBL: ENSMUSP00000126183 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064190] [ENSMUST00000090806] [ENSMUST00000102688] [ENSMUST00000132012] [ENSMUST00000171108]
Predicted Effect possibly damaging
Transcript: ENSMUST00000064190
AA Change: S1452R

PolyPhen 2 Score 0.937 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000070896
Gene: ENSMUSG00000062115
AA Change: S1452R

DomainStartEndE-ValueType
low complexity region 55 69 N/A INTRINSIC
low complexity region 115 129 N/A INTRINSIC
low complexity region 168 175 N/A INTRINSIC
low complexity region 294 304 N/A INTRINSIC
low complexity region 322 336 N/A INTRINSIC
low complexity region 409 424 N/A INTRINSIC
low complexity region 699 708 N/A INTRINSIC
low complexity region 836 842 N/A INTRINSIC
low complexity region 1015 1030 N/A INTRINSIC
low complexity region 1049 1064 N/A INTRINSIC
low complexity region 1084 1102 N/A INTRINSIC
low complexity region 1262 1272 N/A INTRINSIC
low complexity region 1375 1388 N/A INTRINSIC
low complexity region 1455 1465 N/A INTRINSIC
low complexity region 1499 1515 N/A INTRINSIC
low complexity region 1597 1609 N/A INTRINSIC
low complexity region 1680 1690 N/A INTRINSIC
low complexity region 1714 1732 N/A INTRINSIC
PHD 1838 1885 3.59e-6 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000090806
AA Change: S1452R

PolyPhen 2 Score 0.937 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000088315
Gene: ENSMUSG00000062115
AA Change: S1452R

DomainStartEndE-ValueType
low complexity region 55 69 N/A INTRINSIC
low complexity region 115 129 N/A INTRINSIC
low complexity region 168 175 N/A INTRINSIC
low complexity region 294 304 N/A INTRINSIC
low complexity region 322 336 N/A INTRINSIC
low complexity region 409 424 N/A INTRINSIC
low complexity region 699 708 N/A INTRINSIC
low complexity region 836 842 N/A INTRINSIC
low complexity region 1015 1030 N/A INTRINSIC
low complexity region 1049 1064 N/A INTRINSIC
low complexity region 1084 1102 N/A INTRINSIC
low complexity region 1262 1272 N/A INTRINSIC
low complexity region 1375 1388 N/A INTRINSIC
low complexity region 1455 1465 N/A INTRINSIC
low complexity region 1499 1515 N/A INTRINSIC
low complexity region 1597 1609 N/A INTRINSIC
low complexity region 1680 1690 N/A INTRINSIC
low complexity region 1714 1732 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000102688
AA Change: S1452R

PolyPhen 2 Score 0.937 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000099749
Gene: ENSMUSG00000062115
AA Change: S1452R

DomainStartEndE-ValueType
low complexity region 55 69 N/A INTRINSIC
low complexity region 115 129 N/A INTRINSIC
low complexity region 168 175 N/A INTRINSIC
low complexity region 294 304 N/A INTRINSIC
low complexity region 322 336 N/A INTRINSIC
low complexity region 409 424 N/A INTRINSIC
low complexity region 699 708 N/A INTRINSIC
low complexity region 836 842 N/A INTRINSIC
low complexity region 1015 1030 N/A INTRINSIC
low complexity region 1049 1064 N/A INTRINSIC
low complexity region 1084 1102 N/A INTRINSIC
low complexity region 1262 1272 N/A INTRINSIC
low complexity region 1375 1388 N/A INTRINSIC
low complexity region 1455 1465 N/A INTRINSIC
low complexity region 1499 1515 N/A INTRINSIC
low complexity region 1597 1609 N/A INTRINSIC
low complexity region 1680 1690 N/A INTRINSIC
low complexity region 1714 1732 N/A INTRINSIC
PHD 1838 1885 3.59e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000132012
SMART Domains Protein: ENSMUSP00000118543
Gene: ENSMUSG00000062115

DomainStartEndE-ValueType
low complexity region 55 69 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149770
Predicted Effect possibly damaging
Transcript: ENSMUST00000171108
AA Change: S1452R

PolyPhen 2 Score 0.937 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000126183
Gene: ENSMUSG00000062115
AA Change: S1452R

DomainStartEndE-ValueType
low complexity region 55 69 N/A INTRINSIC
low complexity region 115 129 N/A INTRINSIC
low complexity region 168 175 N/A INTRINSIC
low complexity region 294 304 N/A INTRINSIC
low complexity region 322 336 N/A INTRINSIC
low complexity region 409 424 N/A INTRINSIC
low complexity region 699 708 N/A INTRINSIC
low complexity region 836 842 N/A INTRINSIC
low complexity region 1015 1030 N/A INTRINSIC
low complexity region 1049 1064 N/A INTRINSIC
low complexity region 1084 1102 N/A INTRINSIC
low complexity region 1262 1272 N/A INTRINSIC
low complexity region 1375 1388 N/A INTRINSIC
low complexity region 1455 1465 N/A INTRINSIC
low complexity region 1499 1515 N/A INTRINSIC
low complexity region 1597 1609 N/A INTRINSIC
low complexity region 1680 1690 N/A INTRINSIC
low complexity region 1714 1732 N/A INTRINSIC
PHD 1838 1885 3.59e-6 SMART
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency 97% (107/110)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is located within the Smith-Magenis syndrome region on chromosome 17. It is highly similar to its mouse counterpart and is expressed at high levels mainly in neuronal tissues. The protein encoded by this gene includes a polymorphic polyglutamine tract in the N-terminal domain. Expression of the mouse counterpart in neurons is induced by retinoic acid. This gene is associated with both the severity of the phenotype and the response to medication in schizophrenic patients. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions of this gene usually die as embryos. Survivors have shortened life spans and show severe craniofacial and axial skeleton defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 103 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810065E05Rik G T 11: 58,423,926 C150F probably damaging Het
4932431P20Rik T C 7: 29,531,510 noncoding transcript Het
Aagab T A 9: 63,616,675 probably null Het
Abca15 A C 7: 120,407,474 T1654P probably damaging Het
Abca17 T A 17: 24,334,266 Y157F probably benign Het
Aftph A T 11: 20,698,318 L813* probably null Het
Agap1 T C 1: 89,837,755 I615T probably damaging Het
Ak3 T G 19: 29,022,847 Q221H probably benign Het
Aldoa A G 7: 126,797,642 probably null Het
Anxa8 T C 14: 34,091,916 probably null Het
Baz2a A G 10: 128,123,612 D1329G probably damaging Het
Capn9 G A 8: 124,605,711 G430R possibly damaging Het
Cd55 C T 1: 130,449,423 V333I probably benign Het
Cep70 A G 9: 99,296,385 Y512C probably damaging Het
Cfhr2 T G 1: 139,831,155 R52S probably benign Het
Clcn6 A G 4: 148,024,137 F145S possibly damaging Het
Cnksr1 A G 4: 134,229,628 Y488H probably damaging Het
Diablo A G 5: 123,523,361 V24A probably benign Het
Dnah7b T A 1: 46,268,670 M3048K probably damaging Het
Dsel T C 1: 111,859,457 N1116S probably benign Het
Efnb1 A G X: 99,147,517 Y343C probably damaging Het
Esco1 A G 18: 10,574,873 probably null Het
Fam173b T C 15: 31,609,572 F146L probably benign Het
Fam26f G T 10: 34,127,695 A72E probably damaging Het
Fancd2 A G 6: 113,549,321 N335S probably benign Het
Flnc A G 6: 29,448,675 Y1304C probably damaging Het
Fubp3 A G 2: 31,600,557 probably benign Het
Gemin4 G C 11: 76,211,050 P962A probably damaging Het
Gjc3 A C 5: 137,957,546 L159R probably damaging Het
Gli1 A G 10: 127,336,727 L182P probably damaging Het
Gm21957 G T 7: 125,219,453 noncoding transcript Het
Gm28040 AGTG AGTGGCACCTTTGGTG 1: 133,327,321 probably benign Het
Gm4907 T A X: 23,907,310 V350E probably benign Het
Gm5885 A G 6: 133,529,275 noncoding transcript Het
Gm8989 T A 7: 106,329,956 T245S probably damaging Het
Gon4l A T 3: 88,887,595 T402S possibly damaging Het
Gprasp1 G A X: 135,802,042 E995K possibly damaging Het
Helb A T 10: 120,106,021 M254K possibly damaging Het
Ift20 G A 11: 78,540,034 E68K probably damaging Het
Igfn1 AGGG AGG 1: 135,974,852 probably benign Het
Impdh2 A G 9: 108,565,347 E305G possibly damaging Het
Ints7 T A 1: 191,604,860 C351S possibly damaging Het
Ipo9 ATCCTCCTCCTCCTCCTC ATCCTCCTCCTCCTCCTCCTC 1: 135,386,268 probably benign Het
Ipo9 A G 1: 135,402,250 V484A probably benign Het
Kcnq3 T C 15: 65,995,851 M648V probably benign Het
Kctd16 A G 18: 40,259,178 E273G possibly damaging Het
Kif18a T A 2: 109,333,503 N732K probably benign Het
Kif21b C T 1: 136,152,264 R513W probably damaging Het
Klhl36 T C 8: 119,876,772 C589R possibly damaging Het
Lck A G 4: 129,548,920 Y481H probably damaging Het
Lmtk2 A G 5: 144,147,615 Y156C probably damaging Het
Mical3 A T 6: 121,031,134 probably null Het
Mki67 A G 7: 135,695,592 I2571T possibly damaging Het
Mx2 G A 16: 97,538,703 E20K probably benign Het
Myo10 A G 15: 25,714,108 E87G probably benign Het
Myo18b T C 5: 112,874,026 K500R probably benign Het
N4bp2l2 A T 5: 150,647,536 I458N probably damaging Het
Nat10 T C 2: 103,731,303 probably null Het
Nfasc G A 1: 132,596,645 P932L probably damaging Het
Nipa1 C A 7: 55,997,511 probably null Het
Nkpd1 A G 7: 19,524,237 Q647R probably damaging Het
Nlrc4 T A 17: 74,447,951 probably benign Het
Nmbr C A 10: 14,770,442 Y353* probably null Het
Nos1ap T A 1: 170,329,166 D241V probably damaging Het
Obsl1 G A 1: 75,486,756 T1764M probably benign Het
Olfr1025-ps1 A G 2: 85,918,827 I301V probably null Het
Olfr1173 A G 2: 88,275,010 V13A probably benign Het
Olfr1289 A T 2: 111,483,630 T95S probably benign Het
Olfr770 A G 10: 129,133,006 I254T probably benign Het
Optc A T 1: 133,903,796 probably null Het
Pank1 G A 19: 34,878,980 R33C possibly damaging Het
Pcmtd1 C T 1: 7,169,565 R77C probably damaging Het
Phkg2 G A 7: 127,582,214 probably null Het
Plcb4 G A 2: 135,976,099 V762M probably damaging Het
Pramel7 T A 2: 87,489,977 H324L probably damaging Het
Prelp C T 1: 133,915,131 R92K probably benign Het
Ren1 C G 1: 133,350,778 probably null Het
Rev3l T C 10: 39,848,049 V785A probably benign Het
Rufy2 G T 10: 62,990,994 R104L probably damaging Het
Senp6 T A 9: 80,123,820 N8K probably damaging Het
Sept4 A T 11: 87,583,436 Q60L probably benign Het
Sipa1l2 G A 8: 125,491,491 P369L probably benign Het
Slc43a1 T C 2: 84,840,961 L37P probably damaging Het
Slf1 T A 13: 77,049,219 probably null Het
Ssr2 T A 3: 88,576,642 probably benign Het
Syt2 ACTCTCTCT ACTCTCTCTCT 1: 134,746,741 probably benign Het
Tas2r115 T C 6: 132,737,358 K210R probably benign Het
Tbx18 A G 9: 87,715,653 V276A probably damaging Het
Tie1 G A 4: 118,472,811 R1072* probably null Het
Tm2d2 C A 8: 25,022,658 T174K probably damaging Het
Tmem98 A G 11: 80,814,332 D82G possibly damaging Het
Tmub2 A G 11: 102,287,553 E94G possibly damaging Het
Tnnt2 TG TGG 1: 135,846,761 probably benign Het
Tonsl A T 15: 76,632,661 I923N probably damaging Het
Trove2 T C 1: 143,760,034 D458G probably benign Het
Ttc21a G A 9: 119,964,295 V977M probably damaging Het
Ube2ql1 T C 13: 69,738,664 D226G probably damaging Het
Ubr4 C T 4: 139,477,207 T4810M probably damaging Het
Zadh2 T C 18: 84,094,543 Y115H probably benign Het
Zfp408 A G 2: 91,647,849 probably benign Het
Zfp473 T C 7: 44,733,077 T610A possibly damaging Het
Zfp804b A G 5: 6,772,583 V160A probably benign Het
Zfp960 A G 17: 17,087,884 T287A probably benign Het
Other mutations in Rai1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00232:Rai1 APN 11 60185391 missense probably damaging 1.00
IGL00952:Rai1 APN 11 60187992 nonsense probably null
IGL01118:Rai1 APN 11 60187438 missense probably damaging 0.98
IGL02540:Rai1 APN 11 60186924 missense probably benign 0.09
IGL02624:Rai1 APN 11 60188743 missense probably damaging 1.00
IGL02696:Rai1 APN 11 60193956 missense probably benign
IGL02940:Rai1 APN 11 60187018 missense probably benign 0.03
IGL02970:Rai1 APN 11 60185733 missense probably damaging 1.00
IGL03006:Rai1 APN 11 60188205 missense possibly damaging 0.95
R0557:Rai1 UTSW 11 60190495 missense probably benign 0.00
R1438:Rai1 UTSW 11 60185395 missense probably benign 0.00
R1712:Rai1 UTSW 11 60187602 missense probably benign
R1837:Rai1 UTSW 11 60189398 missense probably damaging 1.00
R1899:Rai1 UTSW 11 60185920 missense probably benign 0.16
R2024:Rai1 UTSW 11 60185589 missense probably damaging 0.99
R2168:Rai1 UTSW 11 60187596 missense probably benign 0.01
R2404:Rai1 UTSW 11 60189924 missense probably benign
R4869:Rai1 UTSW 11 60186762 missense probably damaging 1.00
R4894:Rai1 UTSW 11 60186746 missense probably damaging 1.00
R5082:Rai1 UTSW 11 60185919 missense possibly damaging 0.48
R5093:Rai1 UTSW 11 60188656 missense probably benign 0.00
R5221:Rai1 UTSW 11 60190597 missense probably damaging 1.00
R5503:Rai1 UTSW 11 60186453 missense probably benign 0.00
R5587:Rai1 UTSW 11 60189859 missense probably damaging 1.00
R5849:Rai1 UTSW 11 60190521 missense possibly damaging 0.90
R5914:Rai1 UTSW 11 60187804 missense probably benign
R5950:Rai1 UTSW 11 60187593 missense probably damaging 1.00
R6111:Rai1 UTSW 11 60187906 missense probably damaging 0.99
R6450:Rai1 UTSW 11 60186603 missense probably benign 0.30
R6785:Rai1 UTSW 11 60188794 missense probably benign
R6889:Rai1 UTSW 11 60185715 missense probably damaging 1.00
R7296:Rai1 UTSW 11 60188673 missense probably benign 0.39
R7388:Rai1 UTSW 11 60189375 missense possibly damaging 0.46
R8196:Rai1 UTSW 11 60185970 missense probably damaging 1.00
X0018:Rai1 UTSW 11 60186436 missense probably benign 0.03
X0019:Rai1 UTSW 11 60189940 missense probably benign 0.14
X0024:Rai1 UTSW 11 60187395 missense possibly damaging 0.65
Predicted Primers PCR Primer
(F):5'- CAAAGCTGAGGCCTTCATGTCC -3'
(R):5'- TTTCAGGCTCTGCAGGATCC -3'

Sequencing Primer
(F):5'- TTCATGTCCCCGGAGACC -3'
(R):5'- AGTGGCACGTCCCTTACAG -3'
Posted On2014-10-01